0095-1137/91/040712-06$02.00/0
Copyright © 1991,American Society forMicrobiology
Use of
a
Reamplification
Protocol
Improves Sensitivity
of
Detection
of
Mycobacterium
tuberculosis
in Clinical
Samples
by Amplification of DNA
CATHERINE PIERRE,1 DENISE LECOSSIER,1 YVES BOUSSOUGANT,2 DENIS
BOCART,1
VERONIQUE JOLY,3 PATRICKYENI,3 AND ALLAN J.HANCE'*
InstitutNational de la Sante' etde la RechercheMedicale U.82, FacultedeMedecine Xavier
Bichat,1
and Service deMedecine Interne, Hopital Bichat-Claude Bernard,3 Paris, and LaboratoiredeMicrobiologie, HopitalLouisMourier,
Colombes,2
France Received4September 1990/Accepted 14January 1991We have compared the sensitivity and specificity of quantitative mycobacterial culture against results obtained by usingthepolymerase chain reactionfor the detection of DNA fromorganismsof theMycobacterium tuberculosis complexin82 clinicalspecimens from patientssuspectedofhavingtuberculosis. Twoamplification protocols wereused,astandardamplification protocol, whichamplifiesa segment of thegenecodingfor the 65-kDaantigen,andaprotocolinwhich the initialamplification productsarereamplifiedwithasecond setof nested oligonucleotide primers. Althoughthe standardamplification protocolgavepositiveresults for18of18 sampleswhichgrew>100 CFU/ml andgavepositiveresults in 4 of35specimensfrompatientswithtuberculosis which were negative by culture, only 1 of 6 samples which grew <100 CFU/ml was positive. This lack of
sensitivity could not be explained by the presence of inhibitors ofTaq polymerase present in the original samples.In contrast, thereamplification protocolgavepositiveresults for 24 of 24sampleswhichwerepositive
by culture aswell as for 13 of 35 samples from patients with tuberculosis which were negative by culture
(overall sensitivity, 63%,P< 0.02, comparedwith the standardamplification protocoland routineculture). Two of 23 samplesfrompatientsnotdiagnosedashavingtuberculosisgavepositiveresults whenthestandard amplification protocol was used, but no additional false-positive resultswere seen with the reamplification protocol (overall specificity, 91%). We conclude that the use of a reamplification protocol improves the sensitivityof detection ofmycobacterialDNAinclinicalsampleswithoutsacrificing specificity. Thesensitivity of thisapproach appearstobesuperiortothat ofstandard culture techniques.
Standard techniques for the diagnosis oftuberculosis are
suboptimal. The identification of mycobacteria by micro-scopic examination is insensitive and, even when positive, doesnotpermittheidentification ofthespecies of mycobac-teria observed. Similarly, culture techniques require 3 to 6 weeks before results are available, and multiple samplesare
required to maximize the chance of obtaining a positive result(1, 2). Asaconsequence,patients suspected of having tuberculosis may be subjectedtoinvasivediagnostic
proce-dures to establish or exclude the diagnosis or may receive
possibly inappropriate empiric antituberculous therapy while awaiting results of cultures. All diagnostic tests may
ultimately be negative for some patients thought to have
tuberculosis on clinical grounds, despite extensive
evalua-tion (1, 3).
Inaneffort to overcome these limitations in the diagnosis oftuberculosis, we (5, 12) and others (4, 8, 9, 14, 17, 18, 20, 23, 24, 27) have recently developed procedures based on the
amplificationof mycobacterial DNA by use of the polymer-ase chain reaction. Preliminary studies have indicated that this procedure can be used to rapidly identify the presence of DNAfrom Mycobacterium tuberculosis in clinical samples. The diagnosis of tuberculosis is especially difficult in cases where only a few mycobacteria are present. Thus, a new
diagnostic approach which permits the detection of small
numbers of mycobacteria would be particularly useful. In
*
Correspondifng
author.this context, thesensitivityfor the detection ofmycobacteria inclinical samples containing only small numbers of organ-isms by standard bacteriological techniques and the
sensi-tivity of detection by techniquesbased onthe amplification of
mycobacterial
DNA havebeencomparedinrelativelyfewstudies.
In this study, we have compared the sensitivity and
specificity oftwoamplification protocolsfor the detection of M. tuberculosis in clinical samples from patients suspected
ofhaving tuberculosis. Theresultsdemonstratethata stan-dard amplification protocol, which amplifies a segment of
the genecoding forthe65-kDaantigen (5, 12), could detect the presence ofmycobacterial DNAfrom organisms ofthe M. tuberculosis complex in samples containing more than 100 mycobacteria per ml but was frequently negative with samples containingfewermycobacteria. The inefficient
am-plification of mycobacterial DNA during this
amplifica-tion procedure was not due to the presence of inhibitors present in the initial sample and could be overcome by
reamplifyinganaliquot of the original amplification products
by use of a second set of nested oligonucleotide primers
recognizingDNA sequences contained within the originally
amplifiedmycobacterial DNA sequence. When this
reampli-fication protocol was used, the sensitivity for detection of M. tuberculosis was superior to that of standard culture
techniques.
(Thiswork was presented at the 30th Interscience Confer-ence on Antimicrobial Agents and Chemotherapy, Atlanta,
Ga., October 1990.)
712
on April 12, 2020 by guest
http://jcm.asm.org/
MATERIALS AND METHODS
Clinical specimens. By using standard procedures, speci-mens of sputum or gastric lavage were obtained from 32
patients admittedto Hopital Bichat-Claude Bernard (Paris) orHopital LouisMourier(Colombes)onsuspicionofhaving
pulmonary tuberculosis. Four samples were subsequently
eliminated fromthe studybecause ofatechnicalerrorduring
the extraction ofDNA. The final study group contained 70
sputum samples and 12 gastric aspirates. Samples were
decontaminated byuseof the sodium dodecyl sulfate (SDS)
method (26), neutralized, and concentrated by centrifuga-tion. An aliquot of the sample was examined for acid-fast
bacilli by usingan auramine-flurochrome stain (25), and the remainingsample was divided into twoequal portions. One
part was inoculated into Lowenstein-Jensen medium by
using quantitative culture techniques (6). The second part
was stored at
-80°C
priortoextracting DNA.Diagnosis of tuberculosis. All patients were initially
sus-pectedof having tuberculosis either because ofthepresence
of constitutional symptoms (fever and/or weight loss) and compatible abnormalitiesonchest radiograph orbecause of
known exposure to a close family member with active
tuberculosisandrecentpositive conversion of their skintest
response to intermediate-strength purified protein deriva-tive. Nineteen of the 32 patients were ultimately diagnosed
as having tuberculosis. For the purposes ofthe study, this
diagnosiswasbasedonthe followingtwocriteria: (i) thefinal clinical diagnoses established by the primary physician in-cluded tuberculosis, and (ii) the patient was treated for
tuberculosis byuse ofastandard therapeutic protocol. The
diagnoseswereestablished without knowledge oftheresults
of the DNA amplification proceduresevaluatedin thisstudy. Oneor moreculture specimens ultimatelygrewM.
tubercu-losis in 11 of 19 patients diagnosedashaving tuberculosis.
Extraction of DNA. In most cases, DNA was extracted
fromthe frozen aliquots of theconcentratedclinical samples
as previously described (12, 16). Briefly, the specimen was
centrifuged and the precipitatewasheatedat95°Cfor 15min
in a solution of 0.1 N NaOH-2 M NaCl-0.5% SDS and centrifuged, after which the DNA was purified from the
supernatantby extraction with phenol-chloroform and
etha-nol precipitation and redissolved in 100 p.l of 10 mM Tris hydrochloride (pH 7.4) containing 0.1 mMEDTA.
In some cases, a portion of the sample was treated as
described above and the DNA was extracted from the
remaining portion by using amodification of the procedure
of Higuchi (15). In this procedure, the sample was washed once with 1 ml of phosphate-buffered saline and incubated
for 12 hat
55°C
in 0.1 ml ofamplification buffer (seebelow) containing 60 pLg of proteinase K (Sigma Chemical Co., St. Louis, Mo.) per ml, 0.45% Tween-20 (Sigma), and 0.45%Triton X-100 (Sigma). The sample was then heated at 95°C
for 10 min.
Amplification and detection of mycobacterial DNA. The amplificationof mycobacterial DNAwas performed as pre-viously described (5, 12, 22). The final reaction mixture (50
[ld)
contained 10 mM Tris hydrochloride (pH 8.3), 50 mM KCI,2.5 mM MgCl2, 100,ugofgelatinperml,0.3 mM(each)deoxynucleotides, 2.5 UofTaqpolymerase, 50pmoleachof the oligonucleotide primers TB-1 (5'-GAGATCGAGCTG GAGGATCC) and TB-2 (5'-AGCTGCAGCCCAAAAGGT GTT) (12), and 10 pul of sample. Samples were sequentially incubated at 95°C (1.5 min), 60°C (2 min), and 72°C (2 min extended by 4 s after each cycle) for 50 cycles with an
automated thermal cycler (The Perkin-Elmer Corp., Nor-walk, Conn.).
To reamplify mycobacterial DNA, 1 ,ul of the original
amplification products was transferred by use of a piston-type pipette (Microman;Gilson Instruments, Villiers-le-Bel,
France) to tubes containing the same reaction mixture
de-scribed above except that the oligonucleotide primers TB-1
and TB-2 were replaced by oligonucleotides TB-28 (5'-CCAT
CGATCCGAGACCCTGCTCAAGGGC) and TB-29C (5'-TG CTCTAGACTCCTCGACGGTGATGACG), which recognize
sequences contained within the mycobacterial sequence amplified by TB-1and TB-2 (12). The samples were
subse-quently amplified for an additional 50 cycles as described
above. Because the sequence of the gene coding for the
65-kDaantigen corresponding to the 3' end of TB-28differs between M. tuberculosis and most other mycobacteria, the
reamplification system favors the amplification of DNAfrom
M. tuberculosis complex organisms (data not shown). The presenceof amplified mycobacterial DNA sequences was detected as previously described (5, 12). Briefly, ali-quots ofthe amplificationproducts were electrophoresed in
2% agarose gels, the DNA was transferred to nylon
mem-branes, and the membranes were hybridized with 3 x
105
cpm
of32P-5'-labeled
(specific activity, 1 to 3mCi/pmol)
oligonucleotide TB-4 (12), washed, and exposed to
radio-graphic film. A sample was considered positive if a distinct signal corresponding to an amplified product ofthe appro-priate size was seen in autoradiograms exposed for 18 h.
Control samples containing no DNA were included with eachamplification procedure andwere always negative.
To test for the presence inextracts of clinical samples of
substances capable of inhibiting the amplification of DNA, a fixed amount of purified mycobacterial DNA (containing approximately 1,000 genomes) was added to 1 to 12.5,ulof
the solution obtained after extraction of clinical samples. The samples were amplified as described above, and the results were compared with those obtained for the
amplifi-cation ofmycobacterial DNA alone.
The sensitivity and specificity of the different procedures were compared by use ofaX test.
RESULTS
Detection of mycobacterial DNA by a standardamplification protocol. Fifty-nine of the 82 samplesevaluated inthis study were obtained from the 19 patientsultimately diagnosed as having tuberculosis. Culture for M. tuberculosis was posi-tive for 24 of these 59 samples; no other species of myco-bacteria were grown from these samples. The number of mycobacteria grown from positive cultures was quite vari-able, ranging from 106 to 2 CFU/ml (Fig. la).
The results for the detection of mycobacterial DNA in these samples afteramplification by ourstandard amplifica-tion protocol are shown in Fig. la. Mycobacterial DNA could be detected in 18 of 18 sampleswhichgrew more than 100CFU/ml. Acid-fast organisms were also identified in all of these samples by microscopic examination (Fig. la). In contrast, the results of the amplification procedure were negative for five of six samples which grew fewer than 100 CFU/ml, and the only sample in this group which was positiveby the amplification procedure was also positive by microscopicexamination. The amplification procedure gave positive results in4of 27 samples obtained frompatients not receivingantituberculous therapybut for which both culture and microscopic examination were negative. The overall sensitivity of the amplification procedure (39%) was not
on April 12, 2020 by guest
http://jcm.asm.org/
a
AA AAAAA A
A ALA A A LALAL 0OO
. I
106 10 S 104 103 102 10 results of culture (CFU / ml)
b
LA AL
*sA A
A AL AL A ALAA -A-O .4
106 105 104 103 102 10
results of culture (CFU / ml)
FIG. 1. Comparison of the results ofquantitati
those obtained by the standard amplification proti
reamplification protocol (b) for thedetectionofM.t,
clinical samples from patients diagnosed as havi Samples which were positive by direct microsco (triangles) and negative bydirectexamination (cir( Solid symbols representsamples whichwere posit
amplification protocol.
significantly different from thatof culture tec
or microscopic examination (41%), but samf
few mycobacteria were likelyto benegative cation procedure.
Twenty-three of the 82 samples studied from patients diagnosed asnot havingtuberci these samples was positive by culture. T
samples did, however, give positive results cation procedure. In both cases, only one of fromtwodifferentpatientswaspositive by th procedure (overall specificity, 91%).
Detection of mycobacterial DNA by a ream
tocol. An aliquot of the original amplification reamplifiedbyuseofasetofnestedoligonuci which would specifically recognize sequen
within the amplified mycobacterial DNA
present in the spurious amplification produc
obtained by this reamplificationprotocol are
lb. All 24 samples from patients with tube
were positive by culture were positive when
cation procedure was used, including the 4 grewfewer than 100CFU/ml and whichwerc by direct microscopic examination and by amplification protocol. Furthermore, of the
3'
patients with tuberculosis which were negati
13 samples were positive by the reamplificat
Thisgroup included2 samples frompatients i mentfortuberculosis and 11 samples frompa never received antituberculous therapy. The
tivityof the reamplification procedure for the(
tuberculosis (63%) was significantly greatei
culture (41%, P < 0.02) and that of direc
examination (41%, P< 0.02).
Of the 13 samples from patients with tube werepositive by thereamplification protocolt negative by culture,5wereobtainedfrompati
othersamples evaluated in this series were p
culture and the reamplification procedure. '
0 0 0 0g
eight
samples
wereobtainedfrom fourdifferentpatients
whoo oo o o were diagnosed as havingtuberculosis despite thefact that ^
°O°OO
° noclinicalspecimeneventually
grewM. tuberculosis. MoreA0000 than one specimen was positiveby the
reamplification
pro-o Asses0
tocol in three ofthese four cases (three ofthree, two of + three, two of four, and one of two
positive
specimens,
respectively). All four ofthesepatientswerechildrenwhose mothers hadbeenrecently diagnosed as having tuberculosis no growth and who had had a recent conversion in their skin test o o000 reactivity, but none had received antituberculous
therapy
0 0000 before the time that the specimens were obtained.A0 00 0 The two samples from
patients
diagnosed as not having A* o tuberculosis, but which were positive by the standardam-plification
protocol,
were alsopositive afterreamplification.
]
I-
No additional samples from patients nothavingtuberculosiswere positive when the reamplification protocol was used. Thus, the overall specificityof thereamplificationprocedure
no growth was the same as that of the standard amplification protocol ive cultures and
(91%).
ocol (a) and the For all 35 of the samples which were positive when the uberculosisin59 reamplification protocol was used, a band whose molecular
tng
tuberculosis, weight corresponded to that expected for the amplificationles) are shown product ofmycobacterial DNA was visible when the
ampli-ive bythe given fication products wereelectrophoresed into 2% agarose gels and stained with ethidium bromide (Fig. 2). Furthermore, when thereamplification products were transferred tonylon
membranes and hybridized with the probe specific for M. tuberculosis, a very strongsignal was observed on autorad-:hniques (41%) iograms in all cases, evenafter an exposure time ofonly 2 h
ples
containing (Fig. 2). In contrast, when samples were amplified by the by the amplifi- standardamplification protocol, a bandcorrespondingtothe amplification product ofmycobacterial DNA was observed were obtained in 19 of 35 cases (Fig. 2), and, in some cases, the signalsilosis. None of observed on autoradiograms, even after an 18-h exposure Iwo of the 23 period, were relatively weak.
by the amplifi- Evaluation of techniques used for preparation of samples.
three samples When aliquots of samples prepared by the alkaline
lysis
e amplification method, and which were negative when tested alone
by
the standardamplification protocol, were "spiked" withpurifiediplification pro- mycobacterial DNA, all samples gave positive results.
Fur-iproducts was thermore, the intensity of the signal observed for tubes
leotide primers containing up to 12.5
[lI
ofsample plus purified mycobacte-ices contained rial DNA were always at least 50% of that observed forbut not those samples containingthepurifiedmycobacterial DNA alone(n ts. The results = 8; data not shown).
shown in Fig. In contrast, when samples were prepared by use of a rculosis which procedure based on proteolytic digestion, and in which the
ithe reamplifi- DNA was not subsequently purified by phenol extraction
samples which and ethanol precipitation, the addition of 12.5 [L ofsample
negative both completely inhibited the amplification ofpurified
mycobac-the standard terial DNA in 9 of 13 samples, and, in 5 cases, the addition
5 samples from of as little as 1
,lI
of the sample to thepurifiedmycobacterialive by culture, DNA resulted in no detectable amplification of
mycobacte-:ion
procedure. rial DNA. receivingtreat-ttientswho had DISCUSSION
overall sensi- DSUSO
detection of M. We have evaluated the sensitivity and specificity of a r than that of procedure that is based on theamplification and subsequent
:t
microscopic detection ofmycobacterial DNA from organisms of the M. tuberculosis complex for the detection M. tuberculosis in rculosis which clinical specimens from patients suspected of having tuber-but which were culosis. We have found that when a standard amplification ients for whom protocol is used, the technique can detect DNA from M. ositive both by tuberculosis in samples containing >100 CFU/ml but is The remaining frequently negative for samples containing fewerorganisms.on April 12, 2020 by guest
http://jcm.asm.org/
a
M
b
M
4
FIG. 2. Amplification of myc patients with tuberculosis (lanes culture(300, 10,2,and 60 CFU/n patientswithout tuberculosis(lan the standardamplificationprotoci
col (b), and a 7-,u aliquot of th phoresed into 2% agarose gels photographed (a and b, top). Tl nylonmembranes,and the memb] labeledoligonucleotideTB-4, wa:
diograms (a and b, bottom). Th
amplification protocol was expc reamplification protocol wasexpi the positionofmigrationexpecte ducedbytheamplificationprotoc protocol(b, 155bp).
Thus, the test was negative
negative by directexaminatioi lack ofsensitivity, which doe
presence of inhibitors of the i
samples, can bedramatically
in which the initial amplificati4
use of a set of nested oligon
sequences contained within t]
DNA amplifiedduringtheinit sensitivity of detection of M. plification protocol was used
when standard culturetechnic reamplificationprotocoldidn
test.
The lackofsensitivity ofot
be explained neither by a failure to extract mycobacterial DNA from the originalclinical material (e.g., most samples from patients with tuberculosis were shown to containM. tuberculosis DNA byusing thereamplification protocol)nor by the presence of inhibitors of Taq polymerase in the original samples. The most likely explanation is that in reactions containing low numbers of targetmolecules, non-specificamplificationproducts (e.g., amplified human DNA and primer-dimers) are generated which compete with the
2 3 4 5 6 7 mycobacterial DNA (21). This could be overcome by ream-plifying the initial amplification products with primers which recognize theinefficientlyamplifiedmycobacterialDNA but do not recognize the nonspecificamplificationproducts. This approach haspreviously beenused toincrease the sensitiv-ity ofDNA amplification for the detection of other target
sequences (7, 10, 13), and a similar approach has recently been described by Plikaytis et al. for the detection of
Mycobacterium leprae and M. tuberculosis (20).
In addition to greatly increasing the sensitivity of detec-tion of mycobacterial DNA, thereamplificationprotocol also facilitates the subsequent identification of the amplified
mycobacterial DNA. When the standard amplification pro-tocol was used,manypositive samples gave relatively weak
positive signals on autoradiograms exposed for 18 h. In contrast,when the reamplification protocol was used, aband corresponding to the amplified M. tuberculosis DNA was 2 3 4 5 6 7 visible onethidiumbromide-stained gels in all cases and all samples gave strong positive signals on autoradiograms
exposed
for as little as 2 h.Thus,
the timerequired
toEl_.".
reamplify samples
can be recoveredby
reducing
thetirme
necessary fordetecting positivesamples. Overall,the ream-plification procedure described here requires 3 days to obtain final results. The large amount ofmycobacterial DNA present inreamplifiedsamples could alsofacilitatetheuseof
-obacterial DNA. Samples from less sensitive but more easily handled nonradioisotopic
1 to 4) which were positive by detection systems.
al,respectively) andsamples from A striking result in this study was the finding that the ies 5 to 7) were amplified by using reamplification procedure could detect the presence of M.
01(a) or thereamplification proto- tuberculosis in many clinical samples from untreated pa-le reaction products was
electro-containing ethidium bromide and
tients with
tuberculosis
which
were negative by culture.he DNA was then transferred to Furthermore, eight such samples were obtained from four ranes were hybridized with32p-5'-
patients
for whom no clinical specimens grew mycobacteria. shed, and used to prepare autora- It is noteworthy that all of these patients were childrene autoradiogram for the standard whose mothers had active tuberculosis and who had had )sed for 18 h, and that for the recent positive conversions of their tuberculin skin tests. osed for 2 h. The arrows indicate That these patients actually had tuberculosis is strongly
d for the amplified fragment pro- supported by the finding that, in all but one case, two or :ol (a, 383 bp) and reamplification more samples from the same individual were positive when thereamplification procedure was used. Since decontamina-tion procedures are known to reduce the viability of
myco-bacteria (19), it is possible that the processing of these in all samples which were samples killed the small number of viable mycobacteria
n but positiveby culture. This present. Alternatively, someindividuals may shed
mycobac-s not appear to be due to the teria which are largely nonviable (e.g., because ofthe host Taq polymerase in the original immune response). Inthiscontext,
mycobacterial
DNA has improved by using a protocol beendetectedinculture-negativeclinicalsamples
which had onproducts arereamplifiedby not been decontaminated (e.g.,pleural
fluid andcerebrospi-ucleotide primers recognizing nal fluid) (8, 17, 23, 27). Further studies
comparing
the he sequence of mycobacterial resultsobtainedby
culture with those basedonthe detection tial amplificationreaction. The of mycobacterial DNA shouldpermit
better assessment of tuberculosis when the ream- the viabilityofmycobacteria before and afterprocessing
for was superior to that obtained mycobacterialculture.iueswere
used,
and theuse ofRecently,
several other groups have described systems ot reduce thespecificity ofthe basedon thepolymerase
chain reaction for the detection of mycobacteria. Most of these systems, like that describedar
amplification protocol could here, arespecific
for DNA fromorganisms
of the M.on April 12, 2020 by guest
http://jcm.asm.org/
tuberculosis complex but cannot distinguish individual
mem-bers of this group (4, 5, 9, 14, 17, 20, 24, 27), although two systems have been described which are apparently specific
for M. tuberculosis (8, 18). When tested against purified mycobacterial DNA, several of these systems have been shown to detect as little as 1 fg of mycobacterial DNA
(equivalentto less than onemycobacterial genome) (4, 9, 18, 20, 27) and can detect the presence of fewer than 20 mycobacteria added to samples prior toextraction of DNA (4, 8, 9, 12, 20, 24). Those systems which amplify either a target sequence present in multiple copies in the M. tuber-culosis genome (8, 9, 14, 18, 27) or rRNA from M.
tubercu-losis after reverse transcription (5 x
103
copies permyco-bacterium) (4) may prove to be more sensitive than systems based on thedetection of single copy sequences, such as the gene coding for the 65-kDa antigen used as a target in this study. In this context, Thierry et al. (27) demonstrated that a system based on the detection of the repetitive sequence IS6110 (10 to 15 copies per genome) was approximately 10-fold more sensitive than that of a system based on the
detection of the 65-kDa antigen which was similar to the standard amplification protocol used in our study. Further workis required to compare the relative sensitivities of these different systems and to determine the extent to which the useofareamplification protocol might increase their sensi-tivity.
For two different patients diagnosed as not having
tuber-culosis,oneof three samples was positive when the standard
amplification protocol was used. Because no evidence for
contamination of the reagents used for amplification were observed in this series (i.e., amplification of samples
con-tainingno DNAalways gave negative results),these
presum-ably false-positiveresults arelikely to have resulted from the
contamination of the samples duringthe extraction of DNA. Itis noteworthy,however, that the useofthereamplification protocol did not result in additionalfalse-positive results in this study. The contamination of samples might be
mini-mized by developing simpler procedures for extracting DNA. In this study, we used as starting material for the
purification ofDNAclinical samples which had been
decon-taminated forculture, thuspermitting thedirect comparison
of results obtained with the amplification procedure and standard culture techniques. A disadvantage of this
ap-proachisthat such samples have been treated with SDS. The presenceof thispotentinhibitor of Taq polymerase (11) may
explain why samples prepared by the shorter proteolytic
digestionmethod often inhibited the amplification of purified
mycobacterial DNA and necessitated the use of additional
purification steps before DNA amplification. It is possible that simpler extraction procedures may work if samples
whichhave not been decontaminated areused as astarting material andthereby diminish the risk of sample contamina-tion.
This study demonstratesthat the sensitivity of the
detec-tion of M. tuberculosis
by
use of the polymerase chain reaction is highly dependent on the techniques used to prepare the DNA for amplification and the type ofamplifi-cation protocol employed. In the reamplificationprocedure
described here, the sensitivity of the test appears to be superior to that of routine culture and this approach does not appear to adversely affect its specificity. These findings support the conclusion that this approach will prove to be useful in the rapid detection of M. tuberculosis in clinical
samples containing only small numbers of mycobacteria. It should be stressed, however, that the reamplification
proce-dure describedhere isrelatively expensive (for example, the
reagents alone necessary for amplificationcost morethan$5 persample) and labor intensive. Furthermore, this test will notobviate the need forcultures, the only establishedmeans ofdefining antibiotic susceptibility.Thus, further studiesare neededtodefine the role of this testinclinical practice.
ACKNOWLEDGMENTS
Wegratefully acknowledge thehelpofAlain LoiseauandBernard Grandchamp.
C.P. wassupported by a stipend from the Agence Nationale de RecherchessurleSIDA.
REFERENCES
1. Bates, J.H. 1979. Diagnosis of tuberculosis. Chest 76(Suppl.): 757-763.
2. Bates, J. H., P. J. Brennan, G. W. Douglas, J. C. Feeley, J. Glassroth,D.E.Kohne,W.J.Martin,L.G.Wayne, andC. R. Zeiss.1986. Improvements in thediagnosisof tuberculosis. Am. Rev.Respir. Dis.134(Suppl. 2):415-423.
3. Blair,E.B.,G. L.Brown,and A. H. Tull.1976.Computerfiles andanalyses of laboratory data from tuberculosispatients. II. Analyses of six years' data on sputum specimens. Am. Rev. Respir. Dis. 113:427-432.
4. Boddinghaus, B., T. Rogall, T. Flohr, H. Blocker, and E. C. Bottger. 1990. Detection and identification ofmycobacteriaby amplificationofrRNA. J.Clin.Microbiol. 28:1751-1759. 5. Brisson-Noel,A.,B.Gicquel,D.Lecossier,V.LUvy-Frebault,X.
Nassif,and A.J.Hance.1989.Rapid diagnosisoftuberculosisby amplificationofmycobacterialDNAinclinicalsamples.Lancet ii:1069-1071.
6. David,H. L.1976. Bacteriologyof themycobacterioses. Publi-cation no. (CDC) 76-8316. U.S. Government Printing Office, Washington, D.C.
7. Delfau,M.H.,J.P.Kerckaert,M.Collynd'Hooghe,P.Fenaux, J. L.Lai, J.P.Jouet, andB. Grandchamp. 1990. Detectionof minimal residual disease in chronicmyeloidleukemiapatients after bonemarrow transplantation by polymerase chain
reac-tion.Leukemia4:1-5.
8. DeWit, D.,L.Steyn,S.Shoemaker,andM.Sogin.1990. Direct detection ofMycobacterium tuberculosis in clinical specimens byDNAamplification. J. Clin. Microbiol. 28:2437-2441. 9. Eisenach,K.D.,M. D.Cave, J.H. Bates,andJ. T.Crawford.
1990. Polymerase chain reaction amplification ofa repetitive DNA sequence specific for Mycobacterium tuberculosis. J. Infect.Dis. 161:977-981.
10. Engelke, D. R.,P. A. Hoener, and F. S. Collins. 1988. Direct sequencingofenzymatically amplified human genomic DNA. Proc. Natl.Acad. Sci. USA85:544-548.
11. Gelfand,D. H. 1989.TaqDNApolymerase, p. 17-22. In H. A. Erlich (ed.), PCR technology. Principles and applications for DNAamplification. Stockton Press, NewYork.
12. Hance,A.J.,B.Grandchamp,V.L&vy-Fr6bault, D. Lecossier, J.
Rausier,D.Bocart,and B. Gicquel. 1989.Detection and identi-fication of mycobacteria by amplification of mycobacterial DNA. Mol. Microbiol. 3:843-849.
13. Haqqi,T.M., G.Sarkar, C.S.David, and S. S.Sommer. 1988. Specific amplification with PCR of a refractory segment of genomicDNA.Nucleic Acids Res. 16:11844.
14. Hermans, P. W. M., D. van Soolingen, J. W. Dale, A. R. J., Schuitema,R. A.McAdam,D.Catty, and J. D. A. van Embden. 1990.InsertionelementIS986 fromMycobacterium tuberculo-sis: ausefultoolfor diagnosis andepidemiology of tuberculosis. J.Clin. Microbiol. 28:2051-2058.
15. Higuchi, R. 1989.Rapid, efficient DNA extraction for PCR from cells or blood. Amplifications 2:1-3.
16. Kogan,S.C., M.Doherty, and J. Gitschier. 1987. An improved methodfor prenatal diagnosis of genetic diseases by analysis of amplifiedDNAsequences. N. Engl. J. Med. 317:985-990. 17. Pao,C.C., B. Yen, J. B. You, J. S.Maa, E. H. Fiss, and C. H.
Chang. 1990. Detection and identification of Mycobacterium tuberculosisbyDNAamplification. J. Clin. Microbiol. 28:1877-1880.
on April 12, 2020 by guest
http://jcm.asm.org/
18. Patel, R. J., J. W. U. Fries, W. F. Piessens,and D. F. Wirth.
1990. Sequenceanalysis and amplificationby polymerasechain reaction ofacloned DNAfragmentfor identificationof
Myco-bacterium tuberculosis.J. Clin. Microbiol. 28:513-518. 19. Peres, P.-J., M.-J. Gevaudan, C. Gulian, andP. de Micco.1988.
Unemethode de traitementdes produits' pathologiquesenvue
del'isolement desmycobacteries. Rev. Fr. Lab. 173:67-74. 20. Plikaytis, B. B., R. H. Gelber, and T. M. Shinnick.1990.Rapid
andsensitive detection of Mycobacterium leprae usinga
nested-primer gene amplification assay. J. Clin. Microbiol. 28:1913-1917.
21. Saiki,R. K. 1989. The design andoptimization of the PCR,p.
7-16. In H. A. Erlich (ed.), PCR technology. Principles and applications forDNAamplification. Stockton Press,NewYork. 22. Saiki, R. K., S. Scharf,F. Faloona, K. B. Muilis, G.T. Horn, H. A.Erlich, and N. Arnheim. 1985. Enzymaticamplificationof P-globin genomic sequences and restriction site analysis for diagnosis ofsicklecell anemia.Science 230:1350-1354.
23. Shankar, P., N.Manjunath,R.Lakshmi, B. Aditi, P. Seth, and Shriniwas. 1990. Identification of Mycobacterium tuberculosis bypolymerase chain reaction. Lanceti:423.
24. Sjobring, U., M. Mecklenburg, A. B. Andersen,andH.Miorner. 1990. Polymerase chain reaction for detection of Mycobacte-riumtuberculosis.J. Clin. Microbiol. 28:2200-2204.
25. Smith Wick, R. W., and H. L. David. 1971. Acridineorangeas a fluorescent counterstain with the auramine acid fast stain.
Tubercle 52:226.
26. Tacquet, A., and F. Tison. 1961. Nouvelletechniqued'isolement des mycobacteries parlelauryl-sulfate de sodium. Ann. Inst.
Pasteur(Paris) 100:676-680.
27. Thierry, D., A. Brisson-Noel, V. Vincent-LUvy-Fribault, S. Nguyen,J.-L. Guesdon,and B.Gicquel. 1990. Characterization ofa Mycobacterium tuberculosis insertion sequence, IS6110, and its application in diagnosis. J. Clin. Microbiol. 28:2668-2673.
