Murine leukemia virus mutant with a frameshift in the reverse transcriptase coding region: implications for pol gene structure.

(1)

Vol. 51, No. 2 JOURNALOFVIROLOGY, Aug. 1984, p.470-478

0022-538X/84/080470-09$02.00/0

Murine

Leukemia Virus Mutant with

a

Frameshift in the

Reverse

Transcriptase

Coding Region: Implications for

pol

Gene Structure

JUDITH G. LEVIN,l* STELLA C. HU,1 ALAN REIN, LESLEY I. MESSER,'t ANDBRENDA I. GERWIN3

Laboratory of Molecutlar Genetics, National Instituite ofChild Health andHutman Development, Bethesda, Maryland

202051; Laboratory ofMoleculalr Virology and Carcinogenesis, Litton Bionetics, Inc.-Basic ResearchProgram, National CancQer Instituite, Frederick CancerResearch Faicility, Frederick, Maryland 217012; andLaboratory ofHuman

Carcinogenesis, NationalCancer Institutte, Bethesda, Ma,Iyland202053 Received 7February 1984/Accepted 12 April 1984

The mQlecular defect in the nonconditional B-tropic MuLV pol mutant, clone 23 (Gerwinet al., J. Virol. 31:741-751, 1979), has been characterized by recombinantDNA technology. The entiremutant genome was

cloned fromanEcoRIdigest of integratedcellular DNA intobacteriophage A Charon4Aand then subclonedat theEcoRI siteof pBR322. NIH-3T3 cells transfected with the plasmid clone, termed pRTM (RTM, reverse transcriptase mutant), reproduced the properties of clone 23 virus-infected cells.Invivo ligation experiments involvingcotransfectionof subclones of pRTM and wild-type murine leukemia virus localizedthedefectin the clone 23 genometo an approximately 400-base-pair region in thepol gene between the Sail andXhoI sites.

Sequence analysis of this region in the wild-type and mutant genonies revealed that the mutant has one

additionalC residue located 231 bases downstream ofthe last base ofthe Sall recognition site. This 1-base insertion bringsthreeTGA termination codons into phase. Thus, the mutation in clone 23 leadstopremature termination of translation,explaining thepresenceinclone23 virionsofatruncated polymerasewith low levels

ofenzymatic activity. Itwaspreviously shownthatthegagprecursoriscleaved normally in clone23-infected cells;therefore, ifavirus-codedproteaseis involved in this cleavage, itmustbeencoded bysequencesupstream of the reverse transcriptase region of thepolgene. Thisconsideration, coupled with the observed molecular

weight of themutantpolymeraseandourprecise determinationof its C terminus, have ledtoaproposalfor the

geneticorganizationof the murineleukemia viruspolgene.

Themurineleukemia virus (MuLV)polgenecodesfor the reversetranscriptase enzyme. Thisproteinisasingle 70,000-to80,000 (70 to8QK)-dalton polypeptide (60) which, like the avian retrovirus enzyme (60), exhibits RNA- and

DNA-dependent DNA polymerase activityand RNase Hactivity

(30, 42, 61). Although polymerase and RNase H reside on

the same polypeptide, eachof these activities is thought to

have adifferent active site. This conclusion is based on the

differential sensitivities of thetwoactivitiestovarious types of inhibitors (6, 11, 18, 40, 41, 60) and on the fact that

proteolytic cleavage ofreverse transcriptase gives rise to a

protein

product that has RNase H but not polymerase activity (15, 29). It has been suggested (28, 57) that an

MuLV-associated endonuclease protein of approximately

40Kcaltons(28, 43), which haspropertiessimilartothoseof

the avian retrovirus-encoded endonuclease pp32 (20) and

which

shares methionine-containing tryptic peptides with MuLV polymerase precursor molecules (28), may also be

encodedby the pol gene.

The present study was undertaken to further define the

relationship between the genetic structure of the pol gene anditsassociatedactivities. Ourapproachwasto character-ize the molecular defect inanonconditional MuLV

polymer-ase mitant, clone 23 (16), whose phenotype was already known. Earlier work onclone23 has demonstratedthatit is

a replication-defective virus with a defect in the pol gene (16). Cells producing clone 23 are missing the gag-pol

precursor, Pr180g'w'1""/ (27), buthave been shown tocontain

*Correspondingauthor.

tPresent address: Houghton Poultry Research

Station.

Houghton, Huntingdon, Cambridgeshire PE17 2DA, Great Britain.

smaller proteins of 147K and 117K daltons which could be immunoprecipitated with anti-polymerase sera (16). Other

experimnents

haveindicatedthatmutantvirionsareunableto

synthesize high-molecular-weight viral DNAin vivo (1) and have only 2 to 5% of the wild-type level of polymerase

activitywhenassayedwithasynthetic primer-templatesuch

as poly(rA)

oligo(dT)12>18

(16). This activity is associated

with a truncated enzyme sedimenting with a molecular weight of 47K in glycerol gradients (16). Recent work has also shown that endogenousreversetranscriptase activityis very low and that the only products synthesized in the

endogenousreactionaresmall minus-strand DNA

intermedi-ates no larger than 2.5 kilobases (kb) (L. I. Messer, K. M.

Currey, J. B. O'Neill, J. V. Maizel, Jr., J. G. Levin, and

B. I. Gerwin, manuscript in preparation). Despite its

re-duced size,themutantenzymeretains RNase Hactivityand isindistinguishable from the wild-typeenzymewith respect

to primer-template and metal ion preferences and immune reactivity towards antibodydirected against purified MuLV

polymerase (16).Interestingly, clone 23virions containallof the usual gagstructuralproteins(16), afunctional ecotropic

glycoprotein (16), normal levelsof thetRNAPrO primer(33), and a70S RNA complex that canbe heat denatured to 35S

RNA subunits (16).

In this study, a molecular clone of the entire mutant

genomewas isolated in bacteriophage A Charon 4A (4) and

then subcloned at the EcoRI site ofpBR322. The plasmid

clone is referred to as pRTM (RTM, reverse transcriptase

mutant). Analysis of pRTM showsthatthedefect inclone23

is aframeshift mutation resulting from insertion ofone base

nearthe middleof the pol gene. This frameshift bringsthree

TGAtermination codons into phase and leadstopremature termination of translation. Knowledge of the exact position

470

on November 10, 2019 by guest

http://jvi.asm.org/

(2)

ofthe genetic defect inclone 23. coupled with the previous characterization of the mutant phenotype (16). suggests a

mapfor the organization of the MuLVpolgene. MATERIALS AND METHODS

Materials.

32P-labeled

nucleoside triphosphates were pur-chased from Amersham Corp. (Arlington Heights, Ill.).

[3H]TTP was obtained from New England Nuclear Corp. (Boston, Mass.). Restriction endonuclease enzymes were

obtained from New England BioLabs (Beverly, Mass.) or

from Bethesda Research Laboratories (Gaithersburg, Md.). G418was agift from the Schering Corp. (Bloomfield, N.J.).

Cells and viruses. Conditions for growth of the SC-1i

NIH-3T3, mink (CCL64), 3T3FL (17), and clone 23 (16) cell lines have been described previously(16, 31, 32). AKR-L1 MuLV was obtained from Marilyn Lander and was propagated in SC-1 cells (32).

Transmission of the pol mutant to mink cells. The replica-tion-defective MuLV was rescued from clone 23 cells by superinfecting the cells with amphotropic MuLV 1504A as

described previously (52). Culture fluids from the superin-fected culturewere initially assayed in the complementation plaque assay (51) and then used to infect mink cells at a

multiplicity of infection of 0.2 complementation PFU per cell. The mink cells were cloned in microtest wells the

followingday: cloneswere thenpicked and screened forthe

presence of a defective ecotropic MuLV by testing their

abilitytofuse XC cells after cocultivation with cells produc-ing Moloney mink cell focus-forming MuLV (50). Clones that were positive in this preliminary screen were then

superinfected with amphotropic MuLV, Moloney mink cell

focus-forming MuLV, or feline leukemia virus, and the supernatants of these cultures were tested in the

comple-mentation plaque assay (51, 52).

Viral probes and hybridization procedures. An ecotropic

MuLV-specific plasmid probe (generous gift of Sisir K.

Chattopadhyay and Douglas Lowy), containing a

400-base-pair(bp)SinatI fragmentderived from theenvl regionofAKR

MuLV (7), was used for hybridization to

high-molecular-weightcellular DNA.Forusein screening molecularclones.

the400-bpfragmentwas separated from thevector. In some

experiments, an insert probe containing the entire AKR MuLVgenome wasprepared by isolating the 11-kb HinzdIII-EcoRI fragment of the recombinant plasmid 623P (see be-low). Probeswerenick translated(53)to aspecificactivityof

1 x 108to 2 x 108

cpm/jig.

Hybridization wascarriedout at

40°C for 20 h essentially as described by Wahl et al. (65), except that the prehybridization step was omitted and the buffer was7 mM Tris-hydrochloride(pH 7.5). After

hybrid-ization, filterswerewashed threetimesatroomtemperature with 2x SSC (lx SSC is0.15M NaCl plus 0.015 M sodium citrate) containing0.1% (wt/vol)sodium dodecyl sulfate and five timesat520C with

0.lx

SSC. Bands were visualized by

autoradiographyat -80°C for24h, usingKodak XAR-5film with a Lightning-Plus intensifying screen.

Molecular cloning procedures. A 4-mg sample of high-molecular-weightDNA (31) isolated from clone 23-infected mink cellswasdigested with EcoRI.Thedigestwas fraction-ated by preparative gel electrophoresis (47), and fractions

were tested for the presence of ecotropic MuLV DNA by hybridization to the ecotropic virus-specific plasmid probe

described above. Peak fractions, approximately 10 kb in size,werepooled and packagedinvitro(25) inbacteriophage A Charon 4A (4). Phage were plated on

Escherichia

coli LE392, and recombinants were screened by in situ hybrid-ization (3), usingthe 400-bp ecotropic MuLV-specific insert

probe (see above). A clone 23-K recombinant was isolated

and then subcloned and amplified as described previously (22). To subclone the mutant genome into pBR322, DNA

fromthe A recombinant clone was digested with EcoRI and

ligated with T4 ligase to EcoRI-digested pBR322. The

liga-tion mixture was used totransformE. coli RRI, and

recom-binants were screened by colony hybridization (21), using

the 11-kb insertprobederivedfrom 623P.Aclone designated pRTM was isolated that contained the entire clone 23

genome.including two long terminal repeat units (see Fig. 2)

andflankingcellularsequences of0.8and 0.3kbatthe 5'and 3'termini, respectively, of the viral DNA insert. To increase the yields of plasmid DNA. pRTM was transferred to E. coli HB1I1, which was used as the host for all subsequent subcloning experiments.

Plasmids. pSV2 Neo (59) was agenerous gift from Gray

Crouse. pKC7 (49) was kindly provided by Bernard Weiss. Amt8-1 (8),generously supplied by SisirK. Chattopadhyay, contains thewild-type amphotropic MuLVgenomeinserted at the EcoRI site of pBR322. It has aSalI site at the same

position as ecotropic MuLV and one long terminal repeat, but is permuted in the env gene. pWB-5 (5) was agenerous

giftfrom Larry Boone and containsthe entire wild-type

B-tropic MuLV genome inserted in permuted form at the

HindlIl site of pBR325. A subclone of pWB-5 was isolated that has the 1.6-kbHindIII-XhofragmentofMuLVinserted into the HinidlIl and X/Iol sites ofpKC7. The subclones of

pRTM were asfollows. pRTM-1 and pRTM-2containthe 5' Eco-Sal and 3' Sal-Eco fragments of pRTM, respectively, inserted attheEcoRI andSa/I sites ofpBR322. pRTM-3 and pRTM-4 contain the 5' Eco-X/ho and 3' X/ho-Eco fragments ofpRTM,respectively, insertedatthe EcoRl and Xliol sites of pKC7. 623P is a recombinant plasmid subclone of the

bacteriophage X623 clone (34), which contains the entire

AKR MuLV genome. The HindIll and EcoRI sites in 623P

are located in the 5' and 3' flanking cellular sequences,

respectively (34, 48), and were used as cloning sites for insertion into pBR322 (B. I. Gerwin, unpublished data). Subclones of 623P were as follows: 623P-2, generously provided by Douglas Lowy, has the 3' Sal-Eco fragment of 623P inserted at the SallI and EcoRI sites of pBR322 (44); 623P-3 contains the 5' HinidIII-Xliofragmentof 623P insert-ed at the HinzdlIl and X/iol sites of pKC7; and 623P-4 contains the 3' X/ho-Eco fragments of623P inserted at the EcoRl andXhoI sites ofpKC7.

Isolation of plasmid DNA. Plasmids were grown in LB broth containing 25 pLg of ampicillin per ml. Plasmid DNA

wasisolated essentially as described by Boone et al. (5). with the exception of the sodium dodecyl sulfate step, and was

then treated with ribonuclease (50 pLg/ml) and banded two

times incesium chloride-ethidium bromidegradients.

Cotransfection ofpRTM with pSV2 Neo. The pRTM and

pSV2 Neo (59) plasmids were digestedwith EcoRI. Then 3

pLgof eachdigest wasco-precipitated(eitherwith orwithout 20

p.g

of calf thymus DNA) with calcium phosphate, and the

precipitates were applied to NIH-3T3 cells as described

previously (9, 19). Two days later, the cells were cloned in microtest plates in medium containing 400 p.g of the drug G418 per ml. Clones resistant to G418 were picked and

screenedforthe presence ofadefective ecotropic MuLV as

described above, approximately 20% ofthe G418-resistant clones werefound to contain the MuLV.

Transfection of NIH-3T3 cells withplasmidsubclones.

NIH-3T3 cellswereseededat adensity of 8 x

105

cells per60-mm

petri dish. One day later, 0.5

pLg

of each plasmid DNA,

previouslydigested witheitherSallI orX/iol. wasappliedto

on November 10, 2019 by guest

http://jvi.asm.org/

(3)

472 LEVIN ET AL.

the cells as described previously (9, 19), in the absence of

added carrier DNA. The next day, transfected cells were

trypsinized and dividedbetweentwoT75flasks. Since some

ofthe transfections were expected to yield virions with the

hostrangeofB-tropicMuLV, it was necessary toprovide a

permissive host for virus amplification. Thus, 2 days after

transfection, the transfected NIH-3T3 cells were treated

with mitomycinC (31) to preventfurther cell division. Each flask then received 5 x 105 3T3FL cells (17), which support

replication ofboth N-and B-tropic MuLV. When these cells

reached confluency, they were divided among several T75

flasks. Ten days after transfection, the supernatant fluids

werecollected and assayed forreversetranscriptaseactivity (32) and infectivity (see the legends toFig. 3 and4).

Sequencing procedures. Fragments to be sequenced were

end labeled with [a-32P]TTP, using the Klenowfragment of

DNA polymerase (35), denatured by heating in dimethyl

sulfoxide, and electrophoresed in 5% polyacrylamide gels

under strand-separating conditions (37). Separated strands were excised, recovered from polyacrylamide, and subject-ed to sequencing by base-specific chemical cleavages as

detailed in reference 37. The guanine-plus-adenine reaction

was carried out as described by Mark and Rapp(36). RESULTS

Molecular cloningof the clone 23mutantgenomefrom mink

cells.Earlier workonthe clone23viralmutantdemonstrated

that it hasa defect in thepolgene(16). To characterize the

defect in clone 23 with respect to its genomic structure, it

was necessarytomakeamolecular cloneof the viralmutant. Since the presence of other murine viral genomes could

interfere with thescreening procedures usedin cloning, the clone23genome wastransferred biologically from mouseto minkcells, asdescribed above. Mink cellclones containing

defective ecotropic MuLV were identified by the

comple-mentation plaque assay (51). One of these clones was

selected for further study.

Analysis of the mink cell genomic DNA by restriction endonuclease digestion and Southern blotting (58) (Fig. 1)

was carried out by using a mouse ecotropic virus-specific

probe (7). Digestion with PstI yielded an 8.2-kb fragment thatcomigrated withaDNA band producedby PstI cleavage

ofgenomicDNAfrom cellsinfected with the closely related wild-type AKR MuLV (Fig. 1). Since PstI is known to

remove only 0.6 kb from the longterminal repeat regions of

the complete 8.8-kb AKR viral genome (48), the results

suggested thatafull-length copyofthe mutantviralgenome is present in mink cells. Digestion of mink cell DNA with EcoRI, which doesnot cut mostecotropicMuLV DNAs (7), gave onefragment approximately 10kbin size, presumably

representing the viral genome plus flanking cellular

se-quences.Thisresult also showed that the infected minkcells

containonly one copy ofecotropic MuLV.

Since restriction with EcoRI leaves the clone 23 genome

intact(Fig. 1),DNA ofinfected mink cellswasdigested with

this enzymein preparation for molecularcloning. The

clon-ingprocedures wereperformedasdetailed above. A recom-binantcloneofbacteriophage A Charon4A (4)containingthe entire mutant viral genome and 1.1 kb offlanking cellular

sequences wasisolated,andthe insert was subclonedatthe EcoRI site ofthe plasmid pBR322.

To test the biological activity of the plasmid clone

(pRTM), NIH-3T3cells werecotransfectedwith pRTM and

anotherplasmid, pSV2 Neo (59), which carriesthe genefor

neomycinresistance. Cell cloneswerefirstselected for their

abilitytogrowinthe presenceof theneomycinanalogG418,

Eco

RI

Pst

I

CL

23 AKR 23

-

23.6 -

9.4 -6.7

FIG. 1. Southern blot analysisofgenomic DNA digested with E(oRI andPsul. High-molecular-weight cellularDNA was isolated from clone 23 virus-infected mink cells (CL 23) and from AKR MuLV-infected SC-1 cells (AKR) as described previously (31). DNAsamples were digested withEcoRI (clone 23) and Pstl(AKR and clone23), subjectedtoelectrophoresisin a0.6%agarosegel (25

V. 24h). transferred to a nitrocellulose filter(58).andhybridizedto a 32P-labeled plasmid probe containing a 400-bp fragment specific forecotropic MuLV (7). as described in the text. The molecular weight markers are Hindlll fragments ofbacteriophage X and are given in kb.

and thenwerescreened for the presence of defective

ecotro-pic MuLV by thecomplementation plaque assay (51). Two cell clones, referred to as C5 and D3, gave positive results since supernatant fluids from these clones formed comple-mentation plaques only after superinfection of the cells with Moloney mink cell focus-forming MuLV, an XC-negative helper virus (Table 1). Polyacrylamide gel analysis showed that bothof these clones contained the gag precursorprotein

Pr65c""I

(26) and two proteins with molecular weights of

120K and 110K, respectively; no

Pr180g'''

(27) was de-tected. Control NIH-3T3 cells transfected with pSV2 Neo (59) alone did not contain any of the virus-specific proteins found in either mutant or wild-type MuLV-infected cells (data not shown). These results demonstrated that cells

TABLE 1. Presence ofa replication-defective ecotropic MuLV in cells transfected withpRTM

Cell clone" Superinfectingvirus CPFU/ml'

C5 None 0-1

MoloneyMCF" 2 x 10i

D3 None <1

MoloneyMCF 8 x 104

NIH-3T3clones were isolated aftercotransfectionwithpRTMandpSV2 Neo(59)andselectionin mediumcontainingthedrugG418.

MCF,Mink cellfocus-forming.

CPFU,Complementation plaque-formingunits. The titerwasmeasured 9 daysaftersuperinfection.

J. VIROL.

on November 10, 2019 by guest

http://jvi.asm.org/

[image:3.612.322.560.624.687.2]

(4)

- Y

Ll

E U)

mU CUnX/)i-mco

m

~~~m

m 0- c c nm

x _

11 10.

E

cn

Pol

, , 1 , , . .

0.0 1.0 2.0 3.0 4.0 5.0 6.0 7.0 8.0 8.8

KILOBASE

FIG. 2. Restrictionmapofclone 23 genome. The restriction mapoftheclone23polmutantgenomewasderivedby analysis of the plasmid clone pRTM and the Hirt supernatant DNAfraction(24) prepared from mink cells infected with clone23(baboonvirus)pseudotypevirions. The plasmid was mapped by visualization ofrestriction fragments with ethidium bromide; the Hirt supernatant DNA was mapped by Southernblotting (58)andhybridizationwith the 623P AKR MuLV genomeasprobe. This probe does not react with baboon virus under the conditions used here(data not shown). Distances between sites are givenin kb. The boundaries of thepolgene aretakenfromthe nucleotide sequenceofAKRMuLV (23).

transfected with pRTM have the same properties as the original clone 23 mouse cells(16; Table 1).

Thegenetic structure of the clone 23 genome wasinitially probed by subjecting the plasmid clone to restriction endo-nuclease analysis. Theresulting restriction map is shown in Fig. 2. This map is consistent with the published map of

AKR MuLV (48), differing only by the presence of aPillII site in the enm' gene at map position 7.1 kb. The plasmid pRTM and the clone 23 genome in mink cells also share the

same restriction sites (Fig. 2). This was demonstrated by superinfectingthe mink cells with baboonendogenousvirus,

cocultivatingthese cells with uninfected minkcells,and then

preparingHirt supernatant DNA(24) foranalysis by restric-tion endonucleasedigestion and Southernblotting(58) (data

Plasmids Utilized

Cloned Viral DNA Inserts

not shown). The restriction map of pRTM was also

com-pared with that of a plasmid clone, pWB-5, containing the wild-type B-tropic MuLVgenomein permuted form (5). No differences between the mutantandwild-typegenomeswere

revealed in theseexperiments (data not shown).

Localization of thedefectin the clone23 genome. Thefact thatthe mutant and wild-typegenomes had identical restric-tion maps made it possible to perform in vivo ligation

experimentstolocalize the defectinclone 23. Thisapproach involved transfection of NIH-3T3 cells with combinations of

plasmid DNAs containing either mutant or wild-type viral

DNA inserts. Subclones were constructed that extended from the cellularflankingsequenceat the 5' or3' endof the genome to the Sail site inpol(mapposition4.2 kb r48; Fig.

Polymerase Activity Infectivity

[3H]dTMP incorporated PFU/ml (pmol)

pRTM-1 + 623P-2 Dz zz 70.9 6x 105

Amt8-1 + pRTM-2 L+tZZZZZZZZ4o <0.1 <2x 100

pRTM-1 + pRTM-2

L=='+L'i[

0.1 <2x 100

Amt8-1 1 <0.1 <2x 10°

623P-2 + 0 0.2 <2x 100

Amt8-1 + 623P-2 7.0 1.4x 105

4= SalISite [1= LTR WildType r7777,-= Mutant

FIG. 3. Reconstitution of polymerase activity and infectivity by transfection withplasmids containing mutant or wild-type viral DNA cleavedatthe Sall site. Allplasmids were digested with Sall before transfection. Procedures for transfection ofNIH-3T3cells are given in the

text. Polymerase activity was assayed with poly(rA)

oligo(dT)12-1s

as described previously (32); the data are given for 10-,ul portions of concentratedsupernatantfluid(totalvolume,100,ul). Infectivity wasdeterminedby the XC assay (54). For simplicity, only the biologically relevant DNA,i.e.,the viral DNAinsertincluding the long terminal repeat segment, is shown in the schematic representation of column 2. The plasmidAmt8-1 (8) isdepicted schematically as a 5' subclone since only the 5' portion of the viral DNA is unpermuted and therefore biologically activeafter Sallcleavage. Foramore completedescription of the plasmids used, see the text.

on November 10, 2019 by guest

http://jvi.asm.org/

[image:4.612.166.455.76.253.2] [image:4.612.157.470.496.664.2]

(5)

474 LEVIN ET AL.

PlasmidsUtilized

Cloned Viral

DNA Inserts Polymerase Activity

[3H]dTMPincorporated FlU/ml (pmol)

623P-3 + pRTM-4 O +ZZz O 342.1 2x 105

pRTM-3 + 623P-4

aZ=j+Lzzt=

0.3 < 2 x100

pRTM-3 + pRTM-4 DlzzzzItz 0.1 <2x 10°

623P-3 <0.1 <2x1&0

623P-4

t-

<0.1 <2x100

623P-3 + 623P-4 °

+L

350.8 2x 106

+= XhoI Site O= LTR

Wild Type V11111M, Mutant

polymerase activity aind infectivity by transfection with plasmids containing mutant or wild-type viral

cleavedatthe Xliolsite.Theexperimentalproceduures werethesame asthosedescribed inthelegendtoFig. 3.exceptthat theplasmidswere

digested with Xliol before transfection and infectivity wasdeterminedby the S'L focus assay (2).

21).Plasmidsweredigested with Soll, andpairwise

combina-tions of 5'and 3'subclones werethencotransfected, relying

oncellular ligation (39, 45;A. Rein andR. J. Mural,

unpub-lished data) to generate acomplete genome. Production of

nondefective MuLV from combinations in which neither

subclone contained a defect was monitored by the

appear-ance ofreverse transcriptase activity and infectious virions

intheculture fluidsapproximately10days aftertransfection. Figure 3 shows the results of thisexperiment. Details on the plasmids used (column 1) are given above and in the

legend to Fig. 3. The biologically relevant pieces of the

cloned viral DNA insertsareshown schematicallyincolumn

2.AdditionofplasmidDNAscontainingthe5'portion ofthe mutant genome and the 3' portion of the wild-type (line 1)

gave rise to infectious virus with reverse transcriptase activity. In contrast, combinations involving the 3' portion

of the mutantgenome andthe 5' portion of either the

wild-type (line 2) or mutant (line 3) were inactive. Control

experiments showed that plasmids containing the 5' and 3' portions of the wild type were not active (lines 4 and 5.

respectively) unless both DNAs were transfected together

(line 6). These results demonstrated that the clone 23

genome has nodefectupstream ofthe Sall site.

A similarexperiment (Fig. 4)wasundertaken with respect to the XhoI site (map position 4.6 kb [48; Fig. 2]). In this case, the plasmid containingthe3' Xiho-Eco fragmentofthe mutant (line 1) was biologically active, whereas the 5'

mutantviral DNAinsert spanningthe Sail site wasnot(line

2). Negative controls included transfection of 5' and 3' portionsofthe mutantgenome (line 3)oreitherofthe

wild-typesubclones alone(lines4and 5). AsobservedintheSall

experiment (Fig. 3), cotransfection of both wild-type sub-clones generated infectious virus with polymerase activity

(line 6). These results demonstrated that the clone 23

genome has no defect downstream from the XIloI site. Takentogether,theresults inFig.3and 4showthatclone23

is defective only in the 400-bp region between the Still and XhoI sites.

Sequence analysis of the Sal-Xho region ofpol gene. The

Maxam-Gilbert method (37) was used to determine the

sequenceofthe Sili-XIoa regions of themutantand wild-type pol genes. Figure 5 shows a portion oftwo 8%

polyacryl-amide-urea gels illustrating the critical difference between

the mutant andwild-typegenomes. Thewild-type sequence had a run offive C residues, whereas the parallel mutant

sequence containedanadditional C (Fig.5).Thepresenceof

an extra C in the mutant sequence was confirmed by

sequence analysis of an M13 clone (38) containing the mutant Sal-Xhlo fragment (data not shown).

The entire nucleotide sequence ofthe Sal-Xho region is given in Fig. 6. The sequences of the mutant and wild-type coding strands were compared by using the NUCALN programof Wilburand Lipman (66); nucleotide 1 is the last

base ofthe Still recognition site. The data show that

inser-tionof the additional C residue inthe mutantsequence after

nucleotide 231 bringsaTGAterminationcodonintophaseat position 233. Additional TGA termination codons are also

WILDTYPE

G A-G A>C T C C A

A

G

C

A

ci

MUTANT

(1 A-G A>C T>C C

.:,..M,-. _*

iEi__{_} _~~~~dmd

~%w4

__Q

I

_.-;.

NW

I P

A A c

A

---T

-c'

-<Cl

N-\C

Cz

FIG. 5. Maxam-Gilbert sequencegels. showing aportionofthe wild-typeandclone23mutantsequenceintheSilI-Xlio regionof the

polgene.To obtain thewild-type fragment usedforsequencing,the

Hinidlll-Xhlosubclone (seethetext)ofpWB-5(5) wasdigestedwith

SollandXliol;the MuLV-specificSal-Xhofragmentwas recovered froma5%polyacrylamide gelasdescribedpreviously (37).The

Sal-Xlio fragment of the mutant was isolated by digestion ofpRTM-2

(see the text) with Still andXlhol, followed by preparative electro-phoresis in a 1.0% agarose gel and recovery of the DNA by adsorptiontoglassbeads(62). Sequenceanalysiswasperformedas

described in thetextandin reference37. The nucleotidesequences

aredisplayedon8% polyacrylamide-urea gels.

Infectivity

J.VIROL.

on November 10, 2019 by guest

http://jvi.asm.org/

[image:5.612.153.464.78.251.2] [image:5.612.318.555.485.617.2]

(6)

20 40

MUT CGAGAAGCAGGGCTACGCCAAAGGCGTCCTAACGCAAAAACTGGGACCTTGGCGTCGGCC

WT CGAGAAGCAGGGCTACGCCAAAUGCGTCCTAACGCAAAAACTGGGACCTTGGCGTCGGCC

20 40

80 100

CGTGGCCTACCTGTCCAAAAAGCTAGACCCAGTGGCAGCTGGGTGGCCCCCTTGTCTACG

80 100

140 160

GATGGTAGCAGCCATTGCCGTTCTGACAAAAGATGCAGGCAAGCTAACTATGGGACAGCC

140 160

200 Val 220 Pro ProEnd

GCTAGTCATCCTGGCCCCCCATGCAGTGGAGGCACTGGTCAAGCAACCCCCCTGACCGCT

GCTAGTCATCCTGGCCCCCCATGCAGTAGAGGCACTGGTCAAGCAACCCCC-TGACCGCT

200 Val 220 Pro Pro Asp

260 280 End

GGCTATCCAACGCCCGCATGACCCACTACCAGGCAATGCTCCTAGACACTGACCGAGTTC

260 280

320 340

AGTTCGGACCAGTGGTGGCCCTCAATCCTGCCACCTTACTCCCTCTCCCGGAAGAAGGAG AGTTCGGACCAGTGGTGGCCCTCAATCCTGCCACCTTACTCCCTCTCCCGGAAGAAGGAG

320 340

End 370 CCCCCOATGATTGCC

CCCCCCATGATTGCC 370

FIG. 6. Nucleotide sequence of the entire

Sal-Xho

region of the mutant and wild-type pol genes. Sequencing was by the method of Maxam andGilbert(37). The sequence of the coding strands of the clone 23 mutant and the wild-type Sal-Xho fragments was compared by using the NUCALN programofWilbur and Lipman (66). Nucleotide 1 is the last base of theSallrecognition site. MUT, mutant; WT,wild type.

generated at positions 290 and 368 as a result of this

insertion. Thus, themutationinclone23 leadstopremature

termination of translation.

Theonly other

nucleotide

difference between themutant and wild-type sequence occurs at

position

208. This base

change is silent since GTG (mutant)and GTA(wild type)are both valine codons. Interestingly, N- and

B-tropic

MuLV share the same nucleotide sequence in the Sal-Xhoregion,

except at position 88, where AKR MuLV has a T residue

(23),butboth themutantandwild-typeB-tropicviruses have

aC.Thisdifferencedoesnotaffect theamino acid sequence

ofthe enzyme,however, since GATand GAC both code for thesame amino acid (asparticacid).

DISCUSSION

In the present study, the molecular defect in a naturally arising MuLV pol mutant, clone 23 (16), has been precisely

defined in terms of the genetic structure of the mutant

genome.Analysis ofamolecular cloneoftheentire clone 23 genome demonstrated that the mutant is defective in the approximately 400-bp sequence between the SalI andXhoI sites (Fig. 2) of the pol gene. No defects were present elsewhere in the viral genome (Fig. 3 and 4).

Sequence analysis of the Sal-Xho regions of the mutant and wild-type genomes revealed that the mutant has one

additional C located 231 bases downstream from the last

base of the Sall recognition site (Fig. 5 and 6). The only

otherdifference between themutantand wildtype occurs at

position 208,butthis changedoes notaffect the amino acid sequence(Fig. 6).The consequences of the 1-baseinsertion,

however,arequite striking. Three TGAtermination codons

are brought into phase, the first immediately after the

insertion (position 233) and the other two at positions 290 and368,respectively (Fig. 6).Thus,themutationinclone 23

produces a shift in readingframe that results in premature

termination of translation.

Two lines of evidence establish that termination occurs

within the structural gene for reverse transcriptase. First, the mutantenzyme has beenpurifiedand shown to havean

abnormally low sedimentation rate in glycerol gradients,

consistent with a molecular weight of 47K (16). Second, recent experiments using a competition immunoassay

indi-catethat thespecific activity of the mutant enzyme molecule isatleast10-fold lower than that of the wild type (Messeret

al., in preparation).

Correlation of the nucleotide position of the clone 23

defect with the mutant phenotype allowed us to propose a

scheme for the genetic organization of the MuLV pol gene

(Fig. 7). This scheme involves calculations that are based uponthegenomicsequenceof the very closely relatedAKR

on November 10, 2019 by guest

http://jvi.asm.org/

[image:6.612.146.481.70.428.2]

(7)

476 LEVIN ET AL.

Reverse Transcriptase RNase H

70-80K

l

Endonuclease

40-50K

4500- 4776

Map Position 1kb) 2.73 3.09 4.98- 5.26 6.32

FIG. 7. Organization of the MuLV polgene.Theproposedmapforthe MuLVpolgene isbasedonconsiderations discussed in thetext. The molecular weights ofpol-associated proteins are given in kilodaltons. The numbering system of Herr for the AKR MuLV genomic

sequence(23)wasusedtodesignatenucleotide position.Mappositionwascalculated by adding 482 bp. thesizeof the AKR U3region(23). to

eachof thenucleotide positions aindisgiveninkb. Theuncertaintyin theCterminusofreversetranscriptase isindicatedonthe line drawing

by thebrackets around the predicted boundaries of theC-terminal region. The polopenreadingframeisterminatedbyanochre termination

codonat nucleotide positions 5841 to5843 (23).

MuLV (23), anduses the numbering system of Herr (23). Termination at the first TGA brought into frame by the mutation locates the C terminus ofthe truncated clone 23

reverse transcriptase molecule at nucleotide 3956. The

pre-cise locationof the Cterminus, coupled with thepreviously determined (16) molecular weight (47K) of the mutant en-zyme, places the N terminus at approximately nucleotide 2691 and predicts a mutant protein of 421 amino acid residues (23). However, since the 5' boundary of the pol gene is at nucleotide 2253 (23), a protein encoded by nucleotides 2253 to 3956 would have a molecular weight of ca.63K(23). Althoughthemolecular weightestimate of 47K was made under nondenaturing conditions (16), it seems

unlikely that it should underestimate the true molecular weight by as much as 25%. We therefore propose that reversetranscriptase isnotthe N-terminal proteinof the pol

gene product. This conclusion is consistent with recent

findings of Copeland, Gerard. and Oroszlan (T. D. Cope-land, G.Gerard,and S. Oroszlan. personal communication). who have used amino acid sequencing to localize the N

terminusof Moloney MuLV reversetranscriptaseto nucleo-tide2598 (accordingto the numberingsystemofShinnicket al. [571). Inspection of the nucleotide sequences of the

Moloney (57) and AKR (23) pol genes suggests that the

reverse transcriptase molecules of these viruses share the

same N termini and places the N terminus of the AKR

enzyme at nucleotide 2613(23).

Aproteolytic activity associatedwith MuLV particleshas been reported (67). Previous characterization of clone 23

virions has demonstrated that all of the gaig structural proteins are present in the correct proportions (16),

indicat-ing that the gag precursor is cleaved normally. As shown

above, clone 23 terminates gaig-pol synthesis within the reversetranscriptase coding region. Thus, if thecleavageof

the gag precursor is catalyzed by a virus-coded protease, thisenzymecannotbeencodedtothe 3' sideof the mutation in theclone 23genome, butmustbeencodedtothe 5' side of

reverse transcriptase. Localization of the N terminus of reverse transcriptase to nucleotide 2613 leaves 360 bp of

geneticinformationatthe 5' endofpolwhichcould encodea

protein of 13K daltons (23). Such a protein would

corre-spondinsizetotheavianretrovirus-codedprotease p15(12, 56) and would also show sequencehomologyand similarity

in predicted secondary structure to avianp15 (S. Oroszlan,

personal communication). We therefore suggestthat the N-terminal portion ofthepolgeneproduct encoded by

nucleo-tides2253to2612 isa13K proteaseinvolved inthe cleavage

ofgag proteins. The existence ofan MuLV-codedprotease upstreamof the reversetranscriptase codingregion has also

been considered by Oroszlan and co-workers (S. Oroszlan,

personal communication).

Furtherinformation about theorganization of the polgene can be derived by locating the C-terminus of wild-type reverse transcriptase. If the wild-type reverse transcriptase

molecule is encoded by a sequence beginning at nucleotide position 2613and has amolecular weight of 70to 80K(60). then its C terminus would be encoded approximately at

nucleotides 4500 to 4776 (23). However, the open reading

frame of the polgene of AKR MuLV extendsto nucleotide position 5840(23), givingthisgene additional coding

capaci-ty ofapproximately 40to 50K daltons. It is likely that this regionatthe 3'end of the polgeneencodes the endonuclease

described byKopchicketal.(28) and Nissen-Meyerand Nes

(43).

One striking feature of the scheme proposed in Fig. 7 is

that itplacesthe MuLVpol-associatedproteins inthe same

relative positionson thegenetic mapas inthe avian retrovi-ruses, despite the fact that the polyprotein precursors are

cleaved quite differently in the two virus groups. Thus, in

both cases, the protein encoded just downstream from the

firstfourgagproteins is thegagcleavageenzyme;however, inthe avianviruses,this protein(p15)(13, 63, 64)is thefifth

gag protein (12, 56), whereas in MuLV it is the first pol protein. This protease is followed by reverse transcriptase.

Downstream from reverse transcriptase is the virus-coded

endonuclease;this enzymeis theC-terminal portion of the

subunit ofavian reversetranscriptase (10, 14),but

apparent-ly is cleaved away from reverse transcriptase during

proc-essingof the MuLVpolgene product.

Thecurrentdata, in addition togeneratingaproposal for

the structure ofthe pol gene, also suggest some inferences

concerning structure-function relationships in the wild-type

enzyme molecule. As mentioned above, the MuLV reverse

transcriptasemolecule isasinglepolypeptidewhich has both RNase H and polymerase activities (30, 42, 61). These activitiesarethoughttohavedifferentactive sites(6, 11, 15, 18, 29, 40, 41, 60), but the location ofthe sites has notbeen

identified. Thepresent workon clone 23 indicates that both

ofthese sites, as well as the antigenic determinants of the enzyme recognized by heterologous goat antisera (16), lie

within the N-terminal portion of the polymerase protein.

This conclusion is in accord with a recent suggestion by

Crouch and Dirksen that the active site for the avian retrovirus RNase H is at or near the N terminus of the a-subunit of reverse transcriptase (11). It is intriguing that

despitethe lossofapproximatelyonethird of the moleculeat the C-terminal end, the clone 23 enzyme can stillcarry out

some of the reactions required for viral DNA synthesis,

Protease

13K

5' I

Nucleotide Position 2253 2613

-

3'

5840 J. VIROL.

on November 10, 2019 by guest

http://jvi.asm.org/

[image:7.612.79.542.79.157.2]

(8)

including synthesis

of minus-strong stop DNA (60) and

partial elongationof minus-strand DNA after thejumptothe 3' end of the

template

(Messer et al., in preparation). However, theenzymecannotmakeanyplus-strandDNAor

full-length

minus-strand DNA and terminatesDNA

synthe-sis near a

major

wild-type pause site (Messer et al.. in

preparation).

Future

experiments

will bedesigned to assess the role of the C-terminal

portion

of the enzyme in these reactions,

The fact that clone 23 has normal amounts of tRNAPI' in

viral 4S RNA

(33)

is also of interest. Othernonconditional

pol mutants in both the avian and murine systems have

reduced levelsoftRNATrP(46,

55)

andtRNAPr,

(33).

respec-tively,

and based on these observations, it was concluded

that reverse

transcriptase

is the

major

determinant in the

selective

encapsidation

of

primer

tRNA that occurs during

virus

assembly.

The clone 23 data suggest that

tRNA-polymerase

interactions that form the basis for thisselection involve

only

the N-terminal

portion

of the enzyme.

In summary, correlation of the clone 23

phenotype

with

the

precise

localization of the C terminus of the mutant reverse

transcriptase

has allowedustoproposeamapof the

MuLVpolgene and to

begin analysis

ofstructure-function

relationships

within the reverse transcriptase molecule.

ACKNOWLEDGMENTS

It is apleasure to thankMichael Seddon, Melody

McClure.

and

Dorothy Cavanaugh for outstanding technical assistance. We are indebted to Aya Leder for encouragement and adviceon cloning

techniquesduringanearly phaseofthiswork, MarianNauforhelp withfractionationandpackagingof minkcellDNA,AlanSchultzfor adviceonprotein gels,and JohnOwens forassistance with

comput-eranalysis. We arealsogratefulto DolfHatfield and CharlesVan Beveren for valuable

discussion.

Larry Boone, Winship

Herr.

and

Stephen

Oroszlanforcommunicatingresults beforepublication,and Robert Crouch and Stephen Oroszlan for critical readings of the

manuscript. Catherine Miceli provided expert assistance in the

preparation ofthe manuscript.

ADDENDUM IN PROOF

A model for the structure of the

pol

gene with some similaritiestotheone

proposed

herewas

previously

suggest-ed

by

Kopchick

et al.

(J.

J.

Kopchick,

W. L.

Karshin,

and R. B.

Arlinghaus,

J. Virol.

30:610-623, 1979).

LITERATURE CITED

1. Bassin,R.H., B.I.Gerwin,J.G.Levin,G.Duran-Troise,B. M.

Benjers, and A. Rein. 1980. Macromolecular requirements for

abrogation ofFt-] restriction by murine leukemia viruses. J. Virol. 35:287-297.

2. Bassin,R. H., N. Tuttle,and P.J. Fischinger. 1971. Rapidcell culture assay technique for murine leukaemiaviruses. Nature (London)229:564-566.

3. Benton, W. D.,and R. W. Davis. 1977. ScreeningXgt recombi-nant clonesby hybridization to single plaques in situ. Science 196:180-182.

4. Blattner, F. R., B. G. Williams, A. E. Blechl, K. Denniston-Thompson, H. E. Faber,L. A. Furlong,D. J.Grunwald, D.0.

Kiefer, D. D. Moore, J. W. Schumm, E. L. Sheldon, and 0. Smithies. 1977. Charon phages: safer derivatives of

bacterio-phagelambda for DNA cloning. Science 196:161-169. 5. Boone, L. R., F. E. Myer,D. M. Yang,C.-Y. Ou, C. K. Koh,

L. E.Roberson,R. W.Tennant,and W. K.Yang.1983. Reversal of Ft-] host rangebyinvitrorestrictionendonucleasefragment

exchange between molecular clones of N-tropic and B-tropic murine leukemiavirus genomes. J. Virol. 48:110-119.

6. Brewer, L. C., and R.D. Wells. 1974. Mechanisticindependence of avian myeloblastosis virus DNApolymerase and

ribonucle-ase H.J. Virol. 14:1494-1502.

7. Chattopadhyay, S. K., M. R. Lander, E. Rands, and D. R. Lowy. 1980. Structure ofendogenous murine leukemia virus DNAin

mouse genomes. Proc. Natl. Acad.Sci. U.S.A. 77:5774-5778. 8. Chattopadhyay, S. K., A. I. Oliff, D. L. Linemever. NI. R.

Lander, and D. R. Lowv. 1981. Genomes of murine leukemia viruses isolated from wild mice. J. Virol. 39:777-791.

9. Cohen, M., A. Rein, R. M. Stephens, C. O'Connell, R. V. Gilden, M. Shure, M. 0. Nicolson, R. M. McAllister, and N.

Davidson. 1981. Baboon endogenousvirus genome: molecular cloning and structural characterization of nondefective viral genomes from DNA of a baboon cell strain. Proc. Natl. Acad. Sci. U.S.A. 78:5207-5211.

10. Copeland, T. D., D. P. Grandgenett, and S. Oroszlan. 1980. Aminoacid sequence analysis of reversetranscriptasesubunits from avian myeloblastosis virus. J. Virol. 36:115-119. 11. Crouch, R. J., and M. L. Dirksen. 1982. Ribonucleases H. p.

211-241. In S. Linn and R. Roberts (ed.). Nucleases. Cold Spring Harbor Laboratory. Cold Spring Harbor. N.Y. 12. Dickson, C., R. Eisenman, H. Fan, E. Hunter, and N. Teich.

1982. Protein biosynthesis and assembly. p. 513-648. In R. Weiss. N. Teich. H. Varmus. and J. Coffin (ed.). Molecular biology oftumor viruses. RNA tumor viruses. 2nd ed. Cold Spring HarborLaboratory. Cold Spring Harbor, N.Y. 13. Dittmar,K.J., and K. Moelling.1978.Biochemical propertiesof

p15-associated protease in an avian RNA tumor virus. J. Virol. 28:106-118.

14. Eisenman,R. N., W. S. Mason, and M. Linial. 1980. Synthesis and processing ofpolymerase proteins ofwild-type and mutant avianretroviruses. J. Virol. 36:62-78.

15. Gerard, G. F. 1978. MultipleRNase H activities in mammalian typeC retraviruslysates.J. Virol. 26:16-28.

16. Gerwin,B.I.,A.Rein, J. G. Levin, R. H. Bassin, B. M. Benjers, S. V. S.Kashmiri, D. Hopkins, and B. J. O'Neill. 1979. Mutant ofB-tropic murine leukemia virus synthesizing an altered poly-merase molecule. J. Virol. 31:741-751.

17. Gisselbrecht,S.,R. H. Bassin,B. I.Gerwin, and A. Rein. 1974. Dual susceptibility of a 3T3 mouse cell line to infection by N-andB-tropicmurine leukemia virus:apparent lack of expression of the Fv-1gene. Int. J. Cancer 14:106-113.

18. Gorecki, M., and A. Panet. 1978. Discrimination of DNA polymeraseand RNase H activities in reversetranscriptase of avianmyeloblastosisvirus. Biochemistry 17:2438-2442. 19. Graham, F. L., andA.J.vander Eb. 1973.Anewtechnique for

the assay ofinfectivityof human adenovirus 5 DNA. Virology 52:456-467.

20. Grandgenett,D.P.,A.C.Vora,and R. D.Schiff.1978. A 32.000-dalton nucleicacid-binding proteinfrom avian retrovirus cores possesses DNA endonuclease activity. Virology 89:119-132. 21. Grunstein,M., and D. S. Hogness. 1975.Colony hybridization:a

method fortheisolation of clonedDNAsthat containaspecific gene. Proc.Natl. Acad. Sci. U.S.A. 72:3961-3965.

22. Hager, G. L., E. H. Chang, H. W. Chan, C. F. Garon, M. A. Israel, M. A. Martin, E. M. Scolnick, and D. R. Lowy. 1979. Molecularcloningof the Harveysarcoma virus closed circular DNA intermediates: initial structural andbiological character-ization. J. Virol. 31:795-809.

23. Herr, W. 1984. Nucleotide sequence of AKVmurine leukemia virus.J. Virol.49:471-478.

24. Hirt, B. 1967. Selective extraction of polyoma DNA from infectedmouse cellcultures. J. Mol. Biol. 26:365-369.

25. Hohn,B. 1979. In vitropackagingof lambda and cosmidDNA.

MethodsEnzymol. 68:299-309.

26. Jamjoom,G., W.L. Karshin,R. B.Naso, L.J. Arcement, and

R. B. Arlinghaus. 1975. Proteins of Rauscher leukemia virus:

resolution of a 70,000-dalton, nonglycosylated polypeptide containing p30 peptide sequences. Virology68:135-145. 27. Jamjoom, G. A., R. B. Naso, and R. B. Arlinghaus. 1977.

Further characterization of intracellular precursorpolyproteins of Rauscher leukemia virus. Virology78:11-34.

28. Kopchick, J. J., J. Harless, B. S. Geisser, R. Killam, R. R.

on November 10, 2019 by guest

http://jvi.asm.org/

(9)

478 LEVIN ET AL.

Hewitt, and R. B. Arlinghaus. 1981. Endodeoxyribonuclease activity associated with Rauscher murine leukemia virus. J. Virol. 37:274-283.

29. Lai, M.-H. T., and I. M. Verma. 1978. Reversetranscriptase of RNA tumorviruses.V. Invitroproteolysisof reverse transcrip-tasefrom avianmyeloblastosis virusandisolation ofa polypep-tide manifesting onlyRNase H activity.J. Virol. 25:652-663. 30. Lai,M.-H.T.,I. M. Verma, S. R. Tronick, and S. A. Aaronson.

1978. Mammalian retrovirus-associated RNase H is virus cod-ed.J. Virol.27:823-825.

31. Levin, J. G., B. F. Hughes, J. S. Graeter, A. Rein, E. Rands, and A. B. Mukherjee. 1982. Transfer of murine leukaemia and murinesarcomavirus genetic informationby transfection with isolated metaphasechromosomes. J. Gen. Virol. 62:227-237. 32. Levin, J. G., and M. J. Rosenak. 1976. Synthesis of murine

leukemia virus proteins associated with virions assembled in actinomycin D-treated cells: evidence for persistence of viral messenger RNA. Proc. Natl.Acad. Sci. U.S.A. 73:1154-1158. 33. Levin, J. G., and J. G. Seidman. 1981. Effect ofpolymerase mutations on packaging of primer tRNA""r during murine leukemia virusassembly. J. Virol. 38:403-408.

34. Lowy, D. R., E. Rands, S. K. Chattopadhyay, C. F. Garon, and G. L. Hager. 1980. Molecularcloning of infectious integrated murine leukemia virus DNA from infected mouse cells. Proc. Natl. Acad. Sci. U.S.A. 77:614-618.

35. Maniatis, T., E. F. Fritsch, andJ; Sambrook. 1982. Molecular cloning-a laboratory manual,p. 113-116. ColdSpring Harbor Laboratory,Cold Spring Harbor. N.Y.

36. Mark, G. E., and U. R. Rapp. 1984. Envelope gene sequence of twoinvitro-generated mink cell focus-formingmurineleukemia viruses which contain the entiregp7O sequenceof the endoge-nousnonecotropic parent. J. Virol. 49:530-539.

37. Maxam, A. M., andW. Gilbert. 1980. Sequencingend-labeled DNAwithbase-specific chemical cleavages. Methods Enzymol. 65:499-560.

38. Messing, J., R. Crea, and P. H. Seeburg. 1981. A system for shotgunDNA sequencing. Nucleic AcidsRes.9:309-321. 39. Miller, C. K., and H. M. Tenmin. 1983. High-efficiency ligation

and recombination of DNA fragments by vertebrate cells. Science220:606-609.

40. Modak, M. J. 1976. Pyridoxal 5' phosphate: a selective inhibitorofoncornaviral DNA polymerases. Biochem.Biophys. Res.Commun. 71:180-187.

41. Modak, M. J., and A. Srivastava. 1979. Reverse transcriptase-associatedribonuclease H does notrequire zinc forcatalysis.J. Biol. Chem. 254:4756-4759.

42. Moelling, K. 1974.Characterization of reverse transcriptase and RNase H from Friend-murine leukemia virus. Virology 62:46-59.

43. Nissen-Meyer,J., andI. F. Nes. 1980.Purificationandproperties ofDNA endonuclease associated with Friend leukemia virus. Nucleic Acids Res.8:5043-5055.

44. Ostrowski, M. C., D. Berard, andG. L. Hager. 1981. Specific transcriptional initiation in vitro on murine type C retrovirus promoters. Proc. Natl. Acad. Sci. U.S.A.78:4485-4489. 45. Perucho, M., D. Hanahan, and M. Wigler. 1980. Genetic and

physical linkage ofexogenous sequences intransformed cells. Cell 22:309-317.

46. Peters, G. G., and J. Hu. 1980. Reverse transcriptase as the majordeterminant for selectivepackagingof tRNA'sintoavian

sarcoma virus particles. J. Virol. 36:692-700.

47. Polsky, F., M. H. Edgell, J. G. Seidman, and P. Leder. 1978. High capacitygel preparative electrophoresis forpurificationof fragments ofgenomic DNA. Anal. Biochem. 87:397-410. 48. Rands, E., D.R.Lowy, M. R. Lander, andS. K.Chattopadhyay.

1981. Restriction endonuclease mapping ofecotropic murine

leukemia viral DNAs: size and sequence heterogeneity of the longterminal repeat. Virology 108:445-452.

49. Rao, R. N., and S. G. Rogers. 1979. Plasmid pKCI: a vector containing tenrestriction endonuclease sites suitable for cloning DNAsegments. Gene 7:79-82.

50. Rein, A., E. Athan, B. M. Benjers, R. H. Bassin, B. I.Gerwin, and D. R. Slocum. 1979. Isolation of a replication-defective murine leukaemia virus from cultured AKR leukaemia cells. Nature (London) 282:753-754.

51. Rein, A., and R. H. Bassin. 1978. Replication-defective ecotro-pic murine leukemia viruses: detection and quantitation of infectivity using helper-dependent XC plaque formatioh. J. Virol. 28:656-660.

52. Rein, A., B. M. Benjers, B.I. Gerwin, R. H. Bassin, and D. R. Slocum. 1979. Rescue and transmission of a replication-defec-tive variant ofMoloney murineleukemiavirus. J. Virol. 29:494-500.

53. Rigby, P. W. J., M. Dieckmann, C. Rhodes,and P. Berg. 1977. Labeling deoxyribonucleic acid to high specific activity in vitro by nick translation with DNA polymerase 1. J. Mol. Biol. 113:237-251.

54. Rowe, W. P., W. E.Pugh,and J. W.Hartley.1970.Plaqueassay techniques for murine leukemia viruses. Virology42:1136-1139. 55. Sawyer, R. C., and H. Hanafusa. 1979.Comparison of the small RNAs of polymerase-deficient and polymerase-positive Rous sarcomavirus and anotherspecies of avian retrovirus. J. Virol. 29:863-871.

56. Schwartz, D. E., R. Tizard, and W. Gilbert. 1983. Nucleotide sequenceof Rous sarcoma virus. Cell 32:853-869.

57. Shinnick, T. M., R. A. Lerner, and J. G. Sutcliffe. 1981. Nucleotide sequence ofMoloneymurine leukaemia virus. Na-ture(London) 293:543-548.

58. Southern, E. M. 1975. Detection ofspecific sequences among DNAfragments separated by gelelectrophoresis. J. Mol. Biol. 98:503-517.

59. Southern, P. J., and P. Berg. 1982.Transformation of

mammali-an cells to antibiotic resistance with a bacterial gene under controlof theSV40 early region promoter. J. Mol. Appl. Genet. 1:327-341.

60. Varmus, H., and R. Swanstrom. 1982. Replication of retrovi-ruses, p. 369-512. In R. Weiss. N. Teich. H. Varmus, and J. Coffin (ed.), Molecular biology oftumor viruses, RNA tumor viruses,2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

61. Verma, 1. M. 1975. Studies on reverse transcriptase of RNA tumor viruses. lII. Properties of purified Moloney murine leukemia virus DNA polymerase and associated RNase H. J. Virol. 15:843-854.

62. Vogelstein, B., and D. Gillespie.1979.Preparativeandanalytical purification of DNA from agarose. Proc. Natl. Acad. Sci. U.S.A. 76:615-619.

63. Vogt, V. M., A. Wight, and R. Eisenman. 1979.Invitrocleavage ofavian retrovirus gagproteinsby viral proteasep15.Virology 98:154-167.

64. vonderHelm,K.1977.Cleavage ofRoussarcomaviral polypep-tide precursorinto internal structuralproteinsin vitro involves viral proteinp15. Proc.Natl. Acad. Sci. U.S.A. 74:911-915.

65. Wahl,G.M.,M.Stern,and G. R. Stark. 1979.Efficiehttransfer oflarge DNAfragments from agarosegelsto diazobenzyloxy-methyl-paper andrapid hybridization byusingdextran sulfate. Proc. Natl. Acad. Sci. U.S.A. 76:3683-3687.

66. Wilbur, W. J., and D. J. Lipman. 1983. Rapid similarity searches of nucleic acid and protein data banks. Proc. Natl. Acad.Sci. U.S.A. 80:726-730.

67. Yoshinaka, Y., and R. B. Luftig. 1977. Properties of a P70 proteolyticfactor of murine leukemia viruses. Cell 12:709-719. J. VIROL.