Deletion and insertion mutations in early region 1a of type 5 adenovirus that produce cold-sensitive or defective phenotypes for transformation.

0022-538X/84/030731-10$02.00/0

Copyright C) 1984, American Society for Microbiology

Deletion and Insertion Mutations

in Early Region

la

of

Type

5

Adenovirus That Produce Cold-Sensitive

or

Defective

Phenotypes

for

Transformation

LEE E. BABISS, P. B. FISHER, ANDH. S. GINSBERG*

Departmentof Microbiology, Cancer CenterlInstitute of Cancer Research, Columbia University College of Physicians and

Surgeons, New York, New York 10032

Received19 August 1983/Accepted9November 1983

On the basis of earlierfindings showing that HShrl (hrl) is cold sensitive fortransformation, a seriesof

mutantswereconstructedsothat theycontained deletionsorinsertions indifferentsitesofearly region la

(Eta)toascertain: (i) whether the cold-sensitive phenotype ofhrlwasthe result of theidentifiedsingle-base

pair deletion of nucleotide 1,055orduetoamissense mutationatanother site and(ii)what regionand how

much of the Ela 51-kilodalton protein is actually required to produce cell transformation. A mutant,

HSdllOl (d1101), was constructed to contain a 5-base pair deletion ofnucleotides 1,008 to 1,012, which

producedaframeshift andasubsequentstopcodonatnucleotide1,241. Thismutant,whichshould encodea

truncated 33-kilodalton protein in place of the wild-type 51-kilodalton protein, had a cold-sensitive

phenotype for transformation essentially identicalto hrl. Consonantwith thisfinding, amutant (HSinlO6)

engineeredtocontaina16-basepair insertioninitiated after nucleotide 1,009,withastop codonbeginningat

thenewly inserted nucleotide 1,013, also had acold-sensitive phenotype like hrl anddllOl. It is striking,

however, thatamutant(H5dllOS)witha69-basepair deletion beginningatnucleotide 1,003,and havinga

stop codon atnucleotide 1,544, was totally defective for transformationat anytemperature. Transfection

studies withplasmids containing the ElaorEla and Elbgenesofsub3O9, hrl, anddllOl further revealed

that the cold-sensitive transformation phenotype observed couldbe exhibited in the absence of viral Elb

geneexpression.

Theearlyregionla(Ela) geneof adenovirus5 (AdS) (0to

4.5 mapunits [MU]) has been shown to serve an essential

role ininitiating both the viralproductive cycleinpermissive cells (3, 24) and the transformation of rodent cells (15, 20,

43). Whereas a number of deletion, insertion, and point mutations have been introduced into thisgene(7, 17, 25, 39),

very littleis known about the mechanism(s) bywhich

Ela-encoded proteins may interact with cellularfactors (31, 32) or virus-encoded macromolecules or both to elicit their

biological effects.

During

the

viralproductive infectiontwospliced mRNAs are synthesized early, 12S and 13S (4, 10, 26, 41), and

Montelletal. (30)have shown that the proteins encoded by

the smaller 12S mRNA are notobligatory for viral replica-tion. Viral host range mutants containing alterations in the

13SmRNAcoding

capacity

havethusfar been showntobe

defective in transformation and viral replicative functions, which suggests that the acidic 51-kilodalton (kd) protein

encoded

by

this mRNA (35) plays a critical role in both

processes.

The requirement for the 51-kd protein in the process of cellular transformation has been demonstrated by using a

viralhost range mutant, hrl (21), whichproduces a truncated

form of thisprotein (35). Recentinvestigations indicatethat

hrl is cold sensitive forthe maintenance of transformation

(1, 22). By using a cloned rat embryo fibroblast cell line,

CREF, it was demonstrated that clones ofhrl-transformed

cells display the transformed phenotype in a

temperature-dependent manner; i.e., at 32°C they reflect the normal

phenotypeof CREF cells and when shifted to 37°C as long as

3 weeks after infection they convert to the transformed

phenotype (1). These observations in conjunction with DNA *Correspondingauthor.

731

transfer-filterhybridization studiessuggest that thoseevents

leading to initiation, i.e., integration, are not conditionally

regulated in hrl-infected cells.

Although it has been demonstrated that hrl contains a

single-base pair deletion at nucleotide 1,055 (35), the entire

sequence ofthe Ela gene was not determined. Since this

mutant wasisolatedwith nitrousacid, itwaspossible thatan

additional missense mutation was present and that this mutation produced the conditionally lethal phenotype. To

approachthisproblemand toprobethefunction(s) ofthe

51-kd protein further, threeAdS mutants were constructed so that they contain deletions or insertions of nucleotide

se-quences aroundtheSmaI restrictionendonuclease cleavage

site (2.8 MU). Two of the viral mutants exhibited a

cold-sensitive transformationphenotypewhichwassimilarto that

found with hrl and confirmed that the single-base pair deletion in hrl was in fact responsible for the observed phenotype. In addition, DNA sequence analyses of the altered viral Ela gene sequences from the three viral

mu-tants revealed that coding sequences varying by no more

than 5 base pairs (bp) coulddetermine whetheratruncated

protein produced by the 13S mRNA was conditionally functional or inactive at 32 and 37°C. DNA transfection

studies described in this paper demonstrate that the Ela

gene sequences from the mutant viral genomes are capable

ofeliciting theconditional phenotypein the absence of Elb

genefunctions.

MATERIALSANDMETHODS

Constructionand characterizationofAd5 Eladeletionand

insertion mutants. The HpaI-EDNA fragment ofAdS (0 to

4.5 MU) was cloned into the PstI siteof

pBR322

(5),

using

theproceduredescribedbyStow(42). A 2-,ugportionof this

on November 10, 2019 by guest

http://jvi.asm.org/

XboI 0 3.8

XmoI XbaI 0 2.8 3.8 4.5

I a

Xmo I

Sl

orBal 31

Ligate

XbaI

0

3.8 4.5

I I L

XboI,

Ligote>

XbaI

0

8

Xba I

Isolate

3.8-100

fragment

I

Transfect

293 cells

100 5 0

° H5dllOl

H5dtlOS

SmaI XboI 0 2.8 3.8 4.5

Xbol linkers

Ligate

XbaI XbaI 0 2.8 3.8 4.5

I I

' mix

XbaI XbaI 3.8

0,2-8

/ 100

FIG. 1. Diagramof the methods usedto construct mutantsin the ElA region of Ad5. The diagram shownrepresentstheconstruction of dIlOl anddllOSby ligation of the mutated0-to3.8-MUfragmenttothe3.8-to100-MUfragmentof sub309 and theformation of in106 by

over-lap recombination betweenthemutated0-to4.5-MUfragment and the3.8-to100-MUfragmentofsub309. The0-to4.5-MU DNAfragment of Ad5 was cloned into the PstI site in pBR322. Open parenthesis represent areas ofdeleted DNA sequences, andopen triangles denote

restrictionenzymecleavage sitespresentontheviralgenomes.

plasmid DNAwascleaved with XmaI(2.8 MU) and digested

with either 6.25 Uornuclease S1 (P-L Biochemicals) for 30

minat30°Cor0.001 U of nuclease Bal31 (BethesdaResearch

Laboratories) for 30 minat 37°C. After the recircularization

of thesemolecules with T4ligase and cleavage with SmaIto

remove any molecules that escaped nuclease digestion,

Escherichia coli HB101 cells were transformed to

tetracy-cline resistance. Plasmids containing the desired deletions

were isolated, and their DNAs werepurified by the

Sarko-syl-lysate procedure of Clewell and Helinski (11).

Toprepareinsertions of linker DNA into the SmaI restric-tionenzymesite(Fig. 1), 1p.gofplasmid DNAwasdigested

with this enzymeandligated witha200-fold excessof XbaI

linker ends (CTCTAGAG; Collaborative Research). After

digestion with SmaI, the ligated molecules were used to

transform E. coli HB101 cells, selecting for

tetracycline-resistant colonies containing plasmids withtwo XbaI sites

2.8 and3.8 MU.

The modified viral Elagene contained withinthese

plas-midswereintroduced into the viralgenomeofsub3O9(25) by

aprocedure described by Stow (42) for dIlOl and d1105orby

overlap recombination (9). Toenhance thefrequency ofthe

overlap recombination event, subconfluent cultures of 293

cells (19) maintained in Dulbecco modified Eagle medium

supplemented with 10% calfserum wereexposed to 15 J of

UV light (254 mm; General Electric germicidal lamp), and

theirradiated cells were then incubated for 16 h at 37°C in

thedark. After the transfection of these cells (19) with the

overlappingDNAs (1 jig ofsub3O9 DNAcleaved with ClaI

and XbaI and 1 [tg equivalent of plasmid DNA containing Elagene sequences cleaved with PstI), viralplaques were

isolated after incubation for11days at 37°C.

All viruses were plaque purified three times before

pro-ducing stocks for characterization anduse. Mutant viruses

were identified by their SmaI digestion pattern (Fig. 2),

which revealed the loss ofone enzyme siteat2.8 MU. The

size of the deletions generated and the position of XbaI

linker in inlO6wasdeterminedby cloning the ClaI (2.6

MU)-HpaI (4.5 MU) DNA fragment from each virus into plasmid

vector pDR33 (37) containing unique ClaI and HpaI sites.

All of the plasmids constructed were propagated in E. coli

strain GM33 (27), which is deficient in adenine methylase.

The DNA was sequenced, according to the Maxam and

Gilbert (28)technique, after the plasmids werelinearized at

the ClaI site, and the 5' end of the plasmid DNA was

phosphorylated with T4polynucleotide kinase.

Viral transformation and DNA transfection assays with

CREF cells. CREF cells were usedfor viral transformation

assays aspreviously described (1, 12)at amultiplicity of

10-PFU of H5sub3O9, H5dllO1, or H5inlO6 or 30 PFU of

H5dllO5 percell. DNAtransfection assays wereperformed

with7 ,ug of recombinant plasmid DNA, with 3

jg

of salmon

spermDNA ascarrier(19). Approximately 10 CREFcells

inmonolayers in 10-cm platesweretransfected, and after 4 h

at 37°C the plates were treated successively with 15%

glycerol in phosphate-buffered saline, plain

phosphate-buff-ered salinealone, andtrypsin(0.125%)-EDTA (0.05%). The

cellswerereplatedat105 cellsina5-cm culturedish and fed

with low-Ca2+ medium twiceaweek for 8 weeks at37°C or

11 weeksat32°C,afterwhichtransformed fociwerecounted

and isolated. In all assays, each group contained eight

cultures ofreplated cells (i.e.,

105

cellsperculturedish).

Construction of recombinantplasmidscontaining earlygene sequencesfromhrl,dllOl,and sub3O9. The steps involved in

thecloning ofthe Elagene(HpaI-Efragment, 0to45MU)

or Ela and Elbgenes (XhoI-C fragment, 0 to 15.5 MU) of

hrl, sub3O9, and dllOl areoutlined and described in Fig. 3.

pLB209wasconstructed withpACYC177 plasmid DNA (8)

100

H5sub 309

H5 in 106

on November 10, 2019 by guest

http://jvi.asm.org/

[image:2.612.134.485.75.326.2]

A. o ) °0

ro - c:

0 LO)

t -r

-6

I

B.

2-1c

1

r() C

rn U_

-o

f___I

-A

-B

-c -

F/K'

-DE

-F -G

-H

-I

-K

-L-FIG. 2. Electrophoretic analysisofmutantviralgenomes,using

SmaIandXbaI restriction endonucleases. A1-pRgamountof DNA

from each virus described was digested with 4 U of (A) SmaI

(sub3O9, dIlOl,d11O5,andinlO6)or(B)XbaI(sub3O9andinlO6),and thefragmentswereseparatedon a0.6%agarosegel containing1 pg

of ethidium bromide perml. The bands were visualized with UV lightandphotographed.The F/K* bandgenerated bySmaIcleavage ofdIlOl, dllO5, and inlO6 represents afusion of the SmaI-F + K bands since the enzyme site at 2.8 MU is no longerpresent. The

presence of an additional XbaI site at 2.8 MU is detected by

cleavage of inlO6 with this enzyme to yield two unique DNA fragments, Bi (O to 2.8 MU) and B2 (2.8 to 3.8 MU). The DNA fragmentlabeledB inthe sub3O9lane extends from0 to3.8 MU.

and the AdS XhoI-C fragment instead ofthe Ad2 XhoI-C

fragment byaprocedure previously described (2). All DNA

fragmentsusedforligation and transformationwere purified

withlow-melting-pointagarose(Bethesda Research

Labora-tories). For the dIlOl plasmids pLB211 and PLB214, the

presence of the deletion at 2.8 MU was confirmed by

restriction enzymeanalysis.

Characterization of cells transformedby dIlOl, hrl, inlO6, and sub3O9. Two transformed fociresultingfrom viral infec-tion orDNAtransfection from each virus type werecloned

by seeding 100 cells per 90-mm plate and isolating

well-separated clones by using steel cloning cylinders. The ability of the cloned cell linestogrowinananchorage-independent

manner was assayed in agar as previously described (13).

Briefly, 103, 104, or 105 cells in low-Ca2+ medium

supple-mented with 0.4% Noble agar were layered on 0.8% agar bases prepared in low-Ca2+ medium. The plates were fed once aweek with 3 mlof 0.4%agarinlow-Ca2+ medium,and colonieswere countedat 3 weeks for37°Cand5to6weeks for 32°C cultures.

The presence of viral or plasmid DNA sequences in the cloned transformed cell lineswasdeterminedbyDNA filter-transferhybridization analyses, as previously described (12, 36, 40, 45).

RESULTS

Construction and isolation of viral deletion and insertion mutants. The protocol used to construct Ad5 insertion and deletionmutants sothat thecoding capacity of the Ela 13S

mRNA was affected is described in Fig. 1. Briefly, a plasmid

containing a cloned Ela gene (O to 4.5 MU) of AdS was

linearized with XmaI and digested with nuclease Si or Bal3l. By using an approach described by Stow (42), the modified viral Ela gene sequences were introduced back into a complete viral genome, using mutant H5sub3O9 (sub3O9) DNA (24). sub3O9 virus has a phenotype similar to

that of wild-type Ad5 (Ad5wt), but structurally it contains

only one XbaI site at 3.8 MU. Because of this genomic

organization, the 3.8- to 100-MU fragment of this sub3O9 can

be isolated and ligated to the 0- to 3.8-MU mutated DNA

fragments derived from the isolated plasmids. These ligated

molecules were then used to transfect 293 cells in a direct

plaque assay.

Alternatively, SmaI-digested plasmid DNA was ligated to the octanucleotide CTCTAGAG, which contained an XbaI

recognition site. The Ela sequences containing a newly

inserted XbaI site at 2.8 MU were then introduced into

sub3O9 DNA viaanoverlap recombination mechanism (9).

However, the small areaofhomology existingbetween the

twooverlapping DNA fragments (250 bp) resulted in a very

low frequency ofrecombination. To enhance the occurrence

oftherecombinational event,293cells werepretreatedwith UVlightand transfected after a 16-h inductionperiod in the

dark. The UV irradiation effected an enhanced ability to

recombine the overlapping DNAfragments upon

transfec-tion (L. E. Babiss and H. S. Ginsberg, manuscript in

preparation).

To confirm that the viral plaque isolates obtained did

contain alterations in their Ela gene sequences, after two

cycles of plaque purification on 293 cells, viral DNA was

isolated and analyzed by using SmaI or XbaI restriction

endonuclease. The three viral mutants analyzed all

con-tained alterations at 2.8 MU,which prevented SmaI

cleav-age at that site (Fig. 2A). As a result, the SmaI-K and -F

fragmentspresentintheparentalsub3O9 virus were fused in

the mutants viruses and resulted in a new DNA band of

higher molecular weight. H5inlO6 (inlO6)wasalsofoundto

contain an additional XbaI site at about 2.8 MU, which

confirmed the presence of the linker molecule within the viral genome (Fig. 2B).

Todeterminewhether aframeshiftmutation had occurred as aresult ofthedeletionsintroducedat 2.8MUorwhether

the linker sequences ligated properly at the site, DNA

sequence analyses were performed (28). By using acloned

DNA fragment derived from each ofthe mutant viral

ge-nomes,itwasdetermined thatH5dl101

(dlOl)

containeda

5-bp deletion extending from 1,007 to 1,013 bp; H5dl105 (dIlO5) contained a 69-bp deletion extending from 1,002 to

1,072 bp; and H5inlO6 contained an insertion of 16 bp

between 1,009and 1,010 bp (Fig.4). Although no alteration

of the reading frame occurred for d11O5, the frameshift mutation that wasintroduced into thecoding region ofthe

13S mRNA for dllO1 resulted in the occurrence of a stop

codonbeginningatnucleotide 1,241 and presumably caused

termination of translation. The 16-bp insertion determined

for inlO6 indicated that two linker molecules were ligated

into the SmaI site in tandem, which produced an in-frame

stop codon at the insertednucleotide 1,013.

Transformation characteristicsofsub3O9 and Ela deletion

and insertion mutants. It was previously shown that hrl

exhibits a cold-sensitivephenotype for transformation, using

bothprimaryratembryocells(22) and CREF cells (1). When

CREFcells wereinfected withdllOl, followedby replating

oftheinfectedcells at32°Candgrowth for6weeks at32°C, morphologically transformed foci could not be discerned

on November 10, 2019 by guest

http://jvi.asm.org/

[image:3.612.57.297.76.301.2]

A

BomHI pLB209'

ANhoI

CI %

%s

0.0 2.6 15.5

B

CloI XhoI

0.02.6 15.5

|XhoI aCIoI

H5hrl

or Ta-Z9-

H5dIlO

100 or

H5sub309

I

2I'll

sub309,pLB210

W(iR~- H45dl101,pLB211

11 H5hrl,pLB212

0.0 15.5

BomHlIaHpaoI

>|Ligote

(<m HI

-.g-r '. sub3O9,pLB213

Hpol ( H5d1101,pLB214

| l'B H5hrl,pLB215

4.5 0.0

FIG. 3. Methodsfor constructing plasmids containing mutationsin theearly regionsof Ad5 DNA. Theprocedureforcloningthe Ela and Elbgenesof eachvirus indicated ispresented (A).pLB209 containstheXhoI-C(Oto15.5MU)fragmentofAdScloned intopACYC177 (8)

and itsconstructionhas been describedbefore(2). A2-,ugamountof hrl, sub309, ordllOl virus DNAwascleaved with ClaI andXhoIand mixed andligated with100ngofpLB209 cleaved with thesame enzymesand HpaItoinactivatethe Ad5wtfragment extending from2.6to

15.5 MU. After transformation ofE. coliHB101 cells, ampicillin-resistant colonies were selected and the resulting plasmids, pLB210,

pLB211, andpLB212,wereisolated. To clone only the Elageneofeachvirus(B),one,ug ofeachplasmid described abovewascleavedwith

BamHIandHpaI andligatedto100ngofpDR33plasmid DNA cleaved with thesame enzymesand Sall. Ampicillin-resistant colonieswere

selected aftertransformations ofE. coliHB1Ol cells, and plasmidspLB213,pLB214, and pLB215wereisolated.

(Table 1). However, like hrl, ifdllOl-infected CREF cells were maintained at 37°C, the frequency of transformation was fivefold higher than for sub3O9 or Ad5wt-infected

cul-tures(Table 1). It should also be noted thatdllOlandinlO6

(describedbelow), like hrl, had the same minimal cytopathic

effects on CREF cells as sub3O9, and thus the increased

transformation frequency produced by these mutants must be attributeddirectly to the altered viral product.

Allfocigenerated by the mutant virus at 37°C exhibited a

fibroblasticmorphology; in contrast, sub3O9 and Ad5wt foci

contained a mixture of both fibroblastic and epithelioid

colonies. Shift-up and shift-down experiments with

dllOl-infected CREF cells were similar to the previous findings with hrl (1). When mutant-infected cell cultures were shifted

from 32 to37°C 2 or 3 weeks after infection, the frequency of

transformation approached thatof infectedcells maintained at 37°C throughout theexperimental period (Table 1).

Con-versely, upon shifting cultures from 37 to 32°C, the number

of foci decreased, the majority of the transformed foci

becameflattened, and the cells were not dissimilar from the

surrounding CREF cells.

It is important to note that the cold-sensitive nature of

thesevirusesis not absolute. CREF cells infected with hrl or

dllOl,andmaintainedat32°C for aperiodof 8 weeks, could

developa few small foci, which probably reflected a small

amountof"leakiness" associatedwith thediminished

func-tion of thetruncated protein.

From theseobservations itcan beinferred that hrl

proba-blydoes notcontain asecond-sitemutation. In addition, the

functional domain of the 51-kd proteincould now bemore

precisely positioned sincethemutationpresentin dllOl was

47bp upstream from the hrl deletion.

To determinewhether theadditional missense amino acids

present in the truncated protein encoded by dllOl were

on November 10, 2019 by guest

http://jvi.asm.org/

[image:4.612.164.479.72.460.2]

Ad5 Wt

499 561 ACT ATG

+

" 1544

1112J,

"^1229 TAA 1632

is %I t I

61lbp 1085 -,A

1055 TGA , '

-GGG6ACCJ-T

H5hrl

1000

a5bp

H5dllO

GGAGCACCMCAC-1000

H5dlI05

GGAG

1000

669bp

Protein

M.W.

51K

28K

^ 1241

,' %. TGA

, v

ol%

J. %

(30K)

1544 TAA

(47

K)

1013 TAG v 16bp

[image:5.612.62.531.77.282.2]

H5in

106

GGAGCACCCCCTCTAGAGCTCTAGAGG

'-(24K

)

FIG. 4. Nucleotidesequencesofdeletionsandinsertions constructed in the 13S mRNA of the ElaregionofAdSandproposedtranslation

product. A DNA fragment extending from 2.6 (ClaI)to4.5(HpaI)MU fromdllOl, d1105,andinlO6wasclonedintoplasmidvectorpDR33and

waspropagated inadam strain of E. coli(GM33). The DNAsequencefromtheClaIsitewasdeterminedbythechemicaldegradationmethod

ofMaxamandGilbert(28). ThesequencedatapresentedforAd5wt and hrlweredeterminedbyvanOrmondt et al.(44)andRicciardi etal.

(35),respectively. Dashed linesrepresentsequencesremovedduringsynthesisof the 13S mRNA. Hatchedboxesshow thedeleted(A)DNA

sequence ineach mutant, and the bold line above the sequence indicates insertions (V) of linkerDNA. Parentheses around the protein molecular weight (M.W.) values indicate predicted sizesfromDNAsequence data(44).

actingtostabilizeit inaconditionallyactiveconformationat

37°C, a mutant virus was constructed, inlO6, which

con-taineda16-bp insertionat2.8MUandgeneratedanin-frame

translational termination signal beginning at the newly

in-serted nucleotide 1,013 (Fig. 4). The position of this stop

codonenables the 13S mRNAtoencodeapredicted

truncat-ed protein of 24 kd, containing the same amount ofsense

aminoacidsasdilOl but onlyone missenseamino acid.

Transformation studiesperformed usinginlO6 withCREF

cellsrevealed that it hadaconditional, cold-sensitive

pheno-typesimilartothat of dllOl(Table 1). Thisindicated that the

missense amino acids present in the truncated protein

en-codeddllOl werenotacting tostabilize it in aconditionally

activeform.

Asa meansofmoreaccurately determining what domain

of the 51-kd protein was essential to retain some function, d1105 virus (Fig. 4) was used to infect CREF cells in a

transformationassayat 32 and37°C. Uponinfection withas

muchas30PFU/cell,nodiscernible focideveloped ateither

temperatureforincubation periods extendingup to8weeks

(Table 1). The 69-bp deletion asymetrically located around

2.8 MU distinguished dllO5 from dIlO1 in two ways. First,

the sense amino acids incorporated downstream from the

deletion present in dllO5 appeared unable to influence the

function of the truncated protein. Second, the coding

se-quences upstreamfromthe start of the deletions present in

both dllOl and dllO5 revealed a difference of only five

nucleotides. As a consequence, the truncated protein

en-coded by dllO5 contained two fewer sense amino acids

(codons GAG and CAC at positions 148 and 149; refer to

Table 2). Therefore, the nucleotide difference between the

function ofaprotein activeat37°C andaprotein thatcannot

produce transformationateithertemperaturecouldbe

local-ized to a 5-bp region extending from nucleotides 1,002 to

1,007.

[image:5.612.314.556.405.648.2]

Biological properties and integration patterns of mutant

TABLE 1. Comparative transformation of CREF cellsbyAd5wt,

sub309,and Eladeletion and insertionmutants atvarious

temperatures

Incubation Transformation

Expttemp period Fociperplate

(wk) (mean+ SD)h Frequency

Ad5wt

32 6 26±2 2.6x 10-4

37 6 24 3 2.4 x 10-4

sub3O9

32 6 29 5 2.9 x 10-4

37 6 35 3 3.5 x 10-4

dIlO1

32 6 0 <1 x 10-5

37 6 179 ± 7 1.79 x 10-3

32-37

2+4 149±6 1.49x 10-3

32-37 3 + 3 85 ±2 8.5 x 10-4

37 32 2+4 7±2 7x 10-5

37-32 3+3 42±7 4.2x 10-4

d1105

32 8 0 <1x10-5

37 8 0 <1X10-5

in106

32 6 0 <1 x 10-5

37 6 163 ±5 1.6 x 10-3

aCREF cellswereinfected with 10 PFUof

Ad5wt,

sub309, dIll1,

orin106orwith 30 PFUofd1105percell; after2 hof viraladsorption

at32°C, cellswereresuspendedandreseededat105cells per 60-mm

plate at32or37°C. Cultures were either maintainedat32or37°C continuouslyfor 6to8weeksorshiftedtotheindicatedtemperature

at2or3weekspostinfection. Allcultureswerefixedandstainedat

thetimes indicated.

b Meannumberof transformed coloniesorfociper105 cells. Each groupconsisted ofeight culture plates.

.0

0

on November 10, 2019 by guest

http://jvi.asm.org/

[image:6.612.66.560.85.169.2]

TABLE 2. Summary of DNA sequences, proposed amino acid positions, and transformation data of Ad5wt and Ela mutant viruses

Mutation Amino acid atposition': Transformation

Virus Type Site 148 -149-150

-151 -152

Foci'

Cold

(bpY' sensitive

Ad5wt glu -his-pro-gly -his +

5hrl Al 1,055 glu -his-pro-gly -his + +

dIlOl A5 1,007-1,013 glu -his-pro-arg-leu + +

inlO6 V16 1,009-1,010 glu -his-pro-leu -stop + +

dllO5 A69 1,002-1,072 asp-ser- leu -cys -tyr

a A,Deletion; V, insertion. Amino acids and location were not determined experimentally, but were inferred from the nucleotide sequence of this gene by van Ormondt et al. (44) and the deletion and insertion mutants presented in Fig. 4.

bAbility to induce focus formation at 37°C.

virus-transformed CREF cellsat32 and37°C. Thepatternsof

viral DNA integration into chromosomal DNA oftwo setsof

cloned dllOl- and inlO6-transformed CREF cell lines were

examined by cleavage with XbaIorBglII followed by DNA

transfer-filter hybridization analysis (40). Cell line 101-6

appearedtocontain dllOlgenomeDNAintegratedatseveral

sites (Fig. 5A), whereas 101-8 appeared to contain a single

viral DNA integration site. BglII cleavage of cellular DNA

isolated from cell lines 106-B2 and106-B4revealedthatmost

of the viral genome was present in these cells, with the

terminal fragments being larger owing to integration (Fig.

SB). Like hrl-transformed CREF cell lines (1), the

integra-tionpatternof the cloned cellswasnotalteredby shifting the

cultures to 32°C and maintaining them at that temperature

(datanot shown).

Whereas the transformation studies showed similarities

amonghrl, dllOl, and in106, itwas important to determine A.

XboI

a)

(0

-.

_ o *

B.

Bg II

._

*_ _

AP wh.

FIG. 5. AnalysisofdllOl and inlO6sequencesin CREF cells.A

10-,ug portion of cellular DNA isolated from the cloned cell lines indicatedwascleaved withXbaI (A)orBgIIl (B),and the fragments

were separated by electrophoresis in0.6% agarose, transferredto

nitrocellulose sheets by blotting, and hybridized to sub3O9 DNA

labeled with32P by nicktranslation (36, 40,45). The marker lane in

(A)representsfivegenomeequivalentsof sub3O9DNAcleaved with

XbaI,and the marker lane in(B)represents thesame quantity of

sub3O9 DNA cleaved withBglII.Thestarred DNA bandsrepresent terminal fragments which are not present in the transformed cell

linesduetoviral DNAintegration.

whether the cloned celllines derived from transformed cell

fociproduced by the latter twoviruses continuedtoexhibit

the cold-sensitivephenotype. Both cell lines 101-6 and 101-8

at37°C had cloning efficiencies inagarthatweresimilartoor

exceeded that of wt3A, an Ad5wt-transformed CREF cell

line (12) (Table 3). When assayed at 32°C, the cloning

efficiency of wt3A remained relatively unchanged, but cell

lines 101-6 and 101-8 were decreased by 73 and 95%,

respectively. Whereas the sizes of the growing colonies of

wt3A cellsat32 and 37°Cwere similar, therewas amarked

decrease in the colony sizes ofmutantvirus-transformed cell

coloniesgrownin32°C when compared with those incubated

at 37°C. In addition, the highagarcloning efficiency of cell

line 101-6at37°C incomparisonwithwt3A, 101-8, and

106-B4maybe duetoanenhanced level of viralgeneexpression,

perhapsas aresultof theintegration ofagreaternumberof

genomecopies (Fig. 5A).

Construction ofplasmidscontaining the ElaorEla andElb

genes from dllOl, hrl, and sub3O9. The studies described

above strongly indicated that the deletionpresentin the Ela

geneof hrlwasin fact thecauseof the conditional

transfor-mation phenotype and that a region around 2.8 MU was

critical for the function of the 51-kdprotein. It remained to

be determined whether the cold-sensitive nature of the

truncated proteins encoded by the mutantviruses required

functions of viral Elbgeneproductsorwaspossibly dueto

aninteraction of the Elaprotein withsomecellularfactor(s).

Totestthesepossibilities, plasmidswereconstructed which

TABLE 3. Cloning efficiencyin soft agarofuninfected, wt5-transformed, dllOl-transformed, and inlO6-transformed CREF

cells grownatvarious temperatures

Cloningefficiencyinagar(%)a

Cellline

370C 32°C

CREF <0.001 <0.001

Ad5wt-3A 45 ±2 38±2

dllOl-6 98 ±1 27±

2b

dllOl-8 47± 5 3.2± 1b

inlO6-B4 53±8 9± 2b

aApproximately 103,104,or105 cellswerepreparedinlow-Ca2+

medium containing0.4%Noble agar and seededat 37 or320Con 0.8% agar base layersprepared in thesamemedium. Plateswerefed

once aweek with2 to 3 mlof0.4% agaron

low-Ca2`

medium,and colonieswerecountedafter3weeksfor37°Cand after5to6weeks for320C cultures. Eachvalueisthemean ± standard deviation of fourplates.

b The final sizes of the mutant virus-transformed cell colonies countedat320Cwereconsistently fourtofive times smallerthanthe colonies cultured at370C.

on November 10, 2019 by guest

http://jvi.asm.org/

[image:6.612.116.256.410.623.2] [image:6.612.324.562.562.637.2]

[image:7.612.60.298.103.214.2]

TABLE 4. Transforming activity in CREF cells ofhybrid plasmids containing ElaorElaand Elb gene sequences ofdIlOl,

hrl, and sub3O9

ClonedviralDNA Fociperplate

Plasmid clone Cloned viral DNA (mean ±SD)b used for

transformation' Origin Genome 32°C 37°C

region

pLB210 sub3O9 Ela + Elb 8± 2 8± 2

pLB211 dIlOl Ela +Elb 0 19± 3

pLB212 hrl Ela+ Elb 0 22 ± 1

pLB213 sub3O9 Ela 6 ±2 8± 1

pLB214 dIlOl Ela 0 10± 1

pLB215 hrl Ela 0 6± 1

pACYC177 0 0

aApproximately106CREF cellsweretransfected with7,ugof the desired plasmid DNA, using the calcium precipitation technique. After 3 h of incubationat37°C, 15%glycerol inphosphate-buffered saline was added, after which cellswereresuspended and reseeded

at

10'

cells per 60-mm plateat32°C for11weeksor at37°C. Cultures were maintainead at 32°Cfor 11 weeks or at 37°C for 8 weeks, at which time the monolayers were fixed, stained, and counted. A 7-,ug portion ofEla-containing plasmids equals 59-,ug genome equiva-lents; 7 ,ug ofEla+ Elb-containing plasmids equals31-p.ggenome equivalents.

bMeannumberof transformed colonies per105 cells.

contained theDNA sequencesof eitherEla or Ela and Elb

from dllOl, hrl, and sub3O9, andtherecombinantplasmids wereusedtotransfect CREF cells to notetheir transforma-tionpotentials at32 and37°C.

Theconstruction of the varioushybrid plasmids

contain-ingEla or ElaandElbgene sequencesis describedinFig.

3. Mutant viral Ela and Elb DNA sequences (2.6 to 15.5

MU) were substituted for comparable wt sequences to

generate an intact viral sequence extending from 0 to 15.5

MU. With this approach, a series ofplasmidswere isolated containing the Ela and Elb regions of the desired viral

genomes. Thenewly isolatedplasmid strainswereusedas a

source for viral Ela sequences (O to 4.5 MU), which were

subcloned into plasmidvector pDR33 (Fig. 3B).

Plasmid DNAs were used to transfect CREF cells in a

transformation assay at 32 and 37°C. All of the plasmids

containing

viral DNA sequences were

capable

ofproducing transformed foci at 37°C (Table 4). However, no foci

ap-pearedat32°C whenanyof the

plasmids

derived fromhrl or

dllOl were used. In contrast, sub3O9plasmids transformed CREFcellsatthesame

frequency

at32 or37°C. Therefore, the viraltransformation studies described above correlated

exactly with the results oftheplasmid transfection

experi-ments.

It should be noted thatthe morphology of Ela- and Ela

plus Elb-transformed CREF cells were different.

Trans-formed foci produced by Ela plasmids (pLB213-pLB215)

werefibroblastic and relatively flat. In contrast, sub3O9Ela

plus Elb plasmid-transformed CREFcells were amixture of fibroblastic and

epithelioid

cells, and the cell colonieswere

raised.However, foci producedat37°C by plasmids

contain-ingboth Ela and Elb DNAfromhrlordllOl(pLB211 plus

pLB212) were solely fibroblastic but retained the ability to

produce raised colonies. DNA filter-hybridization studies

demonstratredthattransformed CREFcells,whichhad been

transfected with the various plasmid DNAs, contained the

expected viral DNA sequences (data not shown). In

addi-tion,theability ofthe clonedtransformedcell lines to grow

in agar correlated with their abilty to express the

cold-sensitivephenotype: the Ela- and ElaplusElb-transformed

cells derived from hrl or dllOl showed reductions in agar

cloning efficiencies when grown at 32°C as opposed to 37°C

(datanotshown).

DISCUSSION

The data presented in this paper demonstrate that when

frameshift mutations are introducedinto the 13S mRNA of

the Ela gene of Ad5 via deletion or insertion of genetic

material, some of the viral mutants obtained exhibit a

conditional, cold-sensitive transformation phenotype. This

phenotype can be attributed solely to the altered gene

product encoded in the 13S mRNA since the defects were

placed in theintrons ofthe 12S and 9S mRNA transcripts, thus leaving these mRNAs, and hence theirgene products,

unaltered. The initialviral mutantisolated,dllOl, was

engi-neered to contain a 5-bp deletion at 2.8 MU (nucleotides

1,007to1,012),and it wasutilized to investigate: (i) whether hrl might contain a missense mutation, in addition to the

single-base

pair deletion, to account for its conditionally

lethal,

cold-sensitivephenotype; and (ii) how much of the

51-kd Elaproteinwasrequired to transform cells.

Previous studies had shown that the truncated 28-kd

protein

encoded by the 13S mRNA ofhrl (35) effected the

conditionally

functional phenotype for the maintenance of the transformed cell (1, 22). However, it was necessary to

determine whethera mutation other than the known

single-base

pair

deletion in hrl was

producing

the conditional

phenotype

observed since it is uncommon for a nonsense

mutationtodisplayaconditionallylethalphenotype.

Where-as marker rescue

(14)

of the known mutation or back

crossing

of the mutation into a known wt genome is the

traditional

approach

to the

problem,

dllOl answered this

question by revealingthataframeshift mutation introduced

47bpupstream from the lesion present in hrl could generate

the same

phenotypic

characteristics. Unlike

hrl,

dllOl's

mutation was introduced via in vitro

manipulation

and

therefore decreasedthelikelihood ofthere

being

an addition-almutation upstreamfrom the

engineered

deletion.

It is

important

to note that the cold-sensitive mutants

described in this communication did not exhibit a normal

transformedphenotypeevenwhenmaintainedatthe

permis-sivetemperatureof37°C. Thus, allofthe cells transformed

by hrl, dllOl,

and inlO6 at 37°C were

fibroblastic,

as

opposed

to

epithelioid,

and they weregenerated at a

five-fold-higher frequency

thanwas wtvirus. These dataindicate thatatleastonedomain of the truncated

protein

produced by these virusesmaybe

conditionally

functional andthat,when

this

domain(s)

was reducedby asfewasfivenucleotides, it hadlost itsabilitytofunctionnormally at either temperature. Itwas

previously

shownthat hrl-transformedcells grown at 32or

37°C

maintainthe sameviralDNAintegrationpattern

(1)

and that hrl- ordllOl-infected CREF cells shifted after

prolonged periods

at32 to37°Cstill producetransformed cell

foci.These

findings

suggestthatthose eventsthat lead to the

integration

of the viral genome into the host cell

chromo-some, and

possibly

the initialexpressionof Ela gene

prod-ucts,areunaffectedbythemutationpresent or even enhance

the

ability

of the mutant virus to initiate these events.

Studies with these viruses are presently under way to

determine whether an increase in the overall

frequency

of

integration

is the event responsible forthe higher

transfor-mation

frequencies

observed.

The

position

of the deletion present in dllOl further

suggested

thatonlyalimitedregionof the 51-kdproteinwas

on November 10, 2019 by guest

http://jvi.asm.org/

required to retain partialfunctionality. However, since this

mutant did not encode an in-frame stop codon(TGA) until

nucleotides1,241 to 1,243, it was possible that the additional

missense amino acids incorporated into the truncated

pro-tein werefunctioning to stabilize it in a conditionally active

form. This problem was approached by constructing a

mutant virus, inlO6, so that it contained a 16-bp insertion

betweennucleotides 1,009 and1,010,whichgeneratedan

in-frame stopcodon(TAG) at thenewlycreatedposition1,113

to 1,116 (Fig. 4). Transformation studies with this virus

revealed that it behaved like hrl and dllOl and thus

demon-strated thatthe missense amino acids present in the

truncat-ed protein encodtruncat-ed by dllOl and absent in the protein

encoded byin106were notrequired to retain the conditional

transformation functions observed for either virus.

DNAsequence analysis ofd1105revealed that itcontains a

69-bp deletion extending from nucleotides 1,002 to 1,072.

Unlike all ofthe previous viral mutants tested, this virus was

completely incapable of generating transformed CREF cell

foci atmultiplicities as high as 30PFU/cellregardlessof the

temperature of incubation. Since the deletion present in

d1105 was not symmetrical around the SmaI restriction

endonuclease cleavage site at1,009 bp, this mutant anddllOl

only differed by 5 bp upstream from the start of the deletion.

The mutants' characteristics (Table 2) note that wt5, hrl,

dlO1l, andinlO6retain the sameamino acid sequenceaswt

virus at positions 148 to 150, at which site missense amino

acids are introduced. WhereasdlO1lwas shown tocontaina

5-bp deletion, the first amino acid produced owing to the

frameshift remained a proline at position 150 due to

degen-eracy of theamino acid code. Whetherthishistidine-proline

amino acidsequence is absolutely required for thetruncated

proteins produced by these mutant viruses to function in

transformation, or possibly to maintain its integrity, is

presently being investigated by constructing an additional

viral mutant with a 4-bp deletion at this site. This type of

lesion would result in an amino acid sequence of histidine

and arginine at positions 149 and 150, respectively. It is

important to note that, although H5in500 (7) retains the

histidine-proline amino acids, itis transformation defective

just as are allof the previously isolated viralmutantsthat do

not retain this amino acid sequence (25, 39). However, the

lowfrequencies oftransformation reported bythese

investi-gators,perhapsowingtothedifferentratcells used,maynot

have allowed them to detect the partial transformation

phenotypethat is obtained with the Ela mutantsdescribedin

this communication.

Ho et al. (22)described the isolation of Ad5 mutantsthat

are cold sensitive for replication in HeLa cells. Both dllOl

and

inlO6

also display this type of conditionally host range

lethalphenotype for replication (manuscriptinpreparation).

However, although the final viral yield obtained in HeLa

cells witheither virus at 37°C approaches that of

Ad5wt,

the

eclipse period is extended,suggesting that inreplicationasin

transformation only a partial function of the truncated pro-tein is attained at this temperature.

The lesionthat produces a conditional phenotype is

classi-callyamissense mutation at asingle basepair. Althoughour

observations that frameshift mutations brought about by

deletion or insertion of genetic material can yield a

cold-sensitivephenotype are unusual, they are notuniquetothis

system.Pintel et al. (34) isolated adeletion mutantofsimian

virus 40which lacks 81 bp at the C-terminal end of thelarge

T antigen and demonstrated that transformation of rat cells

by this viruswas cold sensitive. These findings were further

extended (33) to show that this virus was heatsensitivefor

viralreplication, whereas, in contrast, the transformed cells

derivedfrom this virus were cold sensitive for maintenance

ofthe transformed phenotype. Bryant and Parsons (6) have

constructed deletion mutants of Rous sarcomaviruses and

haveshown that one mutant, tsCH119, is heat sensitivefor

the maintenance of the transformed phenotype in chicken

cells.

It haspreviously been shown that the Ela geneofAd5(23)

or Adl2 (38) can partially transform rodent cells, whereas

studies thatused a DNAfragment fromAd5 extendingfrom

0 to 8.0 MU revealed that Ela and partial Elb geneproducts

(the 19K and truncated 58K proteins) can effect complete

transformation (16). Those findings suggest that a Elagene

product(s) may act independently or interact with cellular

factors to initiate and maintain the partial transformed phenotype,which alsohas been a proposedfunction forthe

Ela gene product(s)in viralreplication(31,32). The

expres-sion of the Elb-encoded 19K and truncated 58K proteins

mayproduce the completely transformed cells observed by

theirinteracting with Ela proteins or cellular factors or both,

or they may function independently.

Todetermine whether thecold-sensitive phenotype could

beexpressed in the absenceofElb geneproducts,

recombi-nantplasmids wereconstructed which contained the Ela or

Ela and Elb genes ofsub390, hrl, and dllOl, and these were

used to transfect CREF cells in a transformation assay.

Although it has been demonstrated that the processes lead-ing to cell transformation by infection or transfection of susceptible cells can vary (29), our transfection studies

correlated completely with the results of virion infections

(Table 4). The transformation frequencies with plasmids

containingElaor Ela and Elb gene sequences from hrl and

dIlOl werehigher at 37°C thanthose with plasmids derived

from sub3O9, in keeping with the increased transformation

frequency noted when the mutant virions were used. In

addition, the morphology ofthetransformed cells obtained

with the mutant viruses or sub3O9 Ela gene-containing

plasmid was fibroblastic in contrast to the epithelioid cells

produced by the sub3O9 plasmids containing Ela andElb.

Ela gene sequences transfected into CREF cells derived

from hrl or dllOl were unable to induce foci at 32°C, indicatingthat they hadretained theirconditional phenotype in the absence of viral Elbgene expression.

The datadescribed using viruses with specific mutations

intheportion ofthe genomeencodingthe Ela 51-kd

protein

imply that it is this viral gene product that is necessary to

maintaintherecognizedproperties of transformed cells.The

conditionally lethal, cold-sensitive phenotype

expressed by

the mutated genomes, whetherintroduced intoCREF cells

by infection with virions or by transfection with intact

genomes or plasmids, implies that the Ela 51-kd

protein

interacts with a viral (Ela 12S gene product) or a host macromolecule(s) or both. The cold-sensitive phenotype

probably reflects a decreased binding constant at 32°C

betweenthemutants' truncatedproteins and astill

unidenti-fied macromolecule(s). Identification of the components

involved and the characteristics of the viral protein

macro-molecularinteractions should revealcritical clues to

under-standingthe mechanisms of viral transformation.

ACKNOWLEDGMENTS

This workwassupported byPublicHealthServicegrant AI 12052

(H.S.G.) from the National Institute of Allergy and Infectious

on November 10, 2019 by guest

http://jvi.asm.org/

Diseases and grant CTR-1532 (P.B.F.) from the Council for Tobacco Research.

We thank Thomas Shenk forHSsub3O9 and Donald Mills, Lisa Brunet, and David Bechhofer for theirhelp inDNAsequencing.

LITERATURECITED

1. Babiss, L. E., H. S. Ginsberg, and P. B. Fisher. 1983. Cold-sensitiveexpression of transformationbyahostrangemutantof type5adenovirus. Proc. Natl. Acad.Sci. U.S.A. 80:1352-1356. 2. Babiss, L. E., C. S. H. Young, P.B.Fisher,and H.S.Ginsberg. 1983.Expression ofadenovirus Ela and Elb geneproducts and theEscherichiacoli XGPRT gene inKBcells. J. Virol. 46:454-465.

3. Berk, A. J., F. Lee,T.Harrison, J. Williams,and P. A.Sharp. 1979. Pre-earlyadenovirus5genomeproductregulates synthe-sis of early viral messengerRNAs.Cell 17:935-944.

4. Berk, A. J., andP. A.Sharp. 1978. Structure ofadenovirus 2

early mRNAs. Cell 14:695-711.

5. Bolivar, F.,R. L.Rodriquez,P.J. Greene,M.C.Betlash,H. L.

Heynecker, and H.W.Boyer. 1977.Construction and character-ization of new cloning vehicles. II. A multipurpose cloning system. Gene 2:95-113.

6. Bryant, D., andJ. T.Parsons. 1982. Site-directed mutagenesis of the src gene of Rous sarcoma virus: construction and characterization ofadeletionmutanttemperature sensitive for transformation. J. Virol. 44:683-691.

7. Carlock,L.R.,andN. C. Jones. 1981.Transformation-defective

mutant of adenovirus type 5 containing a single altered Ela mRNAspecies. J. Virol. 40:657-664.

8. Chang, A. C. Y., and S. N. Cohen. 1978. Construction and characterization ofamplifiable multicopyDNAcloning vehicles derived from the P1SA cryptic miniplasmid. J. Bacteriol.

134:1141-1156.

9. Chinnadurai, G.,S.Chinnadurai,andJ.Brusca. 1979.Physical mapping ofa large plaque mutation of adenovirus type 2. J.

Virol. 32:623-628.

10. Chow, L. T., T. R. Broker, andJ. B. Lewis. 1979. Complex splicingpatternsofRNAfrom theearlyregions of adenovirus2. J. Mol. Biol. 134:265-303.

11. Clewell, D. B., and D. R. Helinski. 1972. Effect of growth conditionsontheformation of therelaxationcomplexof super-coiledColElDNAandprotein in Escherichia coli.J.Bacteriol. 110:2235-2246.

12. Fisher,P.B.,L. E.Babiss,I. B.Weinstein,and H.S. Ginsberg.

1982. Analysis of type 5 adenovirus transformation with a

cloned rat embryo cell line (CREF). Proc. Natl. Acad. Sci. U.S.A.79:3527-3531.

13. Fisher, P. B., N. I. Goldstein, and I. B. Weinstein. 1979.

Phenotypic properties andtumorpromotor inducedalterations in rat embryo cells transformed by adenovirus. Cancer Res.

39:3051-3057.

14. Frost, E.,andJ. Williams. 1978.Mapping temperature sensitive and host-range mutations of adenovirus type 5 by marker rescue.Virology 91:39-50.

15. Gallimore, P. H., P. A. Sharp, andJ. Sambrook. 1974. Viral

DNA in transformed cells. II. A study of the sequences of adenovirus 2DNAin nine lines of transformed ratcellsusing

specific fragmentsoftheviral genome. J. Mol. Biol. 89:49-72.

16. Graham,F. L.,P. J. Abrahams, C. Mulder, H. L. Heijneker, S.0.Warnaar,F. A.J. DeVries,W.Fiers, andA.J.vanderEb.

1974. Studies on in vitro transformation by DNA and DNA

fragments of human adenovirus andSV40.ColdSpring Harbor Symp. Quant.Biol. 39:637-650.

17. Graham, F. L., T.Harrison, and J. Williams. 1978. Defective transforming capacity of adenovirus type5host-rangemutants.

Virology 86:10-21.

18. Graham,F. L., J. Smiley, W.C. Russell, and R. Nairn. 1977. Characteristics ofahumancell line transformed byDNAfrom human adenovirus type 5. J.Gen. Virol.36:59-72.

19. Graham,F.L., andA.J.van der Eb.1973.Anewtechnique for

the assay of infectivity of human adenovirus type 5 DNA.

Virology52:456-467.

20. Graham, F. L., A. J. van der Eb, and H. L. Heijneker. 1974.Size and location of the transforming region in human adenovirus type5DNA. Nature (London) 251:687-691.

21. Harrison, T., F. Graham, and J. Williams. 1977. Host range mutants ofadenovirus type5defective for growth in Hela cells. Virology77:319-329.

22. Ho, Y.-S., R.Galos, and J. Williams. 1982. Isolation of type S adenovirus mutants with acold-sensitive host-range phenotype: genetic evidence of an edenovirus transformation maintenance function. Virology 122:109-124.

23. Houweling, A., P.J. van der Elsen, and A. J. van der Eb. 1980. Partialtransformation of primary rat cells by the leftmost 4.5% fragment of adenovirus5DNA. Virology 105:537-550. 24. Jones, N., and T. Shenk. 1979. Anadenovirus type5early gene

function regulates expression of other early viral genes. Proc.

Natl. Acad. Sci. U.S.A. 76:3665-3669.

25. Jones, N., and T. Shenk. 1979. Isolation of AdS host-range delection mutants defective for transformation of rat embryo cells. Cell 15:205-214.

26. Kitchingman, G. R., and H. Westphal. 1980. The structure of adenovirus 2 early nuclear andcytoplasmicRNAs.J. Mol. Biol. 137:23-48.

27. Marinus, M. G. 1973. Location of DNA methylation genes on the Escherichia coli K-12 genetic map. Mol. Gen. Genet. 127:47-55.

28. Maxam, A., and W. Gilbert. 1980.Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 65:499-560.

29. McKinnon, R. D., S. Bacchetti, and F. L. Graham. 1982. TnS mutagenesis of the transforming genes of human adenovirus type 5. Gene 19:33-42.

30. Montell, C. E.,E. Fisher, M. Caruthers,and A.J.Berk. 1982.

Resolving the functions of overlapping viral genes by

site-specific mutagenesis at a mRNA splice site. Nature (London) 295:380-384.

31. Nevins, J. R. 1981. Mechanism of activation of early viral

transcription bytheadenovirus Ela gene product. Cell.

26:213-220.

32. Persson, H., H.-J. Monstein, G. Akusjarvi, and L. Phillipson. 1981. Adenovirus early gene products may control viral mRNA accumulationandtranslation in vivo. Cell 23:485-496.

33. Pintel, D., N.Bouck, and G. di Mayorca. 1981. Separation of

lytic and transforming functions of the simian virus 40 A region: two mutantswhich are temperature sensitive for lytic functions

haveoppositeeffects on transformation. J. Virol. 38:518-528. 34. Pintel, D., N. Bouck, G. di Mayorca, B. Thimmuppaya, B.

Swerdlow, and T. Shenk. 1979. SV40 mutant tsA1499 is heat-sensitive for lytic growth but generates cold-sensitive rat cell transformants. Cold Spring Harbor Symp. Quant. Biol.

44:305-309.

35. Ricciardi, R. L., R. L. Jones, C. L. Cepko, P. A. Sharp, and

B. E. Roberts. 1981. Expression of early adenovirus genes requires a viral encoded acidic polypeptide. Proc. Natl. Acad. Sci. U.S.A. 78:6121-6125.

36. Rigby,P.W., J. M. Dieckmann, C. Rhodes, andP.Berg. 1977. Labellingdeoxyribonucleic acid to high specific activity in vitro by nick-translation with DNA polymerase I. J. Mol. Biol. 113:237-251.

37. Russell,D.R., and G. N. Bennett. 1981. Cloningof small DNA fragments containing Escherichia coli tryptophan operon

pro-moterandoperator. Gene 17:9-18.

38. Shiroki, K.,H.Handa, H. Shimojo, S. Yano, S. Ojima, and K. Fujinaga. 1977. Establishment and characterization of rat cell lines transformed by restriction endonuclease fragments of adenovirus 12 DNA. Virology 82:462-471.

39. Solnick, D., M. A. Anderson. 1982. Transformation-deficient

adenovirusmutantdefective in expression of region 1A but not region 1B. J. Virol. 42:106-113.

40. Southern, E. M. 1975. Detection of specific sequences among DNAfragments by gel electrophoresis. J. Mol. Biol.

38:503-517.

41. Spector,D.J., M. McGrogan,and H.J. Raskas. 1978.

on November 10, 2019 by guest

http://jvi.asm.org/

tion oftheappearanceofcytoplasmicRNAsfrom region1of the

adenovirus-2genome. J. Mol. Biol. 126:395-414.

42. Stow, N. 1981. Cloning ofaDNAfragment fromthe left-hand

terminus oftheadenovirus type 2genome and itsuse in

site-directed mutagenesis. J. Virol.37:171-180.

43. vander Eb,A. J., C. Molder, F.L. Graham,and A.Houweling.

1977. Transformation with specific fragments of adenovirus

DNAs. I. Isolation of specific fragments with transforming

activity of adenovirus2and 5 DNA.Gene2:115-132. 44. vanOrmondt, H., J. Maat, and C. P. vanBeveren. 1980.The

nucleotide sequence of the transforming early region El of adenovirustype5 DNA.Gene 11:299-309.

45. Wahl, G. M., M. Stern, and G. R. Stark. 1979.Efficient transfer

oflargeDNAfragments fromagarosegelsto diazobenzyloxy-methyl paper and rapid hybridization using dextran sulfate.

Proc.Natl. Acad. Sci. U.S.A.76:3683-3687.

on November 10, 2019 by guest

http://jvi.asm.org/