• No results found

Clinical Evaluation of an In House Reverse Transcription Competitive PCR for Quantitation of Human Immunodeficiency Virus Type 1 RNA in Plasma

N/A
N/A
Protected

Academic year: 2020

Share "Clinical Evaluation of an In House Reverse Transcription Competitive PCR for Quantitation of Human Immunodeficiency Virus Type 1 RNA in Plasma"

Copied!
6
0
0

Loading.... (view fulltext now)

Full text

(1)

Copyright © 1999, American Society for Microbiology. All Rights Reserved.

Clinical Evaluation of an In-House Reverse Transcription-Competitive

PCR for Quantitation of Human Immunodeficiency

Virus Type 1 RNA in Plasma

MAURIZIO ZAZZI,1,2* LAURA ROMANO,1MARINUNZIA CATUCCI,1GIULIETTA VENTURI,1

ANGELO DE MILITO,1ANDPIER E. VALENSIN1,2

Sezione di Microbiologia, Dipartimento di Biologia Molecolare, Universita` di Siena,1and Servizio di

Microbiologia e Virologia II, Azienda Ospedaliera Senese,2Siena, Italy

Received 14 January 1998/Returned for modification 29 July 1998/Accepted 13 October 1998

An in-house reverse transcription (RT)-competitive PCR (RT-cPCR) for the quantitation of human immu-nodeficiency virus type 1 (HIV-1) RNA in plasma samples was developed and validated. The procedure involves (i) extraction of RNA with spin columns, (ii) ready-to-use bead-mediated RT, (iii) competitive PCR in a microtiter plate, (iv) agarose gel electrophoresis of the reaction products, and (v) densitometric analysis of the digitized image of the gel. Quadruplicate tests and dilution studies showed that the sensitivity and intertest coefficient of variability of the RT-cPCR are comparable to those of the reference AMPLICOR HIV-1 MON-ITOR test. The results obtained by the two assays with a panel of 45 clinical samples were in good agreement (mean difference, 0.3660.25 log units). Analysis of 1,982 clinical samples by the in-house RT-cPCR yielded the typical range of plasma HIV-1 RNA levels with the expected inverse correlation between CD4 counts and HIV-1 RNA titers. In addition, testing of plasma from 36 subjects at weeks 0 and 4 with respect to the time of initiation of protease inhibitor therapy detected a significant decrease in HIV-1 viremia. The mean reduction in the HIV-1 RNA level was 0.914 log unit for those receiving saquinavir (P50.0210), 1.584 log units for those receiving indinavir (P50.0047), and 1.904 log units for those receiving ritonavir (P< 0.0001). The in-house RT-cPCR assay is simple to develop and perform and allows quantitation of HIV-1 RNA in 100 to 200 samples per operator per week. Since the cost is 1/8 to 1/10 of those of reference commercial assays, this procedure could be conveniently used in medium-scale laboratories.

The levels of human immunodeficiency virus type 1 (HIV-1) RNA in plasma are highly predictive of disease progression in individuals with HIV-1 infection (14, 15). Periodic measure-ment of the plasma HIV-1 RNA load has thus been established as the key laboratory analysis for monitoring the course of HIV-1 infection in patients under treatment with different combinations of antiretroviral compounds (9). Three commer-cially available methods have been licensed for titration of HIV-1 RNA in clinical samples; these methods are based on target amplification by competitive PCR (AMPLICOR HIV-1 MONITOR test; Roche) or quantitative nucleic acid se-quence-based amplification (Q-NASBA; Organon Teknika) and signal amplification by the branched-DNA assay (QUAN-TIPLEX; Chiron). These systems have been shown to yield equivalent results in comparative studies (5, 20, 23), and all are suitable for clinical use. However, all of these commercial kits are still expensive ($60 to $100 per test), actually limiting full large-scale application in most settings and prompting the de-velopment of reliable cost-effective in-house assays (1, 25).

The use of a titrated competitor amplification target for the quantitation of HIV-1 nucleic acid sequences by PCR was first detailed in 1993 (19) and is still considered to be the best ap-proach for quantitative PCR, as shown by its use in the Roche AMPLICOR HIV-1 MONITOR test. We have optimized and clinically evaluated a simplified in-house reverse transcription (RT)-competitive PCR (RT-cPCR) system which combines (i) extraction of RNA from plasma with spin columns, (ii)

non-competitive RT with ready-to-use reaction beads, (iii) four-well competitive PCR with premade reaction mixtures in a microtiter plate, (iv) agarose gel electrophoresis of the reac-tion products, and (v) densitometric analysis of the digitized image of the gel. Reproducibility studies, parallel analysis of samples titrated by the AMPLICOR HIV-1 MONITOR test, and testing of samples from a large number of patients indi-cated that the in-house assay is suitable for clinical application and has 1/8 to 1/10 of the cost of commercial systems.

MATERIALS AND METHODS

Construction of competitor HIV-1 DNA and wt HIV-1 RNA standard.The

sequences and relative locations of all primers used in this study are presented in Table 1 and Fig. 1, respectively. A deleted competitor HIV-1 DNA fragment was generated by PCR amplification of apolsequence of the HIV-1 Z6 genome contained in plasmid pSYC1857 (Perkin-Elmer, Emeryville, Calif.) with the antisense primer LR62 and the sense primer T52. Primer T52 hybridizes with the 39terminal 20 bases at positions 3163 to 3182 of the HIV-1 SF2 isolate (GenBank accession no. KO2007) and contains a 27-base 59tail that hybridizes to positions 3096 to 3122. PCR amplification with primers LR52 and LR62 generates a 237-or a 197-bp product when wild-type (wt) HIV-1 RNA-derived cDNA 237-or the T52-LR62 competitor DNA, respectively, is used as the template. The concen-tration of the purified T52-LR62 DNA fragment was estimated by agarose gel electrophoresis and was accurately adjusted by repeated competitive titration of 500 copies of pSYC1857 (as determined by the manufacturer). Competitive amplification and data analysis were essentially the same as described below for clinical samples except that the wt DNA titer was known and the competitor DNA titer was to be determined.

To construct a wt HIV-1 RNA standard, the wt LR52-LR62 PCR product was inserted into plasmid pCRII by using the TA-Cloning System (Invitrogen, Leek, The Netherlands). The resulting plasmid, pCRII-LR52/LR62, was linearized at a uniqueSalI site (26 bases from the end of the inserted fragment) and was quantitated by agarose gel electrophoresis. Following in vitro transcription with T7 RNA polymerase, template DNA was digested with DNase I (Promega, Madison, Wis.). The ethanol-precipitated RNA pellet was resuspended in dieth-ylpyrocarbonate (DEPC)-treated water containing 10 mM Tris-HCl (pH 8.5), 10 mM NaCl, and 1 mM EDTA and was quantitated by spectrophotometry. Ap-* Corresponding author. Mailing address: Sezione di Microbiologia,

Dipartimento di Biologia Molecolare, Universita` di Siena, Via Lat-erina 8, 53100 Siena, Italy. Phone: 39 577 263850. Fax: 39 577 263870. E-mail: [email protected].

333

on May 15, 2020 by guest

http://jcm.asm.org/

(2)

propriate single-use aliquots of the wt HIV-1 RNA standard were stored at

270°C and were used in preliminary experiments in order to evaluate the yield and reproducibility of the RNA extraction and RT steps. HIV-1-negative plasma was used to reconstruct clinical samples harboring 103to 106copies of wt HIV-1 RNA per ml. These standard samples were subjected in triplicate to RNA ex-traction and RT followed by competitive PCR in the presence of increasing amounts of the competitor T52-LR62 DNA fragment as described below, except that 2-ml aliquots of cDNA were used as the cPCR template for titration of the samples with 106copies. The results obtained allowed us to estimate the ratio between the amount of HIV-1 RNA present in the starting material and the amount of HIV-1 cDNA generated. This factor was then used to adjust the actual copy numbers of the competitor DNA to RNA equivalents, i.e., the number of cDNA copies resulting from extraction and RT of equivalent numbers of copies of RNA.

In-house RT-cPCR system.Plasma RNA was prepared by using the QIAmp

Viral RNA kit (Qiagen, Chatsworth, Calif.) according to the manufacturer’s instructions, except that 300ml of starting material was loaded onto the column and was eluted with 50ml of preheated DEPC-treated water after incubation at 80°C for 5 min. In addition, 1,000 copies of tobacco mosaic virus (TMV) RNA (Boehringer Mannheim, Mannheim, Germany) per sample were directly added to the virus lysis buffer as an internal control to check that plasma specimens with undetectable HIV-1 RNA levels were suitable for the RT-PCR. The RT step was performed by using Ready-to-Go You-Prime first-strand cDNA synthesis beads (Pharmacia, Uppsala, Sweden), which contain all reaction components except for template RNA and primer. Each bead was reconstituted with 16ml of DEPC-treated water containing 6 pmol of the HIV-1-specific RT primer LR62 and 3 pmol of the TMV-specific RT primer TMV1 (59-CATCTTTAGTTGTAGATA AGTTTTTTG-39). Template RNA was transferred from a heat block (75°C) to a cryobox (0°C), and 20ml was immediately added to the appropriate tube for RT (30 min at 37°C, followed by 5 min at 94°C to inactivate the enzyme). Each RT run included a blank sample. Following completion of the RT step, four 8-ml aliquots of the RT mixture were used as PCR templates in the presence of increasing amounts (40, 240, 1,440, and 8,640 copies of RNA equivalents) of the competitor T52-LR62 DNA fragment. The amplification reaction mixtures (50

ml) were prepared in a 96-well PCR plate (Corning Costar Corp., Cambridge, Mass.) and contained 50 mM KCl, 10 mM Tris-HCl (pH 8.6), 1.5 mM MgCl2, 0.1% Triton X-100, 100mM each dATP, dCTP, dGTP, and UTP, 10 pmol of the primer pair LR52-LR62, an additive for direct gel loading (240mg of tartrazine

per ml, 1.5% Ficoll 400) (modified from reference 26), 0.15 U of thermolabile uracyl-N-glycosylase (HK-UNG; Epicentre Technologies, Madison, Wis.), and 1 U ofTaqDNA polymerase (Promega). A solid wax layer (DynaWax; Fyn-nzymes, Espoo, Finland) was used to separate the key reaction components (Taq and primers), providing a synchronous hot start. Each plate allowed competitive quantitation of 23 samples containing cDNA and 1 blank control sample. A Hybaid Touchdown thermal cycler was used with the simulated-tube tempera-ture control algorithm to perform the following program: 30 min at 37°C (UNG-mediated inactivation of possible contaminating U-containing DNA), 15 min at 85°C, and 4 min at 94°C (irreversible inactivation of UNG and first denaturation) and then 44 cycles of annealing at 56°C for 20 s, extension at 72°C for 30 s plus a 3-s increment per cycle, and denaturation at 93°C for 20 s. Ten microliters of the reaction mixtures was then directly loaded onto a 2.4% NuSieve–0.6% Seakem (FMC, Rockland, Maine) agarose gel. Two 12-sample series of products were loaded consecutively with a 10-min delay in order to accommodate the reaction products of a whole plate in two two-comb, 24-well minigels. The gel photograph was digitized with a Hewlett-Packard Scanjet as a 256-level grayscale image in the gel analysis software SigmaGel (Jandel Scientific, Erkrath, Germa-ny). The log of the ratio between the intensity of the competitor band (corrected for the shorter length [in base pairs]) and that of the wt band was plotted against the log of the number of copies of competing DNA added, and linear regression was used to calculate the wt DNA copy number at the equivalence between the corrected competitor and wt band intensities (Fig. 2) (27). Testing of samples containing very low (,1,000 copies/ml) or very high (.750,000 copies/ml) num-bers of HIV-1 RNA copies per milliliter could be performed by calculation of the ratio between the amounts of the competitor and the wt PCR products in the first or last lane only, respectively. The results were normalized as the number of HIV-1 RNAcopiespermilliliter.TheefficiencyofRNAextractionandRTforsamplesyield-ing no wt HIV-1 amplification product was controlled retrospectively by subject-ing the residual cDNA (about 2ml) to a 40-cycle single-round amplification with TMV primers TMV1 and TMV2 (59-TGGTCTTTCTATGCCCTTGTTTC-39). These primers amplify a 564-bp region of the TMV genome (GenBank accession no. V01408).

Specificity, sensitivity, reproducibility, and comparative analysis.The

[image:2.612.352.509.75.282.2]

speci-ficities of the RT and PCR primers were preliminarily checked by testing 50 HIV-1-negative and 50 HIV-1-positive plasma samples in a qualitative RT-PCR (i.e., in a single tube in the absence of competitor DNA). The threshold of sensitivity of the method was determined by testing reconstructed plasma sam-ples containing 1,500 to 100 copies of HIV-1 RNA per ml, with tests conducted eight times to examine the performance at the lower limit of 400, 250, and 100 copies/ml. To determine the intertest coefficient of variation (CV) of the whole assay from RNA extraction to data analysis, 12 plasma samples were divided into four aliquots on receipt and were frozen at270°C. The different aliquots of these TABLE 1. Sequences and locations of the primers used for

construction of the HIV-1 DNA competitor and in the RT-cPCR assay

Primera Sequence (59-39) Positionb

T52 (1) CTATCAATACATGGATGATTTGTATGT

ATGTGAGGAGCTGAGACAACATCTc 3163–3182

LR52 (1) CTATCAATACATGGATGATTTGTATGT 3096–3122 LR62 (2) TTCTGTATGTCATTGACAGTCCAGCT 3307–3332

a(1) and (2), sense and antisense, respectively.

[image:2.612.57.290.540.666.2]

bCoordinates are from HIV-1 isolate SF2 (GenBank accession no. KO2007). cThe 27-base 59tail (underlined) hybridizes to positions 3096 to 3122.

FIG. 1. Relative location of HIV-1-specific primers on the HIV-1polgene (thick lines). Sense and antisense HIV-1 DNA strands are labeled (1) and (2), respectively. Note that since the sequence of the 59tail of primer T52 is identical to that of primer LR52, PCR products obtained with primer pair LR52-LR62 and with primer pair T52-LR62 differ in length but are delimited by the same sequences at the 59end (LR52) and the 39end (LR62). Primers, target DNA, and PCR products are not drawn to scale.

FIG. 2. Quantitation of a wt HIV-1 RNA standard by RT-cPCR. HIV-1 RNA (5,000 nominal copies) was reverse transcribed with primer LR62. The reaction mixture was split into four aliquots and subjected to amplification with primers LR52 and LR62 in the presence of 40, 240, 1,440, and 8,640 RNA equivalents (eq.) of the competitor (comp) T52-LR62 DNA. The wt target copy number was estimated by plotting the log ratio between wt and competitor intensities (intens) (after correction for the difference in base pairs) versus the log number of competitor target copies. The result for this control experiment is 1,3753455,500 copies.

on May 15, 2020 by guest

http://jcm.asm.org/

(3)

samples were then tested in four totally independent runs. To examine whether repeated freezing-thawing of the RNA obtained by spin column purification affects the quantitative in-house assay, a panel of 50 plasma samples was tested twice with the first and second 20-ml aliquots of the same RNA preparation after one and two freezing-thawing cycles, respectively. To compare the in-house assay with commercial reference tests, another panel of 45 plasma samples containing undetectable to high titers of HIV-1 RNA, as measured by the in-house RT-cPCR procedure, were blindly tested by the Roche AMPLICOR HIV-1 MONITOR test.

AMPLICOR HIV-1 MONITOR test.The Roche AMPLICOR HIV-1

MON-ITOR test was performed by following the manufacturer’s instructions (20). This procedure involves (i) treatment of plasma with guanidinium isothiocyanate and precipitation of RNA with isopropanol, (ii) single-step rTthDNA polymerase-mediated RT-PCR with biotinylated primers SK431 and SK462 (gagregion) in the presence of one internal competitor RNA (quantification standard [QS]), (iii) separate hybridization of fivefold serial dilutions of the HIV-1 and QS amplification products in specific probe-coated microtiter wells, (iv) enzyme-linked colorimetric detection of amplification products, and (v) calculation of the number of HIV-1 RNA copies on the basis of the optical densities of one QS-containing well and one HIV-1-containing well within a defined range, the dilution factors in the selected wells, and a correction factor given by the man-ufacturer. The test is carried out in 0.2-ml tubes (RT-PCR) and 12-sample microtiter plates (colorimetric detection) and is expected to be completed in 6 to 7 h.

Clinical samples.The HIV-1 RNA in a total of 1,982 plasma samples obtained

from 720 patients attending different infectious diseases units was quantitated by the in-house RT-cPCR system. Most patients were under treatment with com-bination therapies that included protease inhibitors. In order to check the capa-bility of the in-house RT-cPCR to detect decreases in HIV-1 RNA load, 72 paired samples were obtained from 36 patients (all of whom had been pretreated with reverse transcriptase inhibitors) at week 0 and 4 with respect to the time of initiation of saquinavir (n512), indinavir (n512), and ritonavir (n512) therapy.

RESULTS

Preliminary testing of 50 negative and 50 HIV-1-positive plasma samples by a qualitative RT-PCR showed that primers LR52 and LR62 specifically amplify the expected 237-bp region of the HIV-1polgene. Initial studies were then aimed at defining the yield and the reproducibility of the first noncompetitive steps, i.e., RNA extraction with dedicated spin columns and RT with ready-to-use beads. Triplicate titration of reconstructed plasma samples containing 103to 106copies

of the wt HIV-1 RNA standard indicated that the ratio be-tween the plasma HIV-1 RNA and the cDNA levels obtained after RNA extraction and RT is fairly constant over the range of numbers of copies considered. Indeed, the mean propor-tions of HIV-1 RNA copies extracted from plasma and reverse transcribed into cDNA were 35, 43, 37, and 46% for samples containing 103, 104, 105, and 106HIV-1 RNA copies per ml,

respectively. This yielded the conversion of an average of 40% 6 5% of the plasma HIV-1 RNA into cDNA and defined a correction factor of 2.5 for adjustment of the actual number of copies of competitor DNA to RNA equivalents, i.e., the num-bers of cDNA copies resulting from extraction and RT of equal numbers of RNA copies in plasma.

Quadruplicate testing of a 12-sample panel in four totally independent assays allowed determination of a mean CV of 41.9%, with a tendency to obtain larger CVs for lower-titer samples (Table 2). The lower limit of sensitivity of the method was then assessed with an accurately titrated plasma sample diluted with HIV-1-negative plasma. When plasma samples with decreasing amounts of RNA equivalent to 1,500, 1,000, 500, and 250 HIV-1 RNA copies per ml were tested, the in-house RT-cPCR assay calculated 1,391, 924, 333, and 202 copies, respectively. However, the wt PCR product could not be detected in none of eight and only three of eight samples with 100 and 250 nominal HIV-1 RNA copies per ml, respec-tively. Since replicate tests of eight samples nominally contain-ing 400 HIV-1 RNA copies per ml consistently resulted in a measurable wt amplification signal, plasma samples yielding no

amplification signal were considered to contain,400 copies/ ml. A separate set of experiments demonstrated that inclusion of the TMV control primer in the RT step did not influence either the sensitivity or the performance of the assay (data not shown).

The results obtained in parallel tests of 45 samples by the in-house assay and the AMPLICOR HIV-1 MONITOR test were in good agreement (Table 3). HIV-1 RNA was undetect-able by both assays in the same seven samples, and there was a good correlation for the 38 samples in which HIV-1 viremia was detectable (r50.86;P,1029; Spearman’s correlation).

The mean6standard deviation difference was 0.3660.25 log unit, and there was no tendency for each test to give values higher than the values given by the other test. The results were different within a maximum of twofold (0.3 log unit) and four-fold (0.6 log unit) for 17 (44.7%) and 28 (73.7%) of these 38 samples, respectively. No result differed by.1 log unit; the largest difference between the AMPLICOR HIV-1 MONI-TOR test and the in-house assay (10.96 log unit) was found for sample 7, which was obtained from a subject under triple-combination therapy with zidovudine, lamivudine, and indina-vir. However, six of the seven samples in which HIV-1 RNA was undetectable by both tests and another five samples with comparable low levels of HIV-1 RNA (samples 20, 26, 32, 35, and 36) were also obtained from subjects receiving triple-com-bination therapy. Analysis of the second 20-ml RNA aliquot of the same sample (sample 7) by RT-cPCR confirmed the result obtained previously (32,000 copies/ml), while no residual plasma was available for retesting by the AMPLICOR HIV-1 MONITOR test. A new sample obtained from the same pa-tient 1 month later in the absence of changes in antiretroviral therapy was then tested by RT-cPCR and AMPLICOR HIV-1 MONITOR, and both tests yielded comparable results (43,000 and 39,000 copies/ml, respectively). While this indicated that the different result first obtained by the two assays was not related to a particular virus strain, it was not possible to de-termine the nature of the occasional factor accounting for the discrepancy.

[image:3.612.310.552.92.242.2]

Since the amount of each RNA preparation obtained from plasma was sufficient for two quantitative RT-cPCR tests, we checked whether comparable results could be obtained by us-ing the amount of RNA remainus-ing after the first assay (i.e., after a second freezing-thawing). When 50 RNA samples first shown to contain 3,300 to 575,310 copies per ml of plasma were retested, the results from the first and second titrations were in

TABLE 2. Reproducibility of the in-house RT-cPCR assay in quadruplicate independent tests with 12 plasma samples

Sample No. of HIV-1 RNA copies/ml CV (%) Run 1 Run 2 Run 3 Run 4 Mean6SD

A 557,112 230,106 569,786 388,902 436,4776160,392 36.7 B 446,999 289,507 251,802 232,878 305,297697,357 31.9 C 138,086 111,417 72,225 185,099 126,707647,403 37.4 D 100,166 63,700 102,844 148,838 103,887634,883 33.6 E 33,783 73,995 69,873 43,384 55,259619,722 35.7 F 43,528 21,814 27,068 58,193 37,651616,526 43.9 G 30,813 45,036 43,885 20,125 34,965611,810 33.8 H 20,567 8,397 13,253 7,351 12,39266,026 48.6 I 4,300 9,473 8,499 3,210 6,37163,079 48.3 L 3,300 5,527 4,000 1,110 3,48461,836 52.7 M NDa 640 1,530 ND 1,0856629 58.0

N ND ND ND ND NAb NA

Mean6SD 41.968.9

aND, not detectable. bNA, not applicable.

on May 15, 2020 by guest

http://jcm.asm.org/

(4)

excellent agreement, differing by,0.3 and,0.6 log unit for 42 (84%) and 50 (100%) samples, respectively. The mean6SD difference was 0.2560.18 log unit, and there was no tendency for the second experiment to yield lower copy numbers than the first experiment (data not shown).

In-house RT-cPCR of 1,982 plasma samples did not produce wt amplification products for 188 (9.5%) samples (number of HIV-1 RNA copies,,400/ml). The standard yield from RNA extraction and RT for these samples was confirmed by success-ful amplification of the TMV control sequence with residual cDNA. Of the remaining 1,794 samples, the quantities of HIV-1 RNA in 501 (27.9%), 791 (44.1%), and 341 (19.0%)

samples were determined by reading the ratio between the amounts of wt and competitor PCR products in four, three, and two lanes, respectively (Fig. 3). A single reading in the first or last lane was available for a total of 161 (9.0%) samples with exceedingly low (,1,000 copies/ml) or high (.750,000 copies/ ml) HIV-1 RNA titers, respectively. The mean coefficients of correlation (R2) for the regression lines generated by

measure-ment ratios for four and three lanes were 0.972 and 0.967, respectively. There was a significant inverse correlation be-tween HIV-1 RNA titers and CD4 counts for the whole pop-ulation analyzed (r 5 20.22;P, 1027; Spearman’s

[image:4.612.320.544.72.142.2]

correla-tion) (Fig. 4). However, when samples were stratified on the basis of CD4 counts, HIV-1 RNA titers spanned at least two orders of magnitude in all groups. To check the capability of the in-house RT-cPCR to monitor decreases in HIV-1 viremia following effective antiretroviral therapy, 72 paired plasma samples obtained from 36 patients at week 0 and 4 with respect to the time of initiation of saquinavir (n512), indinavir (n5 12), or ritonavir (n512) therapy were analyzed. The baseline HIV-1 RNA titers in the plasma of the three groups examined were not different (mean values, 210,092, 207,970, and 194,555 copies/ml, respectively). This analysis showed a significant de-crease in HIV-1 RNA levels in the whole population (P , TABLE 3. Parallel testing of 45 plasma samples by using the

in-house RT-cPCR assay and the AMPLICOR HIV-1 MONITOR test

Sample

No. of HIV-1 RNA copies/ml

CV (%) differenceLog AMPLICOR RT-cPCRIn-house

1 750,000 830,000 7.16 20.04

2 500,000 650,000 18.45 20.11

3 380,000 660,000 38.07 20.24

4 320,000 140,000 55.34 10.36

5 310,000 360,000 10.55 20.06

6 250,000 81,000 72.21 10.49

7 200,000 22,000 113.39 10.96

8 120,000 120,000 0.00 10.00

9 100,000 87,000 9.83 10.06

10 100,000 77,000 18.38 10.11

11 90,000 240,000 64.28 20.43

12 85,000 37,000 55.64 10.36

13 60,000 12,000 94.28 10.70

14 42,000 130,000 72.36 20.49

15 40,000 84,000 50.18 20.32

16 30,000 6,700 89.79 10.65

17 29,000 6,000 92.93 10.68

18 20,000 9,300 51.65 10.33

19 20,000 5,600 79.55 10.55

20 19,000 7,600 60.61 10.40

21 18,000 4,000 90.00 10.65

22 15,000 26,000 37.94 20.24

23 10,000 47,000 91.80 20.67

24 10,000 44,000 89.04 20.64

25 9,500 46,000 93.01 20.69

26 8,000 6,000 20.20 10.12

27 6,300 6,500 2.21 20.01

28 4,300 21,000 93.35 20.69

29 4,200 17,000 85.39 20.61

30 3,100 5,000 33.17 20.21

31 3,000 2,300 18.68 10.12

32 2,200 800 66.00 10.44

33 2,100 4,200 47.14 20.30

34 2,100 2,400 9.43 20.06

35 1,600 3,100 45.13 20.29

36 1,300 860 28.81 10.18

37 1,000 2,600 62.85 20.41

38 700 1,000 24.96 20.15

39 ,400 ,400 NAa NA

40 ,400 ,400 NA NA

41 ,400 ,400 NA NA

42 ,400 ,400 NA NA

43 ,400 ,400 NA NA

44 ,400 ,400 NA NA

45 ,400 ,400 NA NA

Mean6SD 52.47632.33 0.0160.44

[image:4.612.52.293.101.569.2]

aNA, not applicable.

FIG. 3. Representative quantitative analysis of plasma HIV-1 RNA by the in-house RT-cPCR assay. Competitive amplification products obtained from six clinical samples were loaded as subsequent three-sample series on the same gel with a 10-min delay. Each cDNA was amplified in the presence of 40, 240, 1,440, and 8,640 competitor RNA equivalents. wt and comp, the amplification products generated from wt and competitor templates, respectively. Data analysis for the samples indicated the following numbers of HIV-1 RNA copies per milliliter: 100,166 for sample 1, 138,086 for sample 2, 4,300 for sample 3, 546,999 for sample 4, 30,567 for sample 5, and 33,703 for sample 6.

FIG. 4. Scatter plot showing the correlation between HIV-1 RNA levels and CD4 counts in the population whose plasma samples were analyzed by the in-house RT-cPCR assay. Samples with undetectable HIV-1 RNA levels (,400 copies/ml) are shown as containing 200 copies/ml.

on May 15, 2020 by guest

http://jcm.asm.org/

[image:4.612.332.528.499.695.2]
(5)

0.0001; Wilcoxon’s signed rank test) as well as in each of the separate arms treated with saquinavir (P50.0210), indinavir (P50.0047), and ritonavir (P,0.0001) (Fig. 5). However, the mean decrease in the saquinavir group (0.914 log unit) was markedly lower than those in the indinavir (1.584 log units) and ritonavir (1.904 log units) groups.

DISCUSSION

The in-house HIV-1 RNA quantitation procedure described here was directly adapted from a cPCR system previously used for the titration of DNA targets (28). Although presently re-placed by the measurement of HIV-1 RNA levels, robust cPCR procedures were initially developed for the quantitation of HIV-1 DNA by several investigators (7, 8, 13, 15). While the routine clinical use of homemade RNA competitors may pose problems in terms of titration and long-term storage, DNA competitors can be easily and reliably titrated and stored in-definitely (3). Thus, a practical and reliable competitive DNA PCR system can be conveniently used to quantitate HIV-1 RNA, provided that reproducible methods are used for plasma RNA extraction and RT. Effective procedures for both RNA extraction and RT have been assembled in the laboratory and have previously been reported as preliminary steps in success-ful in-house RT-cPCR assays (16, 17). Commercial RNA spin columns have successfully been evaluated as a means of ex-traction of RNA from plasma for clinical diagnosis (12, 24). It must be remembered that heparin should not be used as an anticoagulant for blood samples that are to be processed with spin columns, since treatment of the eluate with heparinase may be then required to achieve optimal RT and PCR (12). The use of a commercial ready-to-use system is generally ad-visable to avoid a number of operator-dependent variables and to increase the uniformity of the reagents, resulting in im-proved reproducibility. In our hands, commercial RNA spin columns and ready-to-use RT beads proved to fulfill this re-quirement, resulting in a fairly constant rate of generation of cDNA from the RNA in plasma.

Once the noncompetitive RNA extraction and RT steps have been firmly standardized, there is the need to calculate the rate of cDNA production from plasma RNA. Construction and accurate quantitation of an RNA standard and measure-ment of the cDNA generated may provide a direct calculation of such a rate. Alternatively, a practical method for estimating the yield from RNA extraction and RT is to test a panel of samples whose HIV-1 RNA titers have been quantitated with

a reference commercial kit and adjust empirically the amounts of competitor DNA in order to obtain the same HIV-1 RNA titers. We have been successful with this simple approach when we used a second pair of primers and the appropriate deleted competitor DNA (data not shown).

Comparison with a reference commercial assay is strongly recommended as part of an evaluation of any in-house proce-dure. The intertest CV calculated for the in-house assays (41.9%) was almost identical to that reported for the Roche AMPLICOR HIV-1 MONITOR test (23). Parallel testing of a panel of plasma samples indicated that the results obtained by the in-house assay and the commercial AMPLICOR HIV-1 MONITOR test are in good agreement. The differences be-tween the two procedures were comparable to those reported in comparative studies of licensed commercial kits (5, 20, 23), and HIV-1 RNA was undetectable in the same set of samples, confirming that the two systems have similar thresholds of sensitivity. Preliminary data suggest that use of the whole RT mixture as the template for a one-tube cPCR in the in-house assay may allow quantitation of samples containing as few as 80 copies/ml, although with a larger intertest variability (70%, as calculated by quintuplicate tests with a reconstructed plasma sample; data not shown). This is similar to what has been recently reported with the new ultrasensitive commercial as-says (4, 11, 18, 22) and may be of relevance in light of the need for the monitoring of HIV-1-infected patients whose plasma HIV-1 RNA titer is low. Since the RNA extraction protocol yields material sufficient and suitable for two RTs, a sample with RNA levels below the threshold of 400 copies/ml could be directly retested by using the whole cDNA in a second one-tube cPCR, avoiding the need for a new RNA extraction. A more attractive target is a single system that allows the quan-titation of exceedingly low and high HIV-1 RNA levels over a large dynamic range, obviating the need to use an ultrasensi-tive assay as a second-line test after a negaultrasensi-tive standard test. Primer labels that increase the sensitivity of the detection phase and procedures for concentration of the RNA in plasma are being investigated in this context.

A clinical field evaluation of the in-house system was carried out by testing a total of 1,982 plasma samples. The HIV-1 RNA levels obtained are in the same range as those commonly reported by reference tests (5, 20, 23). An inverse correlation between CD4 counts and HIV-1 RNA levels with a wide scat-tering of values was found, in agreement with observations previously obtained by licensed assays (10, 15). Finally, short-term follow-up of the HIV-1 load in patients who were shifted to protease inhibitor therapy demonstrated the capability of the in-house system to monitor antiretroviral treatment in vivo. The extents of the decreases in HIV-1 RNA levels obtained as a result of saquinavir, ritonavir, and indinavir therapy were in agreement with previously reported data (2, 6, 21).

[image:5.612.54.292.72.192.2]

A reliable in-house assay must also be practical in order to be used as a routine means of clinical monitoring. In the in-house procedure described here, RNA extraction and RT are simple to perform and PCR is carried out in a microtiter plate, allowing the convenient use of multichannel pipettes during both preparation and analysis. Hot start of amplifica-tion is easily accomplished by multichannel dispensing of wax kept liquid on a heat block inside the laminar flow hood under which the PCR mixture is prepared. An engineered thermo-labile UNG is absolutely effective in protecting from carryover without interfering with the generation of PCR products after irreversible inactivation. Notably, multiple ready-to-use plates containing all reagents except cDNA can be stored at 4°C and successfully used up to 2 weeks later, saving most of the time required for each RT-cPCR run. Inclusion of an additive for

FIG. 5. Effect of saquinavir, ritonavir, and indinavir therapy on HIV-1 RNA load in three groups of 12 patients as measured by the in-house RT-cPCR assay. Each line represents a different subject. Weeks refer to the time from the initiation of protease inhibitor therapy. For graphical representation and statis-tical analysis, samples with,400 HIV-1 RNA copies/ml are considered to con-tain 200 copies/ml.

on May 15, 2020 by guest

http://jcm.asm.org/

(6)

gel loading (tartrazine-Ficoll) directly in the PCR mixture also significantly speeds the analytic phase. The reaction mixtures are indeed directly loaded with a multichannel pipette and only two two-comb agarose gels are used. Measurement of band intensity requires only a 256-level grayscale optical scanner and minimal densitometric analysis software. Data analysis can be conveniently automated with simple macro commands in pop-ular spreadsheets such as MS Excel, version 5.0 or higher (Microsoft Corp., Redmond, Wash.). The time required to complete a test run is 7 to 8 h, less than 40% of which is hands-on time. In our experience, a single operator may well be capable of measuring the HIV-1 RNA levels in 100 samples per week. This figure can be actually doubled provided that two microcentrifuges and two thermal cyclers are available for RNA extraction and amplification, respectively. An interlabo-ratory evaluation of the system is in progress.

Assays for the routine medium-scale monitoring of HIV-1 RNA levels in HIV-1-infected subjects should be reliable, practical, and cost-effective. The in-house assay described here is simple to develop and has been shown to be reliable both in reconstruction experiments and for the clinical use in the field. Although not presently available as a complete kit, none of the steps of the procedure requires complex equipment, and all steps can be rapidly learned and routinely used by ordinary laboratory operators. The cost is less than $10 per sample, including the costs for both reagents and disposable supplies. This figure compares with the $60 to $100 per sample required by currently licensed commercial kits. Notably, the cost initially required for additional equipment for data analysis (scanner and densitometric software) translates into only a,10% cost increase for the first 1,000 samples analyzed. This and other in-house systems for the measurement of plasma HIV-1 RNA levels may thus be relevant for increasing both the numbers of subjects analyzed and the frequency of analysis, at least until a significant reduction of the costs of reference methods can be achieved.

ACKNOWLEDGMENTS

This study was supported by Progetto AIDS, Istituto Superiore di Sanita`, Ministero della Sanita` (9402-15), Rome, Italy. M. Catucci, G. Venturi, and A. De Milito are recipients of AIDS fellowships from the Istituto Superiore di Sanita`, Ministero della Sanita`.

REFERENCES

1.Bagnarelli, P., S. Menzo, A. Valenza, S. Paolucci, S. Petroni, G. Scalise, R.

Sampaolesi, A. Manzin, P. E. Varaldo, and M. Clementi.1995. Quantitative

molecular monitoring of human immunodeficiency virus type 1 activity dur-ing therapy with specific antiretroviral compounds. J. Clin. Microbiol.33:

16–23.

2.Bisset, L. R., M. Rothen, H. I. Joller-Jemelka, R. W. Dubs, P. J. Grob, and

M. Opravil.1997. Change in circulating levels of the chemokines

macro-phage inflammatory proteins 1 alpha and 11 beta, RANTES, monocyte chemotactic protein-1 and interleukin-16 following treatment of severely immunodeficient HIV-infected individuals with indinavir. AIDS11:485–491.

3.Clementi, M., S. Menzo, P. Bagnarelli, A. Manzin, A. Valenza, and P. E.

Varaldo.1993. Quantitative PCR and RT-PCR in virology. PCR Methods

Appl.2:191–196.

4.Collins, M. L., B. Irvine, D. Tyner, E. Fine, C. Zayati, C. Chang, T. Horn, D.

Ahle, J. Detmer, L. P. Shen, J. Kolberg, S. Bushnell, M. S. Urdea, and D. D. Ho.1997. A branched DNA signal amplification assay for quantification of nucleic acid targets below 100 molecules/ml. Nucleic Acids Res.25:2979– 2984.

5.Coste, J., B. Montes, J. Reynes, M. Peeters, C. Segarra, J. P. Vendrell, E.

Delaporte, and M. Segondy.1996. Comparative evaluation of three assays

for the quantitation of human immunodeficiency virus type 1 RNA in plasma. J. Med. Virol.50:293–302.

6.Danner, S. A., A. Carr, J. M. Leonard, L. M. Lehman, F. Gudiol, J. Gonzales,

A. Raventos, R. Rubio, E. Bouza, and V. Pintado.1995. A short-term study

of the safety, pharmacokinetics, and efficacy of ritonavir, an inhibitor of HIV-1 protease. N. Engl. J. Med.333:1528–1533.

7.Ferre, F., A. L. Marchese, S. L. Griffin, A. E. Daigle, S. P. Richieri, F. C.

Jensen, and D. J. Carlo.1993. Development and validation of a polymerase

chain reaction method for the precise quantitation of HIV-1 DNA in blood cells from subjects undergoing a 1-year immunotherapeutic treatment. AIDS

7:s21–s27.

8.Gupta, P., M. Ding, M. Cottrill, C. Rinaldo, L. Kingsley, S. Wolinsky, and J.

Mellors.1995. Quantitation of human immunodeficiency virus type 1 DNA

and RNA by a novel internally controlled PCR assay. J. Clin. Microbiol.33:

1670–1673.

9.Hammer, S. M.1996. Advances in antiretroviral therapy and viral load

monitoring. AIDS10:s1–s11.

10. Katzenstein, D. A., S. M. Hammer, M. D. Hughes, H. Gundacker, J. B.

Jackson, S. Fiscus, S. Rasheed, T. Elbeik, R. Reichman, A. Japour, T. C.

Merigan, and M. S. Hirsch.1996. The relation of virologic and immunologic

markers to clinical outcomes after nucleoside therapy in HIV-infected adults with 200 to 500 CD4 cells per cubic millimeter. N. Engl. J. Med.335:

1091–1098.

11. Kern, D., M. Collins, T. Fultz, J. Detmer, S. Hamren, J. J. Peterkin, P.

Sheridan, M. Urdea, R. White, T. Yeghiazarian, and J. Todd.1996. An

enhanced-sensitivity branched-DNA assay for quantification of human im-munodeficiency virus type 1 RNA in plasma. J. Clin. Microbiol.34:3196– 3202.

12. Lin, H. J., T. Tanwandee, and F. B. Hollinger.1997. Improved methods for

quantification of human immunodeficiency virus type 1 RNA and hepatitis C virus RNA in blood using spin column technology and chemiluminescent assays of PCR products. J. Med. Virol.51:56–63.

13.Mallet, F., C. Hebrard, J. M. Livrozet, O. Lees, F. Tron, J. L. Touraine, and

B. Mandrand.1995. Quantitation of human immunodeficiency virus type 1

DNA by two PCR procedures coupled with enzyme-linked oligosorbent assay. J. Clin. Microbiol.33:3201–3208.

14. Mellors, J. W., A. Munoz, J. V. Giorgi, J. B. Margolick, C. J. Tassoni, P.

Gupta, L. A. Kingsley, J. A. Todd, A. J. Saah, R. Detels, J. P. Phair, and C. R.

Rinaldo, Jr.1997. Plasma viral load and CD41lymphocytes as prognostic

markers of HIV-1 infection. Ann. Intern. Med.126:946–954.

15. Mellors, J. W., C. R. Rinaldo, Jr., P. Gupta, R. M. White, J. A. Todd, and

L. A. Kingsley.1996. Prognosis in HIV-1 infection predicted by the quantity

of virus in plasma. Science272:1167–1170.

16. Michael, N. L., T. Mo, A. Merzouki, M. O’Shaughnessy, C. Oster, D. S.

Burke, R. R. Redfield, D. L. Birx, and S. A. Cassol.1995. Human

immuno-deficiency virus type 1 cellular RNA load and splicing patterns predict disease progression in a longitudinally studied cohort. J. Virol.69:1868–1877.

17. Mitra, D., and J. Laurence.1997. Quantitative RT-PCR for human Fas

(CD95) expression. BioTechniques22:442–446.

18. Mulder, J., R. Resnick, B. Saget, S. Scheibel, S. Herman, H. Payne, R.

Harrigan, and S. A. Kwok.1997. A rapid and simple method for extracting

human immunodeficiency virus type 1 RNA from plasma: enhanced sensi-tivity. J. Clin. Microbiol.35:1278–1280.

19. Piatak, M., Jr., K. C. Luk, B. Williams, and J. D. Lifson.1993. Quantitative

competitive polymerase chain reaction for accurate quantitation of HIV DNA and RNA species. BioTechniques14:70–81.

20. Revets, H.1, D. Marissens, S. de Wit, P. Lacor, N. Clumeck, S. Lauwers, and

G. Zissis.1996. Comparative evaluation of NASBA HIV-1 RNA QT,

AM-PLICOR-HIV monitor, and QUANTIPLEX HIV RNA assay, three meth-ods for quantification of human immunodeficiency virus type 1 RNA in plasma. J. Clin. Microbiol.34:1058–1064.

21. Schapiro, J. M., M. A. Winters, F. Stewart, B. Efron, J. Norris, M. J. Kozal,

and T. C. Merigan.1996. The effect of high-dose saquinavir on viral load and

CD41T-cell counts in HIV-infected patients. Ann. Intern. Med.124:1039–

1050.

22.Schockmel, G. A., S. Yerly, and L. Perrin.1997. Detection of low HIV-1

RNA levels in plasma. J. Acquired Immune Defic. Syndr. Hum. Retrovirol.

14:179–183.

23.Schuurman, R., D. Descamps, G. J. Weverling, S. Kaye, J. Tijnagel, L.

Williams, R. van Leeuwen, R. Tedder, C. A. Boucher, F. Brun-Vezinet, and

C. Loveday.1996. Multicenter comparison of three commercial methods for

quantification of human immunodeficiency virus type 1 RNA in plasma. J. Clin. Microbiol.34:3016–3022.

24.Shafer, R. W., D. J. Levee, M. A. Winters, K. L. Richmond, D. Huang, and

T. C. Merigan.1997. Comparison of QIAamp HCV kit spin columns, silica

beads, and phenol-chloroform for recovering human immunodeficiency virus type 1 RNA from plasma. J. Clin. Microbiol.35:520–522.

25. Trabaud, M. A., G. Audoly, K. Leriche, L. Cotte, J. Ritter, M. Sepetjan, and

C. Trepo.1997. Development of a reverse transcriptase PCR-enzyme-linked

immunosorbent assay for quantification of human immunodeficiency virus type 1 RNA in plasma: comparison with commercial quantitative assays. J. Clin. Microbiol.35:1251–1254.

26. Wittwer, C. T., and D. J. Garling.1991. Rapid cycle DNA amplification: time

and temperature optimization. BioTecheniques10:76–83.

27. Zazzi, M., M. Catucci, A. De Milito, L. Romano, G. Venturi, P. Almi, A.

Gonnelli, M. Rubino, and P. E. Valensin.1996. Zidovudine resistance

mu-tations and human immunodeficiency virus type 1 DNA burden: longitudinal evaluation of six patients under treatment. Infection24:419–425.

on May 15, 2020 by guest

http://jcm.asm.org/

Figure

TABLE 1. Sequences and locations of the primers used forconstruction of the HIV-1 DNA competitor andin the RT-cPCR assay
TABLE 2. Reproducibility of the in-house RT-cPCR assay inquadruplicate independent tests with 12 plasma samples
TABLE 3. Parallel testing of 45 plasma samples by using thein-house RT-cPCR assay and the AMPLICORHIV-1 MONITOR test
FIG. 5. Effect of saquinavir, ritonavir, and indinavir therapy on HIV-1 RNAload in three groups of 12 patients as measured by the in-house RT-cPCR assay.

References

Related documents

However, anti-Semitism and Islam phobia are both specific forms of discrimination and racism in which attitudes; behavior, institutional patterns and policies reject, exclude,

It is clearly observed from the performance evaluation that the curvelet based approach for retinal blood vessel analysis provides significant results when compared with other

The approach as presented is able to find and classify common conducting gestures (as described by [Rudolf, 1950]) which are continuously performed by the user with his or her arm.

In relation to the diameter of lettuce head, when uti- lized soil cover could be observed a different behavior among organic fertilizer sources and poultry manure had higher

Mazumder (2001) notes that income may be a less noisy measure of economic status than earnings, therefore using income rather than earnings may give a more accurate picture

This study examined the psychological status of Japanese ambulatory patients with primary breast cancer, with a focus on evaluating the impact of the patients’ self-repressive

Knowing load mathematical models, it is possible to obtain a model of a group of loads by simply adding the single models, that is, the procedure used for linear loads

Anatomical characters which are significant for species delimitation include: the presence/absence of sclerenchyma cells associated with the xylem in the midrib; presence/ absence