• No results found

Test 1 2010

N/A
N/A
Protected

Academic year: 2020

Share "Test 1 2010"

Copied!
5
0
0

Loading.... (view fulltext now)

Full text

(1)

Test 1 2010

1. Indicate the ionic species that predominate at pH 4.91 I: Succinate(-1) II: Succinic acid III: CO3(-2) IV: Succinate(-2) V: HCO3(-) VI: H2CO3 8 0.028 a) I & IV

13 0.046 b) II & III 4 0.014 c) III & IV 253 0.897 d) I & VI## 4 0.014 e) III & VI

2. Indicate the ionic species that predominate at pH 8 I: Succinate(-2) II: Succinate(-1) III: Succinic acid IV: H2CO3 V: HCO3(-) VI: CO3(-2) 24 0.085 a) I & IV

1 0.004 b) II & III 4 0.014 c) III & V 250 0.887 d) I & V## 3 0.011 e) III & VI

3. The volume of a solution of 0.5 M NaOH that must be added to adjust the pH from 2.15 to 6.82 in 10 mL of a 100 mM solution of phosphoric acid is:

10 0.035 a) 1 mL 248 0.879 b) 2 mL## 8 0.028 c) 3 mL 9 0.032 d) 4 mL 7 0.025 e) 5 mL

4. The volume of a solution of 0.5 M HCl that must be added to adjust the pH from 9.6 to 2.15 in 10 mL of a 100 mM solution of phosphoric acid is:

4 0.014 a) 1 mL 169 0.599 b) 2 mL 53 0.188 c) 3 mL## 44 0.156 d) 4 mL 12 0.043 e) 5 mL

5. The pH of a 100 mL solution containing 50 mL of 0.1M acetic acid and 4.1g of sodium acetate (formula weight 82g/mol; pK=4.76) is

(2)

6. The amino group of glycine can exist either in the protonated form (-NH3+) or as the free base (-NH2). In order to have 50% of the glycine in its acidic form, what must be the numerical relation be

8 0.028 a) pH-pKa = -2 4 0.014 b) pH-pKa = -1 260 0.922 c) pH-pKa = 0## 7 0.025 d) pH-pKa = 1 2 0.007 e) pH-pKa = 2

7. Which of the following statements are true regarding restriction endonucleases? 21 0.074 a) they are used to cleave DNA and RNA molecules nonspecifically. 0 0.000 b) only form blunt ends

4 0.014 c) only form sticky ends

144 0.511 d) all restriction endonucleases recognize palindromic sequences 112 0.397 e) none of the rest##

8. Which of the following restriction enzymes produce identical sticky ends (see Table 2)? 217 0.770 a) BamHI and BglII##

1 0.004 b) HaeII and TaqI 2 0.007 c) SalI and TaqI

22 0.078 d) All of the answer pairs 39 0.138 e) none of the rest

9. Restriction fragments from which of the following enzymes could be ligated together. The cleavage site is indicated with an apostrophe (').

Enzyme A B C D E

Cleavage site G'AATTC G'TATAC GTATA'C T'TTAAA TTATA'A 10 0.035 a) A and B

5 0.018 b) B and D 105 0.372 c) C and E## 39 0.138 d) D and A

122 0.433 e) none of the above

10. Which of the following DNA sequences is palindromic? 1 0.004 a) 3'-ACTAATGA

264 0.936 b) 3'-ACGATCGT## 0 0.000 c) 3'-CGATTTGC 0 0.000 d) 5'-AGATTACA 17 0.060 e) 5'-AGATTAGA

11. Which of the following primers can amplify the following DNA segment by PCR?

3-'CTGACCAGCGCCTATCGCATATTATAAAGCCTTATGCCATATGGGCCTATGCCTAT 11 0.039 a) 5'ATAGGCATAGGC and 5'TATCCGTATCCG

(3)

205 0.727 d) 5'TATCCGTATCCG AND 5'GACTGGTCGCGG## 21 0.074 e) 5'ATAGGCATAGGC and 5'CCGCGACCAGTC

12. Which of the followings is/are not likely to cause problem in a PCR experiment? 3 0.011 a) both primers are inadvertently omitted from the reaction mixture

4 0.014 b) both primers are complementary to several sites in the starting DNA sample 252 0.894 c) there are single-stranded breaks in one strand of the template DNA molecule## 21 0.074 d) there is a double-stranded break in the template DNA molecule

2 0.007 e) all of the rest are not likely to cause problem

13. Which of the following is not found in RNA? 0 0.000 a) Adenine

0 0.000 b) Guanine 0 0.000 c) Cytosine 15 0.053 d) Uracil 267 0.947 e) Thymine##

14. Which of the following statements is correct?

4 0.014 a) a reaction is said to be spontaneous when it can proceed in either the forward or reverse direction.

1 0.004 b) a spontaneous process always happens very quickly.

13 0.046 c) a spontaneous process can occur only if there is a large increase in entropy. 245 0.869 d) a spontaneous process can proceed spontaneously in the reverse direction with an appropriate change in reaction condition(s).##

19 0.067 e) none of the statements.

15. Which of the following statements is correct regarding buffer strength at pH = 8.1 (MOPS: pK=7.15; Tris:pK=8.08)?

86 0.305 a) MOPS is more effective against acid and Tris is more effective against base 4 0.014 b) MOPS is more effective against base and Tris is more effective against acid 14 0.050 c) MOPS is more effective against both acid and base

173 0.613 d) Tris is more effective against both acid and base## 3 0.011 e) None of the rest

16. Which of the following lists is the best choice of buffers for pH 3.7, 8.1 and 9.3 respectively 268 0.950 a) Formic, Tris and Ammonia##

9 0.032 b) Formic, MES, Tris

3 0.011 c) Succinic, Tris and HEPES 1 0.004 d) Succinic, HEPES and Ammonia

0 0.000 e) HEPES, Phosphoric acid and Ammonia

(4)

has an ionizable carboxyl group (pKa = 3.5). The fraction of aspirin available for absorption in the stomach (if pH=2.5) is

35 0.124 a) 1 /11 237 0.840 b) 10/11## 0 0.000 c) 1/101 9 0.032 d) 100/101 1 0.004 e) 1/1

18. Which of the followings is incorrect when a foreign DNA is being inserted into the XmnI site of pUC18 (refer to Figure 1 for a map of pUC18) and introduced into E. coli cells?

66 0.234 a) Clones transformed with the recombinant plasmid are sensitive to ampicillin 5 0.018 b) Clones transformed with the recombinant plasmid are sensitive to tetracycline 17 0.060 c) Clones transformed with pUC18 are resistant to ampicillin

190 0.674 d) Clones transformed with the recombinant plasmid are not sensitive to ampicillin##

4 0.014 e) all of the rest are correct

19. Which of the following is always true concerning the base composition of nucleic acids? 7 0.025 a) In each single stranded nucleic acid, the number of A = T(U)

1 0.004 b) In each single stranded nucleic acid, the number of A = G 10 0.035 c) In a molecule of double stranded DNA, A + T = C + G

217 0.770 d) In a molecule of double stranded RNA, the number of A + G = C + U## 47 0.167 e) none of the rest

20. When compared to RNA, DNA lacks OH groups on the ______ of the pentoses: 6 0.021 a) 5' carbon

264 0.936 b) 2' carbon## 10 0.035 c) 3' carbon 0 0.000 d) 1' carbon 2 0.007 e) none of the rest

21. Which one of the following processes do bacteria use to protect against restriction endonuclease activity?

1 0.004 a) Hydroxylation 0 0.000 b) Acetylation 281 0.996 c) Methylation## 0 0.000 d) Carboxylation 0 0.000 e) Amination

22. In gel electrophoresis of DNA, smaller fragments travel faster than larger fragments because the smaller fragments

1 0.004 a) are less polar 0 0.000 b) are more charged

(5)

23. DNA pol I can sequentially add deoxynucleotides to the ____ end of polynucleotides. 9 0.032 a) 5'

270 0.957 b) 3'## 1 0.004 c) 2' 0 0.000 d) 1'

2 0.007 e) None of the rest

24. Select the answer that arranges interactions from weakest to strongest: 4 0.014 a) covalent, ionic, hydrogen bonds, van dispersion

270 0.957 b) dispersion, hydrogen bonds, ionic, covalent## 3 0.011 c) dispersion, covalent, hydrogen bonds, ionic 1 0.004 d) ionic, covalent, hydrogen, dispersion 4 0.014 e) none of the rest

25. According Table 2.2 on thermodynamic changes for transferring hydrocarbons from water to nonpolar solvents at 25¡ãC. Which of the following statements is(are) correct. "-" refers to direct interaction; "//" refers to no direction interaction.

7 0.025 a) Methane molecules move spontaneously from water to benzene due to negative DH

109 0.387 b) Methane/water system has higher Gibbs free energy than Methane/benzene system

73 0.259 c) Methane-water//benzene system has higher Gibbs free energy than Water//methane-benzene system##

47 0.167 d) Methane molecules move spontaneously from benzene to water due to negative DG

References

Related documents

February/March on an annual basis, with some preparation in January. The aim of the process is to appraise the performance of individuals against previously

Chapter 1 looks at how this history came to be narrated through popular texts like Ernest Cline’s Ready Player One, a novel about gamers whose knowledge of a “geeky canon” of

AR: Acetated Ringer ’ s solution; ATP: Adenosine triphosphate; BE: Base excess; Cit-ORS: Citrate-enriched ORS; DAG: Desacylghrelin; DCA: Dichloroacetate; EP: Ethyl pyruvate;

compared to the concentration of other chemicals in the environment. Compounds accumulate in living things any time they are taken up and stored faster than

Amit Rajendra Garge et al, International Journal of Computer Science and Mobile Applications,..

To obtain the prediction accuracy measures for different computation times, we tried several different settings of experiments and presented the best accuracies of each method for

The low development capacity of the decentralised areas, not unrelated to size and weak revenue and resource base; poor financial administration and corruption;

Treatment for Type 2 Diabetes involves primarily monitoring of blood sugar along with diabetic medications or insulin or both.. For type 1 Diabetes they need