• No results found

Adeno-Associated Virus Type 2 p5 Promoter: a Rep-Regulated DNA Switch Element Functioning in Transcription, Replication, and Site-Specific Integration

N/A
N/A
Protected

Academic year: 2019

Share "Adeno-Associated Virus Type 2 p5 Promoter: a Rep-Regulated DNA Switch Element Functioning in Transcription, Replication, and Site-Specific Integration"

Copied!
10
0
0

Loading.... (view fulltext now)

Full text

(1)

0022-538X/07/$08.00⫹0 doi:10.1128/JVI.02693-06

Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Adeno-Associated Virus Type 2 p5 Promoter: a Rep-Regulated DNA

Switch Element Functioning in Transcription, Replication, and

Site-Specific Integration

Mary Murphy,† Janette Gomos-Klein,†‡ Marko Stankic, and Erik Falck-Pedersen*

Weill Medical College of Cornell University, Hearst Research Foundation, Department of Microbiology and Immunology, Molecular Biology Graduate Program, New York, New York 10021

Received 6 December 2006/Accepted 24 January 2007

The large Rep proteins, p68 and p78, function as master controllers of the adeno-associated virus type 2 (AAV2) life cycle, involved in transcriptional control, in latency, in rescue, and in viral DNA replication. The p5 promoter may be the nucleic acid complement to the large Rep proteins. It drives expression of the large Rep proteins, it undergoes autoregulation by Rep, it undergoes induction by helper virus, it is a target substrate for Rep-mediated site-specific integration (RMSSI), and it can function as a replicative origin. To better understand the relationship between each of the p5 functions, we have determined the effects of p5 promoter mutations (p5 integration efficiency element, or p5IEE) on transcription, integra-tion, and replication using RMSSI transfection protocols in HeLa cells. The data demonstrate that the organization of the p5 promoter provides a unique platform for regulated AAV2 template transcription and subsequent repression by Rep through direct and indirect mechanisms. The elements of the p5IEE that define its function as a promoter also define its function as a highly optimized substrate for Rep-mediated site-specific integration and replication. The p5 Rep binding element (RBE) is essential in RMSSI and Rep-dependent replication; however, replacement of the p5 RBE with either the AAV2 inverted terminal repeat or the AAVS1 RBE sequence elements neither enhances nor severely compromises RMSSI

activity of p5IEE. The RBE by itself or in combination with the YY11 initiator/terminal resolution

sequence element does not mediate efficient site-specific integration. We found that replication and

integration were highly sensitive to sequence manipulations of the p5 TATA/RBE/YY11 core structure in

a manner that reflects the function of these elements in transcription. The data presented support a model where, depending on the state of the cell (Rep expression and helper virus influences), the p5IEE operates as a transcription/integration switch sequence element.

Adeno-associated virus type 2 (AAV2) is a nonpathogenic single-stranded DNA parvovirus that requires coinfection with a helper virus (adenovirus [Ad] or herpes virus) to stimulate progression through the viral replicative cycle. The Ad helper virus expresses the immediate early E1A gene products which have been shown to transactivate the AAV2 p5 promoter (1, 2), resulting in expression of two alternatively spliced p5 tran-scripts that yield the p68 and p78 (p68/78) Rep polypeptides (8, 33). The large Rep polypeptides possess endonuclease, heli-case, and ATPase enzymatic activities (reviewed in reference 21). In addition to enzymatic properties, the N-terminal do-main of Rep p68/78 has sequence-specific DNA binding capa-bilities that recognize a GAGC sequence motif (3, 18, 24, 28). This motif is imperfectly repeated four times in the AAV2 origin element located in the hairpin inverted terminal repeat (ITR) present at both ends of the viral genome (18, 24). Both the enzymatic and DNA binding functions of p68/78 are es-sential for full-length replication of the AAV2 genome (17,

24). Upregulation of p5 Rep expression and coincident expres-sion of helper virus gene products result in high levels of viral DNA replication and subsequent production of infectious vi-rions.

In the absence of a helper virus, AAV2 infection can result in a unique form of latency featuring preferential integration into the human genome at a site termed AAVS1 at human chromosome 19q13.4qter (13, 15). A 34-bp sequence located in the first exon of the myosin binding subunit 85 of protein phosphatase 1 (31) has been shown to be the minimal AAVS1 element required to target AAV2 DNA to this chromosomal location (15). Following localization to the AAVS1 site, a poorly understood mechanism involving nonhomologous re-combination mediates an integration event. However, this in-tegration event does not occur at a precise site within the AAVS1 region (reviewed in reference 19). The AAVS1 ele-ment is similar in organization to the AAV2 ITR origin and contains an imperfect tetrameric GAGC repeat element and a terminal resolution sequence (TRS) (15). The frequency of AAV2 integration into AAVS1 is influenced by viral dose and can be as high as 50% of infected cells at multiplicities of infection (MOIs) greater than 100 (7). Studies characterizing the kinetics of Rep-dependent integration reveal that integra-tion peaks within 24 to 48 h of infecintegra-tion (11, 12). Rescue of latently integrated virus occurs when cells are infected with helper virus and is thought to occur through activation of p5

* Corresponding author. Mailing address: Weill Medical College of Cornell University, Department of Microbiology and Immunology Box 62, 1300 York Ave., New York, NY 10021. Phone: (212) 746-6514. Fax: (212) 746-8587. E-mail: [email protected].

† M.M. and J.G.-K. contributed equally to this work.

‡ Present address: Department of Biological Sciences, City Univer-sity of New York, Hunter College, New York, NY 10021.

Published ahead of print on 31 January 2007.

3721

on November 8, 2019 by guest

http://jvi.asm.org/

(2)

toregulation. Low levels of Rep expression repress transcrip-tion from the p5 promoter (1, 10, 14, 25). Rep-mediated re-pression is thought to be the result of Rep binding to a Rep binding element (RBE) located between the TATA and YY1⫹1 site of the p5 promoter (14, 25). Rep also interacts with cellular transcription factors such as SP1, TATA binding protein (TBP), and PC4 (9, 25, 40) and indirectly influences expression at a variety of polymerase II (Pol II) promoters. Coincident with Rep-dependent repression of p5, recent stud-ies from our laboratory have shown that the p5 promoter functions as an important and primary target sequence for Rep-mediated site-specific integration (RMSSI) (27). In addi-tion to funcaddi-tioning as an RNA Pol II promoter and as a target substrate for RMSSI, the p5 integration efficiency element (p5IEE) can also serve as a Rep-dependent origin of DNA replication (5, 23, 32, 35, 37, 38). Located downstream of the p5 RBE is a TRS-like sequence (37) positioned within the YY1⫹1 site of the p5 element. When combined with the RBE and the TATA element (5), the p5 TRS can undergo Rep-dependent nicking and DNA amplification.

The versatility of the p5 element in transcription, integra-tion, and replication reflects the functional requirements of AAV2 during distinct stages of infection: primary infection in the absence of helper virus leading to latency, latency, rescue from latency, and primary infection in the presence of helper virus leading to productive infection. We have proposed a model where the p5 promoter, when undergoing Rep repres-sion, is converted from a transcription initiation complex into a structure that facilitates efficient Rep-dependent integration (7). In this study we show that mutations that influence the transcriptional activity of the p5 promoter also influence the ability of the p5IEE to act as a substrate for site-specific inte-gration and for DNA replication.

MATERIALS AND METHODS

Plasmid constructs. p5CAT (where CAT is chloramphenicol acetyltrans-ferase), pTRUF2, and pT7Rep78 were previously described (26). pCMVRep78 (where CMV is cytomegalovirus) was generated by PCR amplification of the Rep78 coding sequence and cloning into the pAdCMVHS cassette (26). In the p5CAT construct (Fig. 1A), the p5 promoter is flanked by a 5⬘NotI restriction site and an SrfI restriction site at the 3⬘end for cloning purposes. Oligonucle-otide-directed mutations were generated by PCR amplification and inserted into p5CAT at NotI and SrfI. All clones were sequenced to confirm sequence identity and integrity. Oligonucleotide sequences for individual constructs are available upon request.

Plasmid transfection.Plasmid DNA was electroporated into HeLa cells as previously described (27). Briefly, 6.4⫻106HeLa cells were electroporated with 15␮g of an integration target plasmid (p5CAT) and 15␮g of a Rep-expressing plasmid (pT7Rep) that also includes a CMV green fluorescent protein (CMVGFP) expression cassette. In the absence of a T7Rep78, a pCMVGFP plasmid was

labeled using a Rediprime kit (Amersham Pharmacia Biotech) according to the manufacturer’s instructions. An 800-bp CAT fragment was generated by PCR from the oligonucleotides GCTAGCTTGAGGTGTGGCAGGC and GGCAT GATGAACCTGAATCGC; a 1.9-kb AAVS1 PCR product was generated using the oligonucleotides GAACTCTGCCCTCTAACGCTGC and CACCAGATA AGGAATCTGCC (13, 34). Southern blots were visualized by autoradiography.

DNA replication assay.The procedure for our DNA replication assay is modeled after the established assay recently used by Francois et al. (5) with minor modifications. Plasmid transfections were as described above; 24 h post-transfection, cells were exposed to medium containing Ad type 2 ([Ad2]1,000 particles/cell; an MOI of⬃30) or treated medium. Infected and mock-treated cells were harvested between 60 and 72 h after Ad infection for total DNA as previously described. Purified DNA from each sample was digested with either Dpn I or MboI and separated by agarose gel electrophoresis as described above. p5CAT constructs digested with DpnI yield an 870-bp DNA fragment that hybridizes to the CAT probe described in the previous section. Digestion of pTRUF2 with DpnI results in a 542- and a 621-bp fragment when probed with a labeled SmaI-MfeI DNA fragment isolated from pTRUF2.

CAT assay.Transfected cells were harvested 48 h postelectroporation in TEN scrape buffer (40 mM Tris HCl, pH 7.4, 1 mM EDTA, 150 mM NaCl) and resuspended in 0.25 M Tris, pH 7.8. Lysates were subjected to three freeze-thaw cycles followed by a 10-min incubation at 65°C to inactivate cellular deacetylases. CAT activity assays were performed as previously described (6).

RESULTS

Rep-mediated site-specific integration and replication of

p5-containing plasmid DNA. In previous studies, we used a

p5CAT plasmid as a target substrate for site-specific integra-tion (27). The p5CAT construct (Fig. 1A) includes 103 bp of the AAV2 p5 promoter sequence (AAV2 nucleotides 189 to 292) (Fig. 1B) flanked by NotI and SrfI restriction sites for cloning purposes and drives expression of the bacterial CAT reporter gene. In the current study, for all integration assays, DNA from clonal isolates was first digested with a restriction enzyme that does not digest p5CAT (EcoRV or AVRII) and characterized by Southern analysis probing AAVS1 or CAT. An example of p5CAT integrants digested with EcoRV is depicted in Fig. 1D and E. EcoRV digestion releases a 5.4-kb genomic fragment surrounding the AAVS1 site in chromo-some 19 (Fig. 1C and D). Rep-mediated AAVS1 disruptions and integrations are identified as DNA fragments migrating well above the genomic AAVS1 5.4-kb fragment (Fig. 1D). When a parallel Southern blot was probed with a32P-labeled CAT DNA probe, bands that comigrate with AAVS1 disrup-tions (Fig. 1E) are indicative of site-specific integrants. For each cell line, a follow-up digest with BamHI which digests p5CAT and the genomic region of AAVS1 (7, 27; also data not shown) are used to confirm the observations made in the EcoRV digest. These are the criteria used to designate a par-ticular integrant as site specific.

In a typical experiment, approximately half of the cell lines that demonstrate a disruption of AAVS1 do not contain

on November 8, 2019 by guest

http://jvi.asm.org/

(3)

p5CAT DNA and represent unproductive disruptions. Occa-sionally, in cell lines containing p5CAT either there is no AAVS1 disruption or the p5CAT does not comigrate with AAVS1; these lines are identified as nonspecific integrants. With wild-type (wt) virus, up to 50% of infected cells undergo RMSSI, and the efficiency is very dependent on viral dose (7). When the plasmid transfection assay was used with low levels of Rep provided from pT7Rep78, the efficiency of RMSSI was between 10 and 20% of transfected cells. Integration assays carried out with pCMVRep78, providing a higher level of Rep expression, resulted in lower numbers of viable cell colonies (interpreted to be the result of cytotoxic effects of Rep) and no tangible enhancement of site-specific integration (data not shown). Thus, unregulated high levels of Rep expression do not translate into increased integration efficiencies or colony survival.

Since the p5IEE has been shown to function as an origin for DNA replication, we wanted to assess Rep-mediated replica-tion under the condireplica-tions used for site-specific integrareplica-tion using the p5CAT plasmid. To characterize Rep-dependent replication, an assay was established by cotransfecting a Rep-expressing plasmid and an AAV origin-containing plasmid in

HeLa cells, followed by helper virus infection. Replication of p5CAT was compared to replication originating from pTRUF2, which contains a rescuable ITR-flanked GFP Neo reporter cassette (42). Because pTRUF2 is a rescuable repli-cation substrate, it undergoes high levels of active replirepli-cation. Rep expression was derived from one of two plasmids: pCMVGFP-pT7Rep78, a low-level Rep-expressing struct, or pCMVRep78, a high-level Rep expression con-struct; pCMVGFP, a non-Rep-expressing plasmid, served as a negative control. Twenty-four hours posttransfection, cells were incubated with wt Ad2 (MOI of 30) or medium and allowed to undergo active replication for 60 to 72 h, at which time total DNA was harvested. Total DNA was digested by the restriction enzyme MboI or DpnI; both enzymes recognize a GATC sequence motif, but Dpn I specifically digests Dam-methylated DNA (generated when plasmids are grown in

[image:3.585.86.487.66.373.2]

Escherichia coliHB101), whereas MboI digests nonmethylated DNA. Plasmid DNA that is replicated in a mammalian cell is insensitive to DpnI digestion and vulnerable to MboI diges-tion. As indicated in ethidium bromide-stained agarose gels (Fig. 2B and D), cellular and adenoviral DNA are not digested by DpnI but are digested by MboI. Transfected plasmid DNA

FIG. 1. The p5IEE functions as a target for Rep-mediated site-specific integration. (A) Diagrammatic representation of the p5CAT plasmid used as a target substrate for replication and integration assays. The p5 element or p5IEE indicated in black is functioning as the promoter for the CAT reporter gene. The CAT coding region used for Southern analysis is indicated by shading, and the MboI restriction sites at 691 and 1561 are shown. (B) Sequence of the p5IEE flanked by NotI and SrfI restriction sites. (C) Restriction digestion map illustrating genomic sequence in the area of AAVS1. Map depicts genomic fragments for EcoRV and BamHI digests used to characterize AAVS1 disruptions and integrants and the AAVS1 genomic region used as a probe in Southern blot analysis. Representative Southern blots of genomic DNA from individual cell lines transfected with p5CAT and T7Rep78 6 weeks posttransfection, hybridized with AAVS1 probe (D) or CAT probe (E) are shown. Arrowheads at the bottom of panel E indicate lanes where restriction fragment bands revealed by both AAVS1 and CAT probes were found to comigrate.

on November 8, 2019 by guest

http://jvi.asm.org/

(4)

is not present in high enough concentration to be consistently identified by ethidium bromide staining (each transfection was done in duplicate). Southern blot analysis was used to detect pTRUF2 or p5CAT replication products (Fig. 2A and C, re-spectively). In the absence of Rep (CMVGFP), no replication of pTRUF2 occurs, whereas in the presence of pT7Rep78 and Ad2, low levels of replication are revealed. No detectable rep-lication occurs in the absence of Ad2. In contrast to the levels of pTRUF2 replication that results with pT7Rep78 as a source of Rep, pCMVRep78 results in 20- to 50-fold more replication product (Fig. 2A, compare boxed areas corresponding to pT7Rep78 and pCMVRep78). With pCMVRep78 there is no identifiable replication of pTRUF2 if helper Ad is not present. In contrast to high levels of replication occurring with pTRUF, p5CAT replication products were found at very low levels when cotransfected with pCMVRep78 and were not detected in the replication assays using pT7Rep78 (Fig. 2C). Under these assay conditions, the p5IEE functions as a modest sub-strate for DNA replication and requires high levels of Rep78 as well as Ad2 helper functions.

The p5 RBEYY11 origin-like element is not a sufficient

target substrate for RMSSI.The p5IEE contains a Rep

bind-ing site that consists of an imperfect tetrameric GAGC repeat

[image:4.585.46.538.68.376.2]

motif and a TRS that is just upstream in the YY1⫹1 site (Fig. 3A). We next asked if these elements by themselves could mimic the p5IEE as a promoter, as an integration substrate, or as a substrate for Rep-dependent replication. Transfection of p5CAT-derived plasmid DNA corresponding to a p5 RBE-only construct or a p5 RBE/YY1⫹1 construct was carried out in the presence or the absence of pT7Rep78 as previously described. Cell lysates were harvested after 48 h and assayed for expression of the CAT reporter gene. Data are presented as a percentage of wt p5CAT expression (Fig. 3B). CAT ex-pression from the pRBE-only construct is essentially at base-line levels and is not altered by the presence of Rep78. Ex-pression from pRBEYY1⫹1 is diminished compared to p5CAT but still represents a significant level of gene expres-sion that is sensitive to represexpres-sion by coexpresexpres-sion of Rep78. When the RBE-only or the RBEYY1⫹1 construct was used as a substrate for RMSSI, neither generated site-specific inte-grants (Fig. 3C). Rep-dependent DNA replication assays were carried out (Fig. 3D; only the MboI and DpnI products at 866 bp are shown), and the data indicate that no MboI digestion products were generated with either construct. Therefore, RBE-only and the RBEYY1⫹1 constructs did not support Rep-dependent replication. Based on these assays, the p5 RBE

FIG. 2. Replication of p5CAT in HeLa cells. Replication assay of the ITR-containing plasmid pTRUF or p5CAT, cotransfected with a control plasmid pCMVGFP, pT7Rep, or CMVRep, in the presence of wt Ad2 or mock (medium) helper virus infection. DNA harvested from duplicate transfections was digested with MboI or DpnI to identify replication products (MboI) or transfected plasmid (DpnI). (A) pTRUF2 replication products detected by Southern analysis when probed for pTRUF2 are indicated by arrows (542 and 621 bp). Boxed areas highlight the locations of expected Rep-dependent replication products. (B) Ethidium bromide staining of gel in panel A before transfer. (C) p5CAT replication products detected by Southern analysis when probed with CAT. The expected 861-bp replication product should be present within the boxed area. (D) Ethidium bromide staining of gel in panel C before transfer.

on November 8, 2019 by guest

http://jvi.asm.org/

(5)

alone cannot support transcription, integration, or the replica-tion funcreplica-tions associated with p5IEE. However, when the RBE is combined with the YY1⫹1 element, it can function as a Rep-sensitive promoter but not as a substrate for Rep-depen-dent integration or replication.

p5IEE RBE requirements for transcription, replication, and

integration.We next wanted to determine if the RBE of the

p5IEE was necessary for RMSSI. Using oligonucleotide-di-rected mutagenesis, a p5IEE RBE mutant (p5RBEmut) was generated that lacked a recognizable GAGC RBE binding domain (Fig. 4A). Additionally, a construct was generated that included an authentic p5IEE RBE sequence flanked upstream by an insertion of four base pairs (TTAA) between the TATA and RBE domains to generate a PacI site and downstream by a substitution of 2 bp and insertion of a single nucleotide between the RBE and YY1⫹1 site to generate a ClaI restric-tion site (p5RBEfix) (Fig. 4A). Each of these constructs was

used in assays assessing function in transcription, integration, and Rep-dependent replication. The p5RBEmut was compro-mised compared to p5CAT in the CAT assay (Fig. 4B), and consistent with the RBE’s playing an essential role in RMSSI, we found no site-specific integrants when the p5RBEmut was used in the integration assay (Fig. 4C). The RBE mutation also had a strong negative effect on replication (Fig. 4D). When the RBEmut sequence was replaced in p5RBEfix, we were sur-prised to find that promoter activity, Rep-dependent integra-tion, and Rep-dependent replication functions were all com-promised. To identify if either or both of the linker insertions were associated with the observed loss of p5IEE function, constructs containing only the PacI linker (p5PacRBE) or only the ClaI linker (p5ClaRBED) (Fig. 4A) were generated and characterized. Both of these plasmids partially restored pro-moter activity. p5PacRBE did not function as a substrate for site-specific integration or replication, whereas p5ClaRBE was

[image:5.585.46.545.479.687.2]

FIG. 3. Characterization of p5IEE origin elements associated with the RBE and the TRS site (YY1). Plasmids containing only the p5 RBEYY11 sequence region of p5 or only the p5 RBE (A) were analyzed for CAT expression following transient transfection in the absence (⫺Rep) or presence of Rep (⫹Rep) (B). Constructs were characterized for site-specific integration efficiency following transfection of each construct in the presence of T7Rep (C) and by a DNA replication assay (D) as described in the text.

FIG. 4. Characterization of p5IEE plasmids containing mutations in the RBE region. (A) Diagram of p5CAT constructs. The RBE was mutated to a non-Rep binding sequence (p5RBEmut), or a wt RBE was reinserted flanked by the restriction sites PacI and ClaI (p5RBEfix) or with PacI only (p5PacRBE) or ClaI only (p5ClaRBE). Constructs were characterized for CAT expression (⫹Rep or⫺Rep) (B) site-specific integration efficiency (C), or p5 replication function (D) as previously described.

on November 8, 2019 by guest

http://jvi.asm.org/

(6)

able to undergo site-specific integration and serve as a tem-plate for Rep-dependent replication. Therefore, perturbing the sequence at the TATA-RBE junction caused a severe repression of p5IEE integration/replication functions, whereas the sequence substitutions at the RBE-YY1⫹1 junction were tolerated in both of the assays.

The p5RBE is interchangeable with the AAVS1 or the

AAV-ITR RBEs.The p5IEE RBE sequence contains a single perfect

repeat of the GAGC Rep binding element and three imperfect repeats. We next asked if the nature of the RBE sequence used in the p5IEE element would either compromise or enhance the efficiency of RMSSI. The AAV2 ITR RBE element contains three perfect repeats of the GAGC motif and one imperfect element (Fig. 5A), whereas the AAVS1 RBE element contains a different organization of three perfect and one imperfect GAGC motif. Oligonucleotide-directed mutagenesis was used to replace the p5IEE RBE sequence with sequence corre-sponding to AAVS1 or AAV2 ITR RBE sequence elements. Exchange of the p5 RBE with AAVS1 or AAV ITR elements had no apparent effect on promoter activity, but there was a noticeable enhancement of Rep-mediated repression with both replacement constructs (Fig. 5B). Each replacement con-struct was able to support site-specific integration; however, there was a slight decrease in the efficiency of integration mediated by each of the replacement RBE elements (Fig. 5C). When assayed for Rep-dependent replication, the replacement constructs were as active in the replication assay as p5RBE. Each of the RBE replacement constructs is able to comple-ment the function of the p5RBE in transcription, integration, and replication; however, the subtle differences in our data indicate that the p5 RBE is a more desirable element for RMSSI whereas the consensus GAGC elements may be better suited for Rep-dependent replication.

Promoter sequence elements surrounding the RBE

contrib-ute to p5IEE function.We next generated a series of p5IEE

mutations to characterize how upstream transcription factor binding sites influence the biology of the p5 promoter. Muta-tions were generated that replaced the sequence of the USF (MLTF) binding site (yielding USFmt), the YY1-60 binding site (YY1-60mt), the TATA DNA element, and the YY1⫹1 initiator (YY1⫹1mt) (Fig. 6A). The p5RBEmut was included for comparative purposes. Compared to wt p5CAT, each

mu-tation resulted in a three- to fivefold decrease in CAT activity (Fig. 6B), with the YY1⫹1 mutant having the strongest overall effect. Interestingly, the USFmt, the YY1-60mt, the RBEmt, and the YY1⫹1mt retained sensitivity to Rep-mediated re-pression whereas the TATA mutation was essentially nonre-sponsive to coexpression of low levels of Rep78 (Fig. 6B). When each construct was characterized for RMSSI (Fig. 6C), p5RBEmut again did not function as a target substrate for RMSSI. The YY1⫹1mt and the TATA mutant were severely compromised with respect to the overall number of site-spe-cific integrants obtained, indicating the critical function these elements contribute to RMSSI. The YY1-60mt and the USFmt were able to mediate RMSSI at levels that were of intermedi-ate efficiency, not at wt levels but consistently above the levels obtained with the TATA or YY1⫹1 mutations. All of the constructs were compromised when assayed for Rep-depen-dent DNA replication, with the USFmt showing a low level of MboI product (compared to levels of DpnI-digested material) (Fig. 5D).

DISCUSSION

AAV2 is a relatively simple single-stranded DNA virus with a genome of 4,680 nucleotides that contains two open reading frames coding for the nonstructural Rep proteins and the structural Cap proteins. The large Rep proteins, p68 and p78, function as master controllers of the AAV2 life cycle, inti-mately involved in transcriptional control, in RMSSI, in rescue, and in viral DNA replication. The p5IEE is the nucleic acid complement to the Rep master controller. In this study we have used mutations of the p5IEE to develop insight into the functional transitions that occur at the p5IEE through its in-teraction with Rep68 and Rep78 that may lead to RMSSI.

In the absence of coinfecting helper virus, the p5 promoter is transcriptionally active, and deletions of the p5 element uniformly result in reduced levels of transgene expression (1). We have found that each of the p5 promoter elements identi-fied by Chang et al. (2) influences transcriptional activity under conditions of no helper virus and no Rep expression. Substi-tution mutations of the RBE, the TATA, the YY1⫹60, and the USF elements all resulted in an approximate two- to fivefold decrease in CAT expression (Fig. 6). These results are

consis-FIG. 5. Characterization of RBE replacement domains from AAVS1 and AAVITR in p5IEE. The p5 RBE was replaced with the RBE sequence present in the AAV2 ITR origin domain or the human chromosome 19 AAVS1 integration site RBE (A) and characterized for CAT activity in the presence (Rep) or absence (Rep) of T7Rep (B), site-specific integration efficiency with T7Rep (C), or DNA replication with CMVRep (D), as previously described.

on November 8, 2019 by guest

http://jvi.asm.org/

[image:6.585.43.541.64.197.2]
(7)

tent with the studies of Pereira et al. (25), who demonstrated that base substitutions in p5, when used to drive expression of Rep, had a generally negative impact on Rep mRNA levels. The data presented in our study are also consistent with the YY1⫹1 element’s functioning as an initiator of Pol II tran-scription. Mutations in this domain were severely compro-mised in our transient transfection CAT assays, and the YY1⫹1 element when combined with the RBE conferred tran-scriptional activity (Fig. 3). However, the presence of the up-stream elements clearly contributes to the activity of the p5 promoter. Recognizing that sequence replacement mutations

may have unidentified structural effects that influence tran-scription levels, we conclude that the overall integrity of the entire p5 element is important to expression in the absence of helper functions.

Following p5 promoter activation and transcription, the large Rep proteins are produced and bind to target sequence elements including the p5 promoter, the AAV2 ITR, and AAVS1. Rep binding to AAVS1 stimulates nicking, and lim-ited replication of this region and causes repression of the p5 promoter. By repressing further expression from p5, the win-dow of Rep-mediated functions is tightly controlled and

pre-FIG. 6. The role of p5IEE promoter elements in transcription, replication, and integration. The p5 promoter includes sequence elements associated with specific transcription factor binding sites as previously indicated. Constructs containing the indicated transcription factor binding site mutations (A) were constructed and characterized for promoter activity (B), for site-specific integration (C), or for Rep-dependent replication (D) carried out as previously described.

on November 8, 2019 by guest

http://jvi.asm.org/

[image:7.585.57.529.64.536.2]
(8)

sion. Because many of the constructs had reduced levels of CAT expression compared to the parental p5CAT, we are viewing Rep-mediated repression in a qualitative rather than quantitative manner.

We were initially surprised to find that the TATA binding element mutation rendered the p5 element relatively insensi-tive to Rep repression (Fig. 6B), whereas CAT assays of the pRBEYY1⫹1 construct (Fig. 3B) demonstrate a very high level of Rep sensitivity (in the absence of a TATA element). This apparent contradiction indicates the importance of con-text to the biology of the p5 promoter element and may be the result of both direct and indirect mechanisms of Rep inhibition operating on the p5IEE. Rep78 can form a complex with TBP (9), and the ability of Rep to complex with TBP negatively regulates expression from a number of promoters including the p97 promoter of human papillomavirus (29) and the major later promoter of Ad (22). In our mutant constructs, a TATA mutant was desensitized to Rep inhibition whereas an RBE mutant was still responsive to Rep inhibition. These observa-tions are consistent with Rep inhibition of p5IEE through an inhibitory TBP-Rep78 complex acting at the p5IEE TATA site. Consistent with this model, studies by Francois et al. (5) demonstrated an essential role for TBP binding to the p5 TATA in Rep-dependent replication at the p5 ori.

In a construct that contains only the initiator and the RBE element, we observed very strong Rep-mediated repression. We also found that replacement of the p5 RBE element with the ITR-RBE sequence or the AAVS1-RBE elements may have increased the sensitivity to Rep-dependent repression (Fig. 5). These data support the possible existence of two classes of Rep interaction with the p5 RBE element (direct and indirect), where the contextual arrangement of promoter ele-ments in the p5IEE are important to establishment of a specific type of Rep-responsive Pol II transcription initiation complex. Based on our current knowledge of Rep interaction with the p5 promoter, the next p5IEE transition could include Rep-mediated localization to AAVS1 (30, 41) and/or Rep-Rep-mediated nicking of the p5 promoter (5, 23, 32, 35, 37, 38). In the case of RMSSI, Rep levels are below those necessary to detect exten-sive replication, but clearly amplification of AAVS1 and the integrating genome occurs (7). In the absence of Ad helper virus, we could not detect replication with any of the constructs including pTRUF2. In the presence of helper virus, we could not detect p5 replication with low levels of Rep78. Since pT7Rep78 can mediate low levels of replication with ITR-containing plasmid pTRUF2, our inability to detect p5CAT replication may reflect a requirement for high levels of Rep to effect replication from p5, or it may represent an insensitivity of the assay used in these studies.

engineered to have a single base substitution and a single upstream substitution (GTATTTA3TTAATTAA; substitu-tions are in boldface and conserved sequence is underlined) transcription, integration, and replication were all severely compromised (data not shown). In contrast to the sensitivity of the TATA region to manipulation, when p5 RBE was replaced with the ITR RBE or the AAVS1 RBE, minimal impact on replication was detected. Although assay conditions used for p5CAT replication involved high levels of Rep78, the overall results were largely consistent with the assays used to charac-terize p5 promoter activity, and the results indicate that the overall integrity of the p5 promoter is important to mainte-nance of efficient p5 Rep-dependent ori function.

Is the Rep complex forming on the p5IEE under latency conditions able to nick and facilitate DNA replication through host DNA repair mechanisms? The observations that AAVS1 and integrating substrate DNA undergo amplification during RMSSI (7) would support such an event on both target and substrate DNAs. Importantly, we anticipate that the Rep endonuclease/replication complex that functions to facili-tate p5 RMSSI is not the same as that provided by helper virus infection during AAV2 replication and, specifically, not the one that forms on the AAV2 ITR ori, which is independent of a TBP-TATA interaction. Based on the data presented in this report, we find a strong correlation be-tween a transcriptionally active p5 promoter sensitive to Rep repression with a p5 element that functions in a Rep-dependent replication assay and in RMSSI.

Taken together, each of the Rep-dependent biological activities assigned to the p5 promoter are envisioned as contributing to efficient RMSSI. We consider four Rep-dependent activities as occurring in RMSSI. (i) Rep medi-ates activation of AAVS1. In vitro AAVS1 activation in-volves Rep-dependent nicking and asymmetric replication (36), consistent with Rep-dependent amplification of the AAVS1 site independent of an integration substrate. (ii) Rep needs to form an integration complex with the target substrate DNA. We believe the p5 promoter provides a specific DNA protein structure that is a landing pad for a Rep-TBP complex, and the interaction of this complex with the p5 promoter (nicking) establishes a preferred integra-tion/recombination substrate. (iii) Rep complex formation on the p5IEE facilitates colocalization to the Rep DNA complex formed on AAVS1 (30). (iv) Establishment of Rep-dependent nicking and replication functions on both the p5IEE and the AAVS1 facilitates a nonhomologous recom-bination event in the region of AAVS1.

All of the experiments carried out in this study have relied on plasmid-based transfection protocols focusing on the

on November 8, 2019 by guest

http://jvi.asm.org/

(9)

tion of a minimal p5IEE element. With this system, we found that the function of the p5IEE can be influenced by the DNA sequence and structure surrounding the p5IEE. The function of the p5IEE as presented in the wt AAV genome may also be influenced by surrounding elements, particularly the ITR ele-ments which are known to have enhancer function (4), and the nature of the viral genome presented as a single-stranded DNA undergoing conversion to a monomeric or dimeric du-plex structure. Studies using recombinant AAV vectors in RMSSI studies will provide valuable insight into how the p5IEE functions under conditions presented during viral in-fections.

If the p5IEE is to be used to facilitate RMSSI of a desig-nated transgene (16), the results presented in this study indi-cate that the original intact p5 or p5IEE element is the most efficient target substrate tested when Rep is expressed from a nonintegrating expression cassette. We are in the process of developing Rep expression cassettes that may offer a further enhancement of integration efficiency. Transient expression of an optimal level of Rep should allow integration efficiencies that approach those found in previous studies using high MOIs of AAV2 infection into HeLa cells (7) without causing a high level of cytotoxicity.

REFERENCES

1.Beaton, A., P. Palumbo, and K. I. Berns.1989. Expression from the adeno-associated virus p5 and p19 promoters is negatively regulated intransby the Rep protein. J. Virol.63:4450–4454.

2.Chang, L. S., Y. Shi, and T. Shenk.1989. Adeno-associated virus P5 pro-moter contains an adenovirus E1A-inducible element and a binding site for the major late transcription factor. J. Virol.63:3479–3488.

3.Chiorini, J. A., S. M. Wiener, R. A. Owens, S. R. Kyostio, R. M. Kotin, and B. Safer.1994. Sequence requirements for stable binding and function of Rep68 on the adeno-associated virus type 2 inverted terminal repeats. J. Vi-rol.68:7448–7457.

4.Flotte, T. R., R. Solow, R. A. Owens, S. Afione, P. L. Zeitlin, and B. J. Carter.

1992. Gene expression from adeno-associated virus vectors in airway epithe-lial cells. Am. J. Respir. Cell Mol. Biol.7:349–356.

5.Francois, A., M. Guilbaud, R. Awedikian, G. Chadeuf, P. Moullier, and A. Salvetti.2005. The cellular TATA binding protein is required for rep-de-pendent replication of a minimal adeno-associated virus type 2 p5 element. J. Virol.79:11082–11094.

6.Gall, J., A. Kass-Eisler, L. Leinwand, and E. Falck-Pedersen.1996. Adeno-virus type 5 and 7 capsid chimera: fiber replacement alters receptor tropism without affecting primary immune neutralization epitopes. J. Virol.70:2116– 2123.

7.Hamilton, H., J. Gomos, K. I. Berns, and E. Falck-Pedersen.2004. Adeno-associated virus site-specific integration and AAVS1 disruption. J. Virol.

78:7874–7882.

8.Hermonat, P. L., M. A. Labow, R. Wright, K. I. Berns, and N. Muzyczka.

1984. Genetics of adeno-associated virus: isolation and preliminary charac-terization of adeno-associated virus type 2 mutants. J. Virol.51:329–339. 9.Hermonat, P. L., A. D. Santin, R. B. Batchu, and D. Zhan.1998. The

adeno-associated virus Rep78 major regulatory protein binds the cellular TATA-binding protein in vitro and in vivo. Virology245:120–127. 10.Horer, M., S. Weger, K. Butz, F. Hoppe-Seyler, C. Geisen, and J. A.

Klein-schmidt.1995. Mutational analysis of adeno-associated virus Rep protein-mediated inhibition of heterologous and homologous promoters. J. Virol.

69:5485–5496.

11.Huser, D., and R. Heilbronn.2003. Adeno-associated virus integrates site-specifically into human chromosome 19 in either orientation and with equal kinetics and frequency. J. Gen. Virol.84:133–137.

12.Huser, D., S. Weger, and R. Heilbronn.2002. Kinetics and frequency of adeno-associated virus site-specific integration into human chromosome 19 monitored by quantitative real-time PCR. J. Virol.76:7554–7559. 13.Kotin, R. M., M. Siniscalco, R. J. Samulski, X. D. Zhu, L. Hunter, C. A.

Laughlin, S. McLaughlin, N. Muzyczka, M. Rocchi, and K. I. Berns.1990. Site-specific integration by adeno-associated virus. Proc. Natl. Acad. Sci. USA.87:2211–2215.

14.Kyostio, S. R., R. S. Wonderling, and R. A. Owens.1995. Negative regulation of the adeno-associated virus (AAV) p5 promoter involves both the p5 Rep binding site and the consensus ATP-binding motif of the AAV Rep68 pro-tein. J. Virol.69:6787–6796.

15.Linden, R. M., P. Ward, C. Giraud, E. Winocour, and K. I. Berns.1996. Site-specific integration by adeno-associated virus. Proc. Natl. Acad. Sci. USA.93:11288–11294.

16.Liu, Q., C. F. Perez, and Y. Wang.2006. Efficient site-specific integration of large transgenes by an enhanced herpes simplex virus/adeno-associated virus hybrid amplicon vector. J. Virol.80:1672–1679.

17.McCarty, D. M., T. H. Ni, and N. Muzyczka.1992. Analysis of mutations in adeno-associated virus Rep protein in vivo and in vitro. J. Virol.66:4050– 4057.

18.McCarty, D. M., D. J. Pereira, I. Zolotukhin, X. Zhou, J. H. Ryan, and N. Muzyczka.1994. Identification of linear DNA sequences that specifically bind the adeno-associated virus Rep protein. J. Virol.68:4988–4997. 19.McCarty, D. M., S. M. Young, Jr., and R. J. Samulski.2004. Integration of

adeno-associated virus (AAV) and recombinant AAV vectors. Annu. Rev. Genet.38:819–845.

20.Miller, S. A., D. D. Dykes, and H. F. Polesky.1988. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res.16:1215.

21.Muzyczka, N., and K. I. Berns.2001.Parvoviridae: the viruses and their replication, p. 2327–2360.InB. N. Fields, D. M. Knipe, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman, and S. E. Straus (ed.), Fields virology, 4th ed. Lippincott Williams & Wilkins, Philadelphia, PA. 22.Needham, P. G., J. M. Casper, V. Kalman-Maltese, K. Verrill, J. D. Dignam,

and J. P. Trempe.2006. Adeno-associated virus Rep protein-mediated inhi-bition of transcription of the adenovirus major late promoter in vitro. J. Vi-rol.80:6207–6217.

23.Nony, P., J. Tessier, G. Chadeuf, P. Ward, A. Giraud, M. Dugast, R. M. Linden, P. Moullier, and A. Salvetti.2001. Novelcis-acting replication ele-ment in the adeno-associated virus type 2 genome is involved in amplification of integratedrep-capsequences. J. Virol.75:9991–9994.

24.Owens, R. A., M. D. Weitzman, S. R. Kyostio, and B. J. Carter.1993. Identification of a DNA-binding domain in the amino terminus of adeno-associated virus Rep proteins. J. Virol.67:997–1005.

25.Pereira, D. J., and N. Muzyczka.1997. The cellular transcription factor SP1 and an unknown cellular protein are required to mediate Rep protein acti-vation of the adeno-associated virus p19 promoter. J. Virol.71:1747–1756. 26.Philpott, N. J., C. Giraud-Wali, C. Dupuis, J. Gomos, H. Hamilton, K. I.

Berns, and E. Falck-Pedersen.2002. Efficient integration of recombinant adeno-associated virus DNA vectors requires a p5-repsequence incis. J. Vi-rol.76:5411–5421.

27.Philpott, N. J., J. Gomos, K. I. Berns, and E. Falck-Pedersen.2002. A p5 integration efficiency element mediates Rep-dependent integration into AAVS1 at chromosome 19. Proc. Natl. Acad. Sci. USA.99:12381–12385. 28.Snyder, R. O., D. S. Im, T. Ni, X. Xiao, R. J. Samulski, and N. Muzyczka.

1993. Features of the adeno-associated virus origin involved in substrate recognition by the viral Rep protein. J. Virol.67:6096–6104.

29.Su, P. F., S. Y. Chiang, C. W. Wu, and F. Y. Wu.2000. Adeno-associated virus major Rep78 protein disrupts binding of TATA-binding protein to the p97 promoter of human papillomavirus type 16. J. Virol.74:2459–2465. 30.Surosky, R. T., M. Urabe, S. G. Godwin, S. A. McQuiston, G. J. Kurtzman,

K. Ozawa, and G. Natsoulis.1997. Adeno-associated virus Rep proteins target DNA sequences to a unique locus in the human genome. J. Virol.

71:7951–7959.

31.Tan, I., C. H. Ng, L. Lim, and T. Leung.2001. Phosphorylation of a novel myosin binding subunit of protein phosphatase 1 reveals a conserved mech-anism in the regulation of actin cytoskeleton. J. Biol. Chem.276:21209– 21216.

32.Tessier, J., G. Chadeuf, P. Nony, H. Avet-Loiseau, P. Moullier, and A. Salvetti.2001. Characterization of adenovirus-induced inverted terminal re-peat-independent amplification of integrated adeno-associated virusrep-cap sequences. J. Virol.75:375–383.

33.Tratschin, J. D., I. L. Miller, and B. J. Carter.1984. Genetic analysis of adeno-associated virus: properties of deletion mutants constructed in vitro and evidence for an adeno-associated virus replication function. J. Virol.

51:611–619.

34.Tsunoda, H., T. Hayakawa, N. Sakuragawa, and H. Koyama.2000. Site-specific integration of adeno-associated virus-based plasmid vectors in lipo-fected HeLa cells. Virology268:391–401.

35.Tullis, G. E., and T. Shenk.2000. Efficient replication of adeno-associated virus type 2 vectors: acis-acting element outside of the terminal repeats and a minimal size. J. Virol.74:11511–11521.

36.Urcelay, E., P. Ward, S. M. Wiener, B. Safer, and R. M. Kotin.1995. Asymmetric replication in vitro from a human sequence element is depen-dent on adeno-associated virus Rep protein. J. Virol.69:2038–2046. 37.Wang, X. S., and A. Srivastava.1997. A novel terminal resolution-like site in

the adeno-associated virus type 2 genome. J. Virol.71:1140–1146. 38.Wang, X. S., and A. Srivastava.1998. Rescue and autonomous replication of

adeno-associated virus type 2 genomes containing Rep-binding site muta-tions in the viral p5 promoter. J. Virol.72:4811–4818.

39.Ward, P., P. Elias, and R. M. Linden.2003. Rescue of the adeno-associated

on November 8, 2019 by guest

http://jvi.asm.org/

(10)

on November 8, 2019 by guest

http://jvi.asm.org/

Figure

FIG. 1. The p5IEE functions as a target for Rep-mediated site-specific integration. (A) Diagrammatic representation of the p5CATplasmid used as a target substrate for replication and integration assays
FIG. 2. Replication of p5CAT in HeLa cells. Replication assay of the ITR-containing plasmid pTRUF or p5CAT, cotransfected with a controlplasmid pCMVGFP, pT7Rep, or CMVRep, in the presence of wt Ad2 or mock (medium) helper virus infection
FIG. 4. Characterization of p5IEE plasmids containing mutations in the RBE region. (A) Diagram of p5CAT constructs
FIG. 5. Characterization of RBE replacement domains from AAVS1 and AAVITR in p5IEE. The p5 RBE was replaced with the RBEsequence present in the AAV2 ITR origin domain or the human chromosome 19 AAVS1 integration site RBE (A) and characterized for CAT
+2

References

Related documents

Pattern I : Immediate trifurcation of main portal trunk into right anterior right posterior and left portal branches was observed in 8/103 specimens studied. Pattern II :

HIV induced minor cognitive-motor disorder or mild neurocognitive disorder is a less severe neurocognitive disorder emergent in earlier HIV infection .The symptoms of

The buccoadhesive dosage forms along with sub-lingual tablets, oral gels and ointments, lozenges, rapidly dissolving tablets and chewing gums are the formulations

Lanes 1 to 5, protein- DNA complexes obtained by incubating a site C probe with DG75 nuclear extract in the presence of the indicated mutant (lanes 1 to 4) or wild-type (lane

Nokhodchi et al 55 used the technique of liquisolid compacts to formulate and enhance the in-vitro release of piroxicam, which was formulated into 10mg liquisolid tablets

Finally in the third (or pubertal) phase, growth is rapid. A possible reason for contractures developing in later life could be an increase in general body fat associated with

nasolacrimal duct. Sac is enclosed by a periorbita which splits at the posterior lacrimal crest, encloses the sac, reuniting at the anterior crest and thus forms the lacrimal

differ from those in each of the previously characterized A- MuLV receptors, the RaPiT2 homolog (9) and PiT2 (22) (Ta- ble 2). The compositions of the fifth extracellular domains