• No results found

Nested Restriction Site Specific PCR To Detect and Type Hepatitis C Virus (HCV): a Rapid Method To Distinguish HCV Subtype 1b from Other Genotypes

N/A
N/A
Protected

Academic year: 2020

Share "Nested Restriction Site Specific PCR To Detect and Type Hepatitis C Virus (HCV): a Rapid Method To Distinguish HCV Subtype 1b from Other Genotypes"

Copied!
7
0
0

Loading.... (view fulltext now)

Full text

(1)

Copyright © 2001, American Society for Microbiology. All Rights Reserved.

Nested Restriction Site-Specific PCR To Detect and Type

Hepatitis C Virus (HCV): a Rapid Method To Distinguish

HCV Subtype 1b from Other Genotypes

LAURA KREKULOVA,1VRATISLAV REHAK,2ADIL E. WAKIL,3EVA HARRIS,1ANDLEE W. RILEY1*

Division of Infectious Diseases, School of Public Health, University of California, Berkeley, Berkeley, California 947201;

Dr. Svoboda’s Clinic-Medicine-Immunology, Prague, Czech Republic2; and California Pacific Medical Center,

Hepatology/Gastroenterology, San Francisco, California 941203

Received 20 July 2000/Returned for modification 21 October 2000/Accepted 22 February 2001

Genotypic differentiation of hepatitis C virus (HCV) has become an integral part of clinical management and epidemiologic studies of hepatitis C infections. Thus, it is extremely important in areas such as the Czech Republic, where current instrumentation and kits for assessing HCV infection are too costly for widespread use. We describe a new and relatively inexpensive method called nested restriction site-specific PCR (RSS-PCR) that generates a “fingerprint” pattern to represent an HCV genotype without the use of restriction endonucleases and that specifically differentiates HCV genotype 1b from the other HCV genotypes. The RSS-PCR method was applied directly to serum samples from patients with hepatitis C from the Czech Republic and from patients with known HCV genotypes from the United States. The method was validated by comparison of the subtype determined by RSS-PCR to the subtype determined from analysis of the 5

noncoding region (NC) or the nonstructural protein gene (NS5b) nucleotide sequence of HCV in these clinical samples. From 75 Czech samples containing HCV RNA, three distinct RSS-PCR patterns were observed; 54 were predicted to contain subtype 1b, 19 were predicted to contain subtype 1a, and 2 were predicted to contain subtype 3a. Among 54 samples predicted to contain HCV genotype 1b, all were confirmed by their 5NC or NS5b sequences to be subtype 1b. Thus, both the sensitivity and specificity of the RSS-PCR test for the differentiation of HCV subtype 1b from the others were 100%. While the assay described here was designed to specifically differentiate HCV subtype 1b from the other HCV genotypes, the RSS-PCR method can be modified to differentiate any HCV genotype or subtype of interest. Its simplicity and speed may provide new opportu-nities to study the epidemiology of HCV infections and the relationship between HCV genotypes and clinical outcome by more laboratories throughout the world.

Hepatitis caused by hepatitis C virus (HCV) has become a major emerging infectious disease problem, with an estimated 170 million people infected worldwide (8). In industrialized countries, HCV accounts for 20% of acute hepatitis cases, 70% of chronic hepatitis cases, 40% of end-stage cirrhosis cases, and 60% of hepatocellular carcinoma cases (8). It has become one of the most common reasons for liver transplants (16).

HCV is a positive-sense single-stranded RNA virus belong-ing to the family Flaviviridae. Clinical strains exhibit a great degree of genetic heterogeneity, and it is thought that such strain differences influence the clinical outcome after infection as well as transmission patterns among susceptible hosts (1, 32, 37, 40). Hence, genotypic characterization of HCV has become an important part of clinical management and public health control of hepatitis C. At the 2nd International Conference of HCV and Related Viruses, a consensus classification scheme was proposed for HCV. According to this system, HCV is classified into six major genotypes, which are further divided into subtypes (29). Genotypic differentiation of HCV has served as an important epidemiologic tool for study of the geographic distribution of HCV genotypes, their routes of transmission, and their association with certain risk groups.

Genotypes 1, 2, and 3 are found throughout the world and constitute the major genotypes in Japan, Western and Eastern Europe, and North America (20, 38, 40). Genotypes 4, 5, and 6 appear to be more restricted in their distribution: genotype 4 has been found mostly in Central and Northern Africa and in the Middle East, type 5 has been reported from South Africa, and type 6 has been identified in Southeast Asia and Hong Kong (18, 22, 28, 40).

Following infection with HCV, patients exhibit differences in the likelihood of developing chronic infection, responding to interferon therapy, progressing to cirrhosis, and developing hepatocellular carcinoma. Although factors such as the dura-tion of infecdura-tion, gender, and alcohol use have been associated with severe outcomes of hepatitis C (40), whether these dif-ferences in clinical outcomes can be also attributed to HCV genotypic differences is not clear. Several studies have shown that genotype 1, especially subtype 1b, is associated with a less favorable outcome after interferon treatment (7, 10, 15, 21, 22, 26, 35, 38, 40). There is also evidence that subtype 1b is asso-ciated with an increased risk for the development of severe sequelae such as liver cirrhosis and hepatocellular carcinoma (19, 37). However, other studies do not show this association (2, 13, 32). The uncertainty about these associations may be resolved by studies that specifically examine the role of HCV subtype 1b in clinical outcomes in additional sites around the world.

* Corresponding author. Mailing address: Division of Infectious Diseases, School of Public Health, University of California, Berkeley, 140 Warren Hall, Berkeley, CA 94720. Phone: (510) 642-9200. Fax: (510) 642-6350. E-mail: [email protected].

1774

on May 15, 2020 by guest

http://jcm.asm.org/

(2)

Several methods for the genotyping of HCV exist. The ref-erence method is direct sequencing of products amplified from clinical material. Several PCR-based methods for the differen-tiation of strains by comparison of differences in the sizes of the products amplified by type-specific primers have been re-ported (14, 23, 24, 27, 36). Another PCR-based method relies on differences in the agarose gel electrophoretic band patterns of a PCR-amplified product digested with restriction endo-nucleases (6). A commercial DNA hybridization method called the line probe assay relies on genotype-specific probes based on 5⬘ noncoding (NC) sequences to hybridize to a product amplified from a clinical sample (34). Most of these methods are labor-intensive, costly, and confined to research or refer-ence laboratories, thus limiting the studies needed to address the types of questions related to the clinical significance of HCV genotypes posed above. Simpler and more accessible tests are needed. This is especially true in countries such as the Czech Republic, where HCV poses a significant public health problem and there is a limited ability to diagnose infection at the genotypic level.

In this report, we describe a simple PCR-based test that rapidly detects HCV in clinical specimens and that simulta-neously distinguishes HCV subtype 1b from the other geno-types. This strain-typing assay is based on a method called restriction site-specific PCR (RSS-PCR). This method takes advantage of nucleotide sequence polymorphisms that occur at restriction endonuclease recognition sites. The RSS-PCR tech-nique is utech-nique in that it generates a “fingerprint” pattern without the use of any endonucleases. The technique was first applied to the typing of dengue viruses (9, 17) and was later used to differentiate entericEscherichia colistrains (12). For HCV, the technique was modified as a nested RSS-PCR be-cause the organism cannot be cultured in vitro and levels of viremia vary greatly among patients. While this approach can be designed to differentiate one HCV genotype from the oth-ers, in this report we describe as one example a method that specifically differentiates HCV subtype 1b from the other ge-notypes. This technique should facilitate studies that examine the significance of infection with HCV subtype 1b on clinical outcome in any laboratory capable of performing PCR assays.

MATERIALS AND METHODS

Serum samples.Serum samples from patients attending liver disease clinics in Prague, Czech Republic, were prospectively collected from October 1998 to January 2000. The entire collection consisted of serum samples obtained from 256 patients with viral hepatitis or hepatitis of unknown origin associated with abnormal liver function tests. All of the patients were citizens of the Czech

Republic living in Prague. None of the patients was on antiviral treatment (interferon, ribavirin, amantadine, etc.) at the time of serum sample collection. All of the samples were screened by enzyme-linked immunosorbent assay (ELISA) for hepatitis A (hepatitis A virus immunoglobulin M assay [HAV Total Assay; Bio-Rad, SA, Paris, France]), hepatitis B (MONOLISA Ag HBs PLUS; Rad, SA), and hepatitis C (MONOLISA anti-HCV PLUS, version 2; Bio-Rad, SA). In the present study, we analyzed the samples that were positive by both the ELISA for HCV and reverse transcription (RT)-PCR for HCV (Am-plicor PCR; Roche Molecular Systems, Inc., Pleasanton, Calif). In addition, we analyzed 15 serum samples from patients with a known diagnosis of hepatitis C from San Francisco, Calif. All of these U.S. samples had previously been tested by PCR (Amplicor PCR), and the viral titers had been determined. The HCV genotypes in these samples had been identified by a line probe assay (INNO-LiPA HCV II; Innogenetics, Inc., Alpharetta, Ga.) by a hepatitis laboratory. These U.S. serum samples served as positive controls. As negative controls, we tested clinical serum samples from Prague patients with liver disease which were negative by the HCV ELISA and RT-PCR tests. All of the samples were stored at⫺70°C until analyzed and were processed under similar conditions within a period of 6 weeks.

Primer design.The nested RSS-PCR strain-typing method described in this report is based on a procedure previously reported for dengue viruses (9, 17). The first step in the modified procedure involves the use of two external primers (primers Bukh-E1 and RSS-E2, Table 1), which were used to amplify a 661-base segment spanning nucleotide positions⫺285 in the 5⬘NC region and 376 in the core (C) region, based on the nucleotide numbering system used for prototype HCV genotype 1a strain reported by Choo et al. (5). Primer Bukh-E1 is identical to that previously reported by Bukh et al. (4). Five additional primers were used for the nested PCR to generate multiple band patterns with the 661-bp amplicon as a template. Two of these nested primers (called Bukh-1 and Bukh-2), identical to those used by Bukh et al. (4), were designed to specifically amplify a conserved segment in the 5⬘NC region to generate an amplicon of identical size (256 bp) in every reaction. The other three primers (primers RSS-I1, RSS-I2, and RSS-I4) were designed to specifically distinguish HCV genotype 1b from the other HCV genotypes. Their primer sequences were based on the sequence of prototype genotype 1b strain HCV-J, reported by Kato et al. (11). The nucleotide se-quences indicated in Table 1 are those of the prototype genotype 1b strain (HCV-J) that correspond to the position numbers based on the prototype ge-notype 1a strain (5). In each case, we designed the primers to introduce a single nucleotide mismatch at the 3⬘end between the corresponding genotype 1a and 1b sequences. Two of these primers (primers RSS-I1 and RSS-I4) were based on nucleotide sequences within the 5⬘NC and C regions that contained restriction endonuclease recognition sites; RSS-I1 contains aBstUI site and RSS-I4 con-tains aMaeII site.

PCR amplification.Viral RNA was extracted from 100-␮l aliquots of serum by the silica particle purification method previously described by Boom et al. (3). RNA pellets were resuspended in 60␮l of DNase- and RNase-free water (Gibco; BRL Products, Gaithersburg, Md.) containing 1␮l of RNase inhibitor (Recom-binant Ribonuclease Inhibitor; Promega Corp., Madison, Wis.). The extracted RNA was immediately used for RT-PCR. The RT-PCR assay was performed with 5␮l of the extracted RNA added to 20␮l of an RT-PCR mixture consisting of 50 mM potassium chloride, 10 mM Tris-HCl (pH 8.5), 3.0 mM magnesium chloride, 0.01% gelatin, 200␮M concentrations of each of the four deoxynucleo-side triphosphates, 10 mM dithiothreitol, 0.25␮M concentrations each of the primers Bukh-E1 and RSS-E2, 0.63 U of avian myeloblastosis virus reverse transcriptase (Promega), 10 U of RNAsin (Promega), and 0.63 U ofTaqDNA polymerase (AmpliTaq; Perkin-Elmer Corp., Foster City, Calif.). RT was con-TABLE 1. Synthetic oligonucleotide primers used for the initial RT-PCR (primers Bukh-E1, RSS-E2) and nested RSS-PCR

(primers Bukh-1, Bukh-2, RSS-I1, RSS-I2, and RSS-I4)

Primer namea Nucleotide sequence (5⬘-3⬘) Oligonucleotide positionb(5⬘33⬘) Reference or source

Bukh-E1 ACTGTCTTCACGCAGAAAGCGTCTAGCCAT ⫺285 to⫺256 3

RSS-E2 GGGTATCGATGACCTTACCCA ⫹376 to⫹356 This study

Bukh-1 ACGCAGAAAGCGTCTAGCCATGGCGTTAGT ⫺276 to⫺247 3

Bukh-2 TCCCGGGGCACTCGCAAGCACCCTATCAGG ⫺50 to⫺21 3

RSS-I1 GGAGATTTGGGCGTGCCCCCGCG ⫺121 to⫺99 This study

RSS-I2 GTGGGGCCCCAACTAGGCCGGGA ⫹330 to⫹307 This study

RSS-I4 GCTTTGGGGATAGGTTGTCGC ⫹202 to⫹183 This study

aPrimer names with odd numbers indicate sense primers, and those with even numbers indicate antisense primers. bThe nucleotide position numbers are indicated according to the numbering used for HCV-1 prototype 1a strain (5).

on May 15, 2020 by guest

http://jcm.asm.org/

[image:2.612.54.560.92.177.2]
(3)

ducted at 42°C for 60 min, followed by 30 amplification cycles consisting of 94°C for 1 min, 55°C for 1 min, and 72°C for 2 min, with a final extension at 72°C for 5 min.

The second round of PCR involved a nested PCR in which 5␮l of the amplified product from the RT-PCR served as the template. The reaction mix-ture for the nested PCR was prepared under sterile conditions in a 50-␮l reaction volume by using the same PCR buffer described above, except that theTaqDNA polymerase concentration was increased to 5 U per reaction mixture. In addition, the reaction mixture contained 0.25␮M each of nested primers RSS-I1, RSS-I2, RSS-I4, Bukh-1, and Bukh-2 (Table 1). The amplification conditions for the nested reaction were as follows: 25 cycles of denaturation at 94°C for 1 min, annealing at 55°C for 2 min, and extension at 72°C for 2 min, followed by a final extension at 72°C for 5 min. Both the RT-PCR and nested RSS-PCR were performed in a thermocycler (Gene Amp PCR System model 9700; Perkin-Elmer Applied Biosystems, Foster City, Calif.).

To reduce the risk of contamination, we prepared the solutions and performed PCR in a laboratory space that was never used for HCV extraction or electro-phoresis of amplified products. All mixtures were prepared under a UV-irradi-ated, PCR-dedicated biosafety cabinet. All solutions were pipetted with sterile pipettor tips containing an aerosol barrier (Molecular BioProducts). Gloves were changed after each step. One additional clinical serum sample from a Prague patient that was negative by HCV ELISA and RT-PCR was used as a negative control in the extraction, RT-PCR, and nested PCR assays; water was used as a negative control template in the RT-PCR and nested PCR tests. We used the U.S. serum sample containing HCV genotype 1b as a positive control in every reaction.

The nested PCR products (12␮l) were resolved electrophoretically in a 1.5% agarose gel in 1⫻TBE buffer (0.5⫻0.045 M Tris-borate, 0.001 M EDTA [pH 8.0]), stained with ethidium bromide, and visualized by UV transillumination. Each gel was electrophoresed initially for 15 min at 40 V and then at 100 V for an additional 60 to 70 min. A 100-bp ladder (Gibco BRL, Grand Island, N.Y.) was used as a molecular size marker in each gel.

Validation of the nested RSS-PCR method.Serum samples obtained from patients in San Francisco who had hepatitis C and whose HCV genotypes were known (on the basis of the results of the line probe assay) were used as positive controls to generate PCR band patterns. Band patterns generated from the clinical serum samples from Prague patients were compared to the patterns produced from these control samples. In addition, we sequenced the 5⬘NC and NS5b regions of the viral genome from the test (Prague) and control (U.S.) clinical samples to further validate the nested RSS-PCR test results. We ampli-fied and sequenced the product generated with primers Bukh-1 and Bukh-2 (Table 1), which contains the 5⬘NC region spanning nucleotide positions⫺276 to⫺50 (5). This segment includes a 176-bp sequence between nucleotide posi-tions⫺244 and⫺69 used by Simmonds et al. (31) and Smith et al. (33) to genotype HCV. In addition, we verified the genotypes of some of the samples by sequencing a 222-bp amplified fragment within the NS5b region of the HCV genome, corresponding to positions 7975 to 8196 in the prototype 1a virus (numbered as in reference 5), as reported previously (30). The amplified DNA fragments were sequenced in both directions by dideoxynucleotide chain termi-nation reactions with the ABI Prism 310 Genetic Analyzer (Perkin-Elmer). The sequences were compared to prototype HCV genotype sequences deposited in GenBank with DNASIS software (Hitachi, South San Francisco, Calif). The accession numbers of the prototype genotype sequences used to compare the 5⬘ NC sequences were as follows: 1a, M62321; 1b, D90208; 2a, D00944; 2b, D01221; 2c, D10075; 3a, D14307; 3b, D11443; 3c, D16612; 4a, M84848; 4b, M84845; 4c, M84862; 4d, M84832; 4e, M84828; 4f, M84829; 5a, M84860; and 6a, M84827. Sequences of NS5b region from the U.S. and Prague clinical samples were validated by comparison to other NS5b sequences deposited under accession numbers L23435 to L23475 (30).

RESULTS

Serum samples. Of the serum samples collected from 256 patients with liver disease in Prague from October 1998 to January 2000, 242 had been previously tested by the HCV ELISA; 126 (52%) of them had a positive result. Of these, 107 were also analyzed by the HCV RT-PCR test, and 78 (73%) of them were positive for HCV RNA. Seventy-five (96%) of the RNA-positive samples were analyzed by the newly developed nested RSS-PCR subtyping procedure. The remaining three samples were weakly positive by RT-PCR and hence could not

be typed by the RSS-PCR method. As positive controls, we used 15 HCV RNA-positive serum samples, whose viral titers were known, obtained from patients in San Francisco whose infecting HCV genotype was known on the basis of the results of the line probe DNA hybridization assay and sequence anal-ysis of the 5⬘NC and NS5b regions (Table 2).

[image:3.612.312.551.102.285.2]

RSS-PCR. The nested PCR was designed to generate six distinct amplicons of various sizes (606, 478, 451, 323, 256, and 101 bp) from the prototype genotype 1b strain (strain HCV-J), as shown schematically in Fig. 1. The number of bands actually observed in agarose gels varied, however, probably due to the difficulty in resolving the two amplicons of similar size (478 and 451 bp) and the small (101-bp) product. However, four pre-dominant bands representing amplicons of 606, 478 or 451, 323, and 256 bp were reproducibly and consistently observed

[image:3.612.313.546.528.600.2]

FIG. 1. RSS-PCR patterns generated from U.S. serum samples containing HCV of known genotype. Lane A diagrammatically repre-sents the predicted electrophoretic band pattern and the sizes of the products amplified from a sample that contains HCV genotype 1b RNA. By the line probe assay, the samples were found to contain HCV genotypes 1a (lane 1), 1b (lane 2), 2a (lane 3), 2b (lane 4), 3a (lane 5), 4 (lane 6), 4 (lane 7), 4 (lane 8), 6 (lane 9), 6a (lane 10), and 3a (lane 11). Lane MW, 100-bp molecular size marker (the numbers on the left are in base pairs). Although the sample in lane 9 was shown by the line probe assay to contain genotype 6 HCV, analysis of the 5⬘NC se-quence of the sample found that it differed from the prototype geno-type 6 5⬘NC sequence by 7 nucleotide positions. However, the NS5b sequence was more than 93% identical to the HCV genotype 1b NS5b sequences deposited in the GenBank database.

TABLE 2. Genotype analyses based on the line probe assay and the 5⬘NC sequence of the U.S. clinical samples used as positive

controls to develop the nested RSS-PCR test U.S. serum

sample identification

Genotype by line probe

assay

Genotype by 5⬘NC sequence

Genotype by NS5b sequence

Viral load (copy no./ml)

2234 1a 1a NDa 3,700,000

684 1a 1a 1a ⬎5,000,000

2529 1b 1b ND 10,000,000

884 1b 1b 1b ⬎5,000,000

1950 2a 2a 2a ⬎5,000,000

2657 2a 2a 2a 4,800,000

2202 2b 2b 2b 3,500,000

2637 2b 2b 2b 9,100,000

1966 3a 3a 3a 28,300,000

2244 3a 3a 3a 9,600,000

633 4 4 ND NAb

1062 4 4 ND NA

3940 4 4 4 NA

728 6 Untypeablec 1bd NA

2713 6a 6a 6a NA

aND, not done.

bNA, information not available.

cThe sequence varied from the HCV prototype 6 strain sequence at 7

nucle-otide positions.

dThis was typed as genotype 1b by the RSS-PCR test.

on May 15, 2020 by guest

http://jcm.asm.org/

(4)

with HCV subtype 1b (see below). The 256-bp amplicon was produced from a segment in the 5⬘ NC region that is highly conserved among all HCV genotypes, and its amplification indicates the presence of any HCV RNA in the test sample. Thus, this PCR product served as an internal positive control in every nested reaction.

Validation of nested RSS-PCR results by comparison to results for serum samples containing HCV RNAs of known genotypes. U.S. serum samples 2529 and 884, whose HCV titers were known, had been found by the line probe assay to contain HCV genotype 1b RNA (Table 2). The nested RSS-PCR electrophoretic band patterns generated for the strains from these samples were identical to each other and were consistent with the predicted pattern for genotype 1b (Fig. 1, lane A), while the strains from the remaining samples pro-duced patterns which were distinct from that for genotype 1b (Fig. 1, lanes 1 and 3 to 11). The products of 478 or 451 and 323 bp were always seen together for HCV subtype 1b, while the products of 606, 478 or 451, and 101 bp were observed at various frequencies and intensities among subtype 1a and ge-notype 2, 3, 4, and 6 strains. Thus, subtype 1b generated an RSS-PCR pattern distinct from those for subtype 1a and other genotypes.

To assess the reproducibility of the nested RSS-PCR tech-nique, we performed new extraction and amplification proce-dures for each of the U.S. samples three or more times and obtained identical results. Representative patterns for the se-lected samples are shown in Fig. 1. The two U.S. genotype 3a-positive samples generated two distinct RSS-PCR patterns (Fig. 1, lanes 3 and 11), and the three U.S. genotype 4 strains also generated two different patterns (Fig. 1, lanes 6 to 8). The 5⬘ NC sequence analysis found changes at 2 nucleotide posi-tions in the two U.S. HCV genotype 3a strains. One U.S. subtype 4 strain (from sample 633) differed from another sub-type 4 strain (from sample 1062) at 2 nucleotide positions, and it differed at 4 nucleotide positions from a third subtype 4 strain (from sample 3940). We were unable to obtain any clinical samples known to contain HCV genotype 5 for this study.

The strain in one U.S. sample (sample 728) was labeled as genotype 6 on the basis of the line probe assay, but it produced an RSS-PCR pattern similar to the pattern for genotype 1b (Fig. 1, lane 9). Interestingly, 5⬘NC sequence analysis did not classify this strain as a genotype 6 strain. The sequence of a 176-bp region within the amplified 256-bp 5⬘ NC sequence used by Simmonds et al. (31) to classify HCV genotypes varied from that of the prototype HCV genotype 6 strain at 7 nucle-otide positions. It differed at 3 and 4 nuclenucle-otide positions from the sequences for the prototype subtypes 1a and 1b strains, respectively. However, its NS5b region was more than 95% identical to the NS5b regions of four different strains of HCV subtype 1b in the GenBank database (accession numbers L23442, L23443, L23444, and L23445) and only 65% identical to the NS5b sequence of a genotype 6a strain (accession num-ber L23475). Hence, by comparison to other prototype se-quences, the virus in this U.S. sample can be classified as HCV subtype 1b, supporting the prediction made by the RSS-PCR test. By sequence analysis, we were able to confirm the line probe assay results for the other 14 U.S. samples (Table 2). The 5⬘NC sequences of the viruses in the two U.S. samples,

predicted to have the HCV subtype 1b pattern, were 100% identical to the corresponding sequence in prototype strain HCV-J.

We tested the clinical samples from Prague using U.S. sam-ples 2529 and 884 as positive controls for subtype 1b. Nested RSS-PCR was performed with 75 clinical samples known to be positive by HCV ELISA and RT-PCR. Of the strains in those 75 samples, 54 (72%) displayed a pattern consistent with the pattern for the positive genotype 1b controls (Fig. 2B). The remaining 21 strains from clinical samples generated patterns distinct from that for genotype 1b. In 19 of them, the RSS-PCR pattern was similar to that observed for U.S. samples 2234 and 684, which, by the line probe assay and sequencing, were found to contain HCV subtype 1a RNA (Fig. 2A, lanes 1 to 4 and lanes 7 and 8). The strains in the other two samples had a pattern similar to that for the strain in U.S. sample 1966, which was found by the line probe assay and sequencing to be HCV genotype 3a (Figure 2C, lane 3).

[image:4.612.333.526.69.271.2]

Validation of nested RSS-PCR by sequence analysis of the clinical samples.We sequenced the 256-bp product from the 5⬘ NC regions from all 75 Prague samples to confirm the FIG. 2. RSS-PCR patterns generated from clinical serum samples from patients with hepatitis C in Prague, Czech Republic. In each panel, the PCR patterns are compared to the subtype 1b RSS-PCR pattern. (A) Samples predicted to contain HCV subtypes 1a (lanes 1 to 4, 7, and 8) and 1b (lanes 5 and 6). Lanes 1 (strain 094) and 3 (strain 152) contain samples that contain HCV subtype 1a with a 5⬘

NC sequence that was 100% identical to that of the prototype geno-type 1a HCV, whereas the samples in lanes 2 (strain 096) and 4 (strain 145) contained HCV that differed from the prototype 1a strain by a single C3A change at position⫺138. The genotype 1a pattern in lane 8 was generated from a sample (strain 048) that contained HCV with the same C3A nucleotide change, in addition to four other changes upstream. (B) Clinical samples predicted to contain HCV of subtype 1b. Lanes 1 to 3, HCV RNA with a 5⬘NC sequence 100% identical to the prototype genotype 1b sequence; lane 4 (strain 177), a sample that contained HCV with an extra A at position⫺137. (C) Comparison of genotype 1b patterns (lanes 1 and 2) with a predicted genotype 3a RSS-PCR pattern (lane 3). Note that the clinical sample from Prague in lane 3 generated a pattern identical to one of the subtype 3a-containing samples from the United States shown in lane 11 in Fig. 1. The U.S. sample was confirmed by sequencing to contain the HCV genotype 3a.

on May 15, 2020 by guest

http://jcm.asm.org/

(5)

results presented above. Of the 54 strains found by RSS-PCR to have the genotype 1b pattern, 46 (85%) had 5⬘NC region sequence that was 100% identical to the corresponding 5⬘NC region sequence of prototype strain HCV-J. Six others had sequences that differed by only 1 nucleotide within the 176-bp 5⬘NC segment from that for strain HCV-J. These nucleotide changes were not located at positions used by Simmonds et al. (31) and Smith et al. (33) to differentiate the HCV genotypes. All six had a G at position⫺99, just like the other 46 strains. Simmonds et al. (31) found that most strains of subtype 1a, as well as strains of other genotypes, have an A at this position (position⫺99). Four of these six strains had an identical single T3C change at position ⫺94, one had a C3T change at position⫺138, and the last one had a C3A change at⫺138. We found the same 5⬘NC nucleotide changes in other HCV genotype 1b sequences deposited in GenBank. We compared the NS5b sequences of the strains in these six samples and found that all were of subtype 1b. The additional two samples with the subtype 1b pattern as determined by RSS-PCR had an extra A at position⫺138. This change was not found among available GenBank subtype 1b 5⬘NC sequences, but the NS5b sequences of these strains were more than 93% identical to the GenBank subtype 1b NS5b sequences.

Among 19 strains with RSS-PCR patterns identical to those of U.S. strains 2234 and 684 (subtype 1a), 2 were 100% iden-tical to the prototype HCV subtype 1a strain (HCV-1) by 5⬘ NC sequence analysis, 16 had a C3A change at position⫺138, and the last 1 (strain 226) had a C3T change at the same position. Interestingly, of the two U.S. strains found to be of HCV subtype 1a by the line probe assay, one had a C at position⫺138 and the other had an A at position⫺138, which are exactly the same both variations for of subtype 1a strains found by RSS-PCR among Prague samples. We found the same 5⬘NC nucleotide changes in HCV subtype 1a sequences deposited in GenBank for both of these subtype 1a variants. The sequences of the NS5b regions of all of these strains verified that they belong to subtype, 1a. The RSS-PCR pattern was the same for all of these subtype 1a strains and distinct from the pattern for the subtype 1b strains.

The last two strains from clinical samples produced RSS-PCR patterns that were identical to that for one of the U.S. strains (strain 1966) found by the line probe assay and sequenc-ing to be of genotype 3a. Sequence analysis of the 5⬘NC region demonstrated that they were closest to the genotype 3a proto-type strain Eb-1 sequence (31), differing by 3 nucleotides at positions ⫺121, ⫺138, and ⫺139. The NS5b sequence also classified them as subtype 3a strains.

Thus, a total of 75 Prague and 15 U.S. clinical samples were characterized by RSS-PCR. Fifty-four Prague and two U.S. strains with sequences validated to be those of HCV genotype 1b were predicted by the RSS-PCR method to be subtype 1b (100% sensitivity). On the basis of analysis of either 5⬘NC or the NS5b sequence, the specificity of the RSS-PCR test for the differentiation subtype 1b from other HCV subtypes was also 100%.

DISCUSSION

Genotypic analyses of HCV are often confined to reference or research laboratories because of the need for nucleic acid

sequencing or the use of kits whose high costs limit their accessibility to most laboratories. Here, we report a modifica-tion of a simple new PCR-based strain-typing method that can be used to generate fingerprint patterns representing HCV genotypes directly from clinical material. This method relies on nucleotide sequence polymorphisms that occur at restriction endonuclease recognition sites without the use of any restric-tion endonucleases. The technique was first developed for the typing of dengue viruses (9, 17) and was more recently applied to the typing ofE. colistrains associated with diarrheal diseases (12). The application of this method to the typing of HCV, however, required modification because this organism cannot be cultured in vitro. Thus, this is the first application of the RSS-PCR method in which strain typing is performed directly from clinical specimens. This approach may be useful for the typing of other pathogens that cannot be easily isolated or cultured. Furthermore, the test was designed in such a way that the generation of a pattern not only provides information about the genotype but also simultaneously indicates the pres-ence of HCV RNA in a clinical sample. The observation of a 256-bp PCR product from each sample indicates the presence of HCV-specific RNA, which adds to the specificity of the test. This RSS-PCR method for the typing of HCV was devel-oped by using information obtained from previous studies that used the 5⬘NC region to genotype HCV strains. Davidson et al. (6) typed HCV by restriction fragment length polymor-phism analysis of a sequence within the 5⬘NC region amplified by PCR and cleaved with restriction endonucleases. They were able to distinguish genotypes 1a, 1b, 2a, 2b, 3a, 3b, 4, 5, and 6 by this method. The nested RSS-PCR method was designed to target polymorphic sequences within the same 5⬘ NC region used for restriction fragment length polymorphism analysis by Davidson et al. (6), in addition to the restriction site polymor-phisms found in the C region of genotype 1b, using the se-quence derived from strain HCV-J as a reference. Stuyver et al. (34) genotyped HCV by DNA hybridization using the line probe assay, in which sequence variability within the 5⬘ NC region was also used as the target of a probe constructed from a DNA product amplified from clinical specimens. The line probe assay is commercially available as a kit, but its cost makes it inaccessible to most laboratories in regions of the world with increasing prevalence of HCV infections, such as Eastern and Central Europe, where specimens for this study were collected. One of the major advantages of the nested RSS-PCR method is that any laboratory capable of performing PCR can readily apply the procedure to the typing of HCV.

Differentiation of HCV strains into genotypes has already become an integral part of epidemiologic investigations of hepatitis C. Several studies have attempted to examine the role of HCV genotypes in clinical outcome following HCV infec-tion, such as progression of the liver disease, response to in-terferon therapy, or development of chronic infection. Differ-ences in clinical outcomes and responses to therapy in patients with HCV infections are well recognized. Amoroso et al. (1) found that the rate of progression to chronic infection after acute exposure to HCV was 92% among patients who were infected with genotype 1b, whereas that rate was 33 to 50% among those infected with strains of other genotypes. Zein et al. (37, 39) found that genotype 1b strains occurred signifi-cantly more frequently among patients with cirrhosis and those

on May 15, 2020 by guest

http://jcm.asm.org/

(6)

patients requiring liver transplantation. Patients infected with genotype 1b and possibly genotype 1a may have a more unfa-vorable response to treatment with interferon than those in-fected with genotypes 2 or 3 (38). On the basis of these obser-vations, the European Association for the Study of the Liver in 1999 announced a consensus statement that for patients in-fected with genotype 1 and with viremia of⬎2⫻106copies/ml, 12 months of therapy with interferon and ribavirin should be given, whereas for patients infected with genotypes 2 or 3, 6 months of therapy with interferon and ribavirin should be given, regardless of the level of viremia (8).

The significance of the relationship between HCV subtype 1b infection and clinical outcome remains unclear, as others have not found such associations with this genotype (2, 7). Zein (40) suggested that HCV genotype 1b may have appeared in the human population before the other genotypes, and thus, patients exposed to HCV genotype 1b may have been infected for a longer time. Hence, the association of this genotype with severe disease may reflect differences in patients’ durations of infection. The continued uncertainty about the relationship between genotype 1b and clinical outcomes of hepatitis C infection emphasizes the need to examine this question in depth with studies performed at more sites. The availability of a simple test to distinguish genotype 1b from other genotypes provides an opportunity to expand such studies.

It should be emphasized that the RSS-PCR method re-ported here should be regarded as a proof-of-concept ap-proach to the typing of HCV, in that the primer designs can be modified to generate a fingerprint pattern specific to any ge-notype or subtype of interest. Primer designs may be modified to generate patterns based on the nonstructural genes (for example, the NS5b region) of HCV or to specifically target HCV subtype 1a. Hence, it offers great flexibility in the design of studies appropriate for local hepatitis C epidemiologic sit-uations.

Other PCR-based methods for the typing of HCV exist (14, 23, 24, 25, 27, 36). However, the other reported methods re-quire the use of restriction endonucleases to generate a fin-gerprint pattern or a larger number of primer sets designed to differentiate the HCV genotypes by displaying differences in the sizes of a single amplified product. The nested RSS-PCR method generates characteristic band patterns without endo-nucleases, which enhances specificity and minimizes false-pos-itive signals due to contaminating and cross-reacting DNA. While the technique does not have the discriminatory power of direct sequencing, it was able to rapidly differentiate the com-mon HCV subtypes circulating in Prague, which are similar to those circulating in Western Europe and North America. In fact, it correctly identified the virus in a U.S. sample to be genotype 1b when the virus was initially misclassified as geno-type 6 by the line probe assay. The technique is considerably cheaper and simpler to perform than the line probe DNA hybridization assay and is certainly more feasible than se-quencing in countries with limited abilities to do that level of testing on a routine basis. A simple method for the differen-tiation of genotype 1b from genotype 1a and other HCV sub-types should make it accessible to more geographic areas and laboratories to facilitate improved clinical outcomes and epi-demiologic studies. Such studies may provide information that

has major implications for clinical management of hepatitis C and possibly HCV vaccine development.

ACKNOWLEDGMENTS

We thank the California Pacific Medical Center for providing the serum samples characterized by the line probe assay and viral load testing. In addition, we thank Flavia Barretos dos Santos, Patrick Killoran, Nora Madrigal, Matthew Johnson, Ivan Krekule, and Cecil H. Hocky for technical assistance, as well as all of the patients who participated in the study.

This project was supported by the Fogarty International Training and Research in Emerging Infectious Diseases Supplement from the National Institutes of Health (grant TW00905).

REFERENCES

1.Amoroso, P., M. Rapicetta, M. E. Tosti, A. Mele, E. Spada, S. Buonocore, G. Lettieri, P. Pierri, P. Chionne, A. R. Ciccaglione, and L. Sagliocca.1998. Correlation between virus genotype and chronicity rate in acute hepatitis C. J. Hepatol.28:939–944.

2.Benvegnu, L., P. Pontisso, D. Cavalletto, F. Noventa, L. Chemello, and A. Alberti.1997. Lack of correlation between hepatitis C virus genotypes and clinical course of hepatitis C virus-related cirrhosis. Hepatology25:211–215. 3.Boom, R., C. J. A. Sol, M. M. M. Salimans, C. L. Jansen, P. M. E. Wertheim-van Dillen, and J. Wertheim-van der Noordaa.1990. Rapid and simple method for purification of nucleic acids. J. Clin. Microbiol.28:495–503.

4.Bukh, J., R. H. Purcell, and R. H. Miller.1992. Importance of primer selection for the detection of hepatitis C virus RNA with the polymerase chain reaction assay. Proc. Natl. Acad. Sci. USA89:187–191.

5.Choo, Q. L., K. H. Richman, J. H. Han, K. Berger, C. Lee, C. Dong, C. Gallegos, D. Coit, A. Medina-Selby, P. J. Barr, A. J. Weiner, D. W. Bradley, G. Kuo, and M. Houghton.1991. Genetic organization and diversity of the hepatitis C virus. Proc. Natl. Acad. Sci. USA88:2451–2455.

6.Davidson, F., P. Simmonds, J. C. Ferguson, L. M. Jarvis, B. C. Dow, E. A. C. Follett, C. R. G. Seed, T. Krusius, C. Lin, G. A. Medgyesi, H. Kiyokawa, G. Olim, G. Duraisamy, T. Cuypers, A. A. Saeed, D. Teo, J. Conradie, M. C. Kew, M. Lin, C. Nuchaprayoon, O. K. Ndimbie, and P. L. Yap.1995. Survey of major genotypes and subtypes of hepatitis C virus using RFLP of se-quences amplified from the 5⬘non-coding region. J. Gen. Virol.76:1197– 1204.

7.Davis, G. L., and J. Y. Lau.1997. Factors predictive of a beneficial response to therapy of chronic hepatitis C. N. Engl. J. Med.339:1493–1499. 8.EASL International Consensus Conference on Hepatitis C.1999. Consensus

statement. J. Hepatology31(Suppl.):3–8.

9.Harris, E., E. Sandoval, A. M. Xet-Mull, M. Johnson, and L. W. Riley.1999. Rapid Subtyping of dengue viruses by restriction site-specific (RSS)-PCR. Virology253:86–95.

10. Kanal, K., M. Kako, T. Kumuda, H. Tsubouchi, T. Aikawa, M. Kojima, H. Harada, T. Kawasaki, M. Nakashima, H. Okamoto, and S. Mishiro.1998. High-dose (9 MU) long-term (60 weeks) alfa-interferon therapy for chronic hepatitis patients infected with HCV genotype 1b. Arch. Virol.143:1545– 1554.

11. Kato, N., M. Hijikata, Y. Ootsuyama, M. Nakagawa, S. Ohkoshi, T. Sug-imura, and K. Shimotohno.1990. Molecular cloning of the human hepatitis C virus genome from Japanese patients with non-A, non-B hepatitis. Proc. Natl. Acad. Sci. USA87:9524–9528.

12. Kimura, R., R. E. Mandrell, J. C. Galland, D. Hyatt, and L. W. Riley.2000. Restriction-site specific PCR as a rapid test to detect enterohemorrhagic

Escherichia coliO157:H7 strains in environmental samples. Appl. Environ. Microbiol.66:2513–2519.

13. Lau, J. Y., G. L. Davis, L. E. Prescott, G. Maertens, K. L. Lindsay, K. Qian, M. Mizokami, P. Simmonds, and the Hepatitis Interventional Therapy Group.1996. Distribution of hepatitis C virus genotypes determined by line probe assay in patients with chronic hepatitis C seen at tertiary referral centers in the United States. Ann. Intern. Med.124:868–876.

14. Li, J. S., S. P. Tong, L. Vitvitski, and C. Trepo.1995. Single-step nested polymerase chain reaction for detection of different genotypes of hepatitis C virus. J. Med. Virol.45:151–155.

15. Mahaney, K., V. Tedeschi, G. Maertens, A. M. DiBisceglie, J. Vergalla, J. H. Hoofnagle, and R. Sallie.1994. Genotypic analysis of hepatitis C virus in American patients. Hepatology20:1405–1411.

16. Marcellin, P.1999. Hepatitis C: the clinical spectrum of the disease. J. Hepa-tol.31(Suppl):9–16.

17. Miagostovich, M. P., F. B. dos Santos, C. M. Gutierrez, L. W. Riley, and E. Harris.2000. Rapid subtyping of dengue virus serotypes 1 and 4 by restric-tion site-specific PCR. J. Clin. Microbiol.38:1286–1289.

18. Mori, S., N. Kato, A. Yagyu, T. Tanaka, Y. Ikeda, B. Petchclai, P. Chiewsilp, T. Kurimura, and K. Shimotohno.1992. A new type of hepatitis C virus in patients in Thailand. Biochem. Biophys. Res. Commun.183:334–342.

on May 15, 2020 by guest

http://jcm.asm.org/

(7)

19.Murase, J., S. Kubo, S. Nishiguchi, K. Hirohashi, T. Shuto, T. Ikebe, and H. Kinoshita.1999. Correlation of clinicopathologic features of resected hep-atocellular carcinoma with hepatitis C virus genotype. Jpn. J. Cancer Res. 90:1239–1300.

20.Naoumov, N. V.1999. Hepatitis C virus infection in Eastern Europe. J. Hepatol.31(Suppl.):84–87.

21.National Institutes of Health Consensus Development Conference Panel. 1997. National Institutes of Health Consensus Development Conference Panel statement: management of hepatitis C. Hepatology26(Suppl.):2S–10S. 22.Nousbaum, J. B.1998. Genomic subtypes of hepatitis C virus: epidemiology,

diagnosis and clinical consequences. Bull. Soc. Pathol. Exot.91:29–33. 23. Okamoto, H., Y. Sugiyama, S. Okada, K. Kurai, Y. Akahane, Y. Sugai, T.

Tanaka, K. Sato, F. Tsuda, Y. Miyakawa, and M. Mayumi.1992. Typing hepatitis C virus by polymerase chain reaction with type-specific primers: application to clinical surveys and tracing infectious sources. J. Gen. Virol. 46:109–115.

24. Okamoto, H., S. Kobata, H. Tokita, T. Inoue, G. D. Woodfield, P. V. Holland, B. A. Al Knawy, O. Uzunalimoglu, Y Miyakawa, and M. Mayumi.1996. A second-generation method of genotyping hepatitis C virus by the polymerase chain reaction with sense and antisense primers deduced from the core gene. J. Virol. Methods57:31–45.

25. Okamoto, H., K. Kurai, S. Okada, K. Yamamoto, H. Lizuka, T. Tanaka, S. Fukuda, F. Tsuda, and S. Mishiro.1992. Full-length sequence of hepatitis C virus genome having poor homology to reported isolates: comparative study of four distinct genotypes. Virology188:331–341.

26. Pozzato, G., M. Moretti, L. S. Croce, F. Sasso, S. Kaneko, M. Unoura, K. Kobayashi, M. Crovatto, G. Santini, and C. Tiribelli.1995. Interferon ther-apy in chronic hepatitis C virus: evidence of different outcome with respect to different viral strains. J. Med. Virol.45:445–450.

27. Silva, L. K., R. Parana, S. P. Souza, F. Berby, A. Kay, C. Trepo, N. Santana, H. Cotrim, L. G. Lyra, and M. G. Reis.2000. Hepatitis C virus genotypes in a northeastern area of Brazil. Am J. Trop. Med. Hyg.62:257–260. 28. Simmonds, P.1999. Viral heterogeneity of the hepatitis C virus. J. Hepatol.

31(Suppl.):54–60.

29. Simmonds, P., A. Alberti, H. J. Alter, F. Bonino, D. W. Bradley, C. Brechot, J. T. Brouwer, S. W. Chan, K. Chayama, D. S. Chen, Q.-L. Choo, M. Colombo, H. T. M. Cuypers, T. Date, G. M. Dusheiko, J. I. Esteban, O. Fay, S. J. Hadziyannis, J. Han, A. Hatzakis, E. C. Holmes, H. Hotta, M. Hough-ton, B. Irvine, M. Kohara, J. A. Kolberg, G. Kuo, J. Y. N. Lau, P. N. Lelie, G. Maertens, F. McOmish, T. Miyamura, M. Mizokami, A. Nomoto, A. M. Prince, H. W. Reesink, C. Rice, M. Roggendorf, S. W. Schalm, T. Shikata, K. Shimotohno, L. Stuyver, C. Tre´po, A. Weiner, P. L. Yap, and M. S. Urdea. 1994. A proposed system for the nomenclature of hepatitis C viral genotypes. Hepatology19:1321–1324.

30. Simmonds, P., E. C. Holmes, T. A. Cha, S.-W. Chan, F. McOmish, B. Irvine, E. Beall, P. L. Yap, J. Kolberg, and M. S. Urdea.1993. Classification of hepatitis C virus into six major genotypes and a series of subtypes by phy-logenetic analysis of the NS-5 region. J. Gen. Virol.74:2391–2399. 31. Simmonds, P., F. McOmish, P. L. Yap, S.-W. Chan, C. K. Lin, G. Dusheiko,

A. A. Saeed, and E. C. Holmes.1993. Sequence variability in the 5⬘ non-coding region of hepatitis C virus: identification of a new virus type and restrictions on sequence diversity. J. Gen. Virol.74:661–668.

32. Simmonds, P., J. Mellor, A. Craxi, J. M. Sanchez-Tapias, A. Alberti, J. Prieto, M. Colombo, M. G. Rumi, O. Lo Jacano, S. Ampurdances-Mingall, X. Forns-Bernhardt, L. Chemello, M. P. Civeira, C. Frost, and G. Dusheiko. 1996. Epidemiological, clinical and therapeutic associations of hepatitis C types in western Europeans patients. J. Hepatol.24:517–524.

33. Smith, D. B., J. Mellor, L. M. Jarvis, F. Davidson, J. Kolberg, M. Urdea, P.-L. Yap, P. Simmonds, and The International HCV Collaborative Study Group.1995. Variation of the hepatitis C virus 5⬘non-coding region: impli-cations for secondary structure, virus detection and typing. J. Gen. Virol. 76:1749–1761.

34. Stuyver, L., R. Rossau, A. Wyseur, M. Duhamel, B. Vanderborght, H. Van Heuverswyn, and G. Maertens.1993. Typing of hepatitis C virus isolates and characterization of new subtypes using a line probe assay. J. Gen. Virol. 74:1093–1102.

35. Vezzoli, M., S. Girola, G. Fossati, I. Mazzucchelli, D. Gritti, and A. Mazzone. 1998. Beta-interferon therapy of chronic hepatitis HCV⫹, 1b genotype. Recenti Prog. Med.89:235–240.

36. Widell, A., S. Shev, S. Mansson, Y. Y. Zhang, U. Foberg, G. Norkrans, A. Fryden, O. Weiland, J. Kurkus, and E. Nordenfelt.1994. Genotyping of hepatitis C virus isolates by a modified polymerase chain reaction assay using type specific primers: epidemiological applications. J. Med. Virol.44:272– 279.

37. Zein, N. N., J. J. Poterucha, J. B. Gross, Jr., R. H. Wiesner, T. M. Therneau, A. A. Gossard, N. K. Wendt, P. S. Mitchell, J. J. Germer, and D. H. Persing. 1996. Increased risk of hepatocellular carcinoma in patients infected with hepatitis C genotype 1b. Am. J. Gastroenterol.91:2560–2562.

38. Zein, N. N., J. Rakela, E. L. Krawitt, K. R. Reddy, T. Tominaga, D. H. Persing, and the Collaborative Group.1996. Hepatitis C virus genotypes in the United States: epidemiology, pathogenicity and response to interferon therapy. Ann. Intern. Med.125:634–639.

39. Zein, N. N., J. Rakela, J. J. Poterucha, J. L. Steers, R. H. Wiesner, D. H. Persing.1995. Hepatitis C genotypes in liver transplant recipients: distribu-tion and 1-year follow-up. Liver Transplant. Surg.1:354–357.

40. Zein, N. N.2000. Clinical significance of hepatitis C virus genotypes. Clin. Microbiol. Rev.13:223–235.

on May 15, 2020 by guest

http://jcm.asm.org/

Figure

TABLE 1. Synthetic oligonucleotide primers used for the initial RT-PCR (primers Bukh-E1, RSS-E2) and nested RSS-PCR(primers Bukh-1, Bukh-2, RSS-I1, RSS-I2, and RSS-I4)
TABLE 2. Genotype analyses based on the line probe assay andthe 5� NC sequence of the U.S
FIG. 2. RSS-PCR patterns generated from clinical serum samplesfrom patients with hepatitis C in Prague, Czech Republic

References

Related documents

two drugs are concomitantly administered where they affect each other’s response either pharmacologically or kinetically. On the other hand, Type B reactions are

Secure Data Exchange Aggregate Services Administration, Business, Citizens Interconnectivity Data integration Content management metadata eServices access Enterprise viewpoint

For using this approach to generate fractal we require heavy amount of memory, because in each iteration we are generating some image and to store image generated by

Two mutations occur in position 120 with different consequence on the stability and the neutrality of the protein; one when Cysteine (wild-type residue) is mutated to

Soil erosion in the Megech river catchment, one of the major catchments of Lake Tana sub-basin of the Abbay River basin using Remote sensing, and GIS based

Nakayama, Segur and Wadati [14] set up a correspondence between the mKdV hierarchy and inextensible motions of plane curves in Eucli- dean geometry.. Integrable systems satisfied

grande implication des chercheurs et universitaires marocains dans les décisions et dans les programmes de recherche scientifique. Par ailleurs, un comité permanent

Connecting femtocells to operator networks requires unique architectures that address the security needs of operators and mobile users and support the deployment