Ionizing radiation induces expression and binding activity of the nuclear factor kappa B

(1)

Ionizing radiation induces expression and

binding activity of the nuclear factor kappa B.

M A Brach, … , R Weichselbaum, D Kufe

J Clin Invest.

1991;

88(2)

:691-695.

https://doi.org/10.1172/JCI115354

.

Recent studies have demonstrated that treatment of mammalian cells with ionizing radiation

is associated with activation of gene expression. Although the signal transduction pathways

stimulated by ionizing radiation remain unclear, our previous findings indicate that radiation

induces specific genes at the transcriptional level. The present work has examined the

effects of ionizing radiation on the transcription factor NF-kappa B. The results demonstrate

that ionizing radiation activates DNA binding of nuclear factor (NF)kappa B. This effect was

detectable at 2 grays (Gy) and reached a maximum at 5-20 Gy. At a dose of 20 Gy, the

increase in NF-kappa B binding activity was maximal at 2-4 h and then declined to

pretreatment levels. The results also demonstrate that ionizing radiation transiently

increases NF-kappa B mRNA levels. However, the finding that induction of NF-kappa B

binding to DNA occurs in the presence of cycloheximide indicates that ionizing radiation

activates preexisting NF-kappa B protein. NF-kappa B exists as a cytoplasmic protein

before activation. Thus, our results suggest that ionizing radiation induces transduction

pathways which include cytoplasmic signaling events.

Research Article

(2)

Rapid Publication

Ionizing Radiation Induces Expression

and

Binding Activity

of the Nuclear Factor

KB

MarionA.Brach, Ralf Hass, Matthew L.Sherman,HisatoGunji, Ralph Weichselbaum,*andDonaldKufe

Laboratory ofClinicalPharmacology,Dana-Farber CancerInstitute,Harvard MedicalSchool, Boston,Massachusetts02115;and

*Department ofRadiation and CellularOncology, University ofChicagoand PritzkerSchoolofMedicine, Chicago,Illinois60637

Abstract

Recent studieshavedemonstrated that treatment of mamma-lian cells withionizingradiationisassociatedwithactivationof gene expression. Although the signal transduction pathways stimulated by ionizing radiation remain unclear, our previous findings indicate that radiation induces specific genes at the

transcriptional level. The present work has examined the ef-fects ofionizing radiation on the transcription factor NF-KB. The results demonstrate that ionizing radiationactivates DNA

binding ofnuclearfactor(NF),B. This effectwasdetectable at 2 grays(Gy) and reached amaximumat5-20Gy. At a doseof 20Gy,theincreasein NF-KBbinding activitywas maximal at 24 h and thendeclinedtopretreatment levels. The results also

demonstrate thationizing radiation transiently increases NF-xB mRNA levels. However, thefindingthatinductionofNF-KB

bindingtoDNA occursinthe presence ofcycloheximide indi-catesthationizingradiation activatespreexistingNF-KB pro-tein. NF-KBexistsas acytoplasmic protein beforeactivation.

Thus,our results suggest thationizing radiation induces trans-duction pathways whichincludecytoplasmic sigalingevents.

(J. Clin.Invest.1991.88:691-695.)Key words:DNA-binding proteins-geneexpression* DNA damage

Introduction

Ionizing radiation inducesbothneoplastic transformationand lethal eventsinmammalian cells. These effectswerethoughtto

arise fromdirect mutagenicortoxiceventsofxrays on DNA. However, recentstudieshave demonstrated thatthisagent in-duces theexpression ofspecificgenes, theproducts of which

maycontribute totheeffects ofxrays oncells. For example,

ionizing radiation increasestumornecrosis factor(TNF)'gene

expression (1). This cytokine enhancesthekilling ofxrays by

paracrine

orautocrine pathways (2).Moreover, other workhas

shown that exposure to ionizing radiation is associated with

Address correspondence to Donald W. Kufe, M. D., Dana-Farber CancerInstitute,44BinneyStreet, Boston,MA02115.

Receivedfor publication3April 1991and in revised form 9 May 1991.

1. Abbreviationsused in thispaper:EMSAs, electrophoretic mobility

shiftassays;NF, nuclearfactor, TNF, tumor necrosis factor.

increased expression of interleukin-l, platelet-derived growth factor, and fibroblast growth factor (3, 4).Thestimulation of cytokine gene expression may thus representoneaspect of the cellular response to the effects of this agent. While fewinsights

are availableregarding mechanisms responsible for the induc-tion ofspecific gene expression by ionizing radiation, recent

work has demonstrated that theincrease in TNF mRNA levels

isregulated byatranscriptionalmechanism (5).

The modulation oftranscription is a critical control point inthe regulation of cellular processes and involves the

activa-tion oftranscription factors that bind to specific DNA se-quences (6). Transcriptional regulation has been proposed to

be importantin avariety of cellular responses toirradiation, including DNA repair, cell cycle arrest, and subsequent growth. Nuclear factor (NF) KB recognizes and bindsan 1l-bp DNA sequence present in theKimmunoglobin light chain gene enhancer (7). NF-KB also recognizesDNAsequencesinseveral virus enhancers, including that of the human

immunodefi-ciencyvirus(8-1 1). Moreover,NF-KB-like sitesareassociated

with regulation ofgenes coding for the Class I major

histocom-patibility antigen(12, 13), ,32-microglobulin (14),

granulocyte-macrophage colony stimulating factor (15, 16),IL-2(17, 18),

and IL-2 receptora chain(19). NF-KB is located in the

cyto-plasmbound to an inhibitorprotein, IKB,which prevents up-takeof NF-KBintothenucleus(20, 21).Theaffinity ofNF-KB forDNAbinding is activated by tumor-promoting phorbol

es-ters(7,22), the transactivatortaxprotein ofhuman Tcell lym-photrophic virustype 1 (9, 23, 24),TNF(25),and IL-1 (25).

Thus,NF-KB mayregulate theexpressionof certaingenes in-volvedin cellgrowthortransformation.

In this report, we have examined the effects of ionizing

radiation on activation of NF-KB binding to DNA. The results demonstrate that DNA

binding

ofNF-KB is activated bythis agent in adoseandtime-dependentmanner. NF-KBbindingis

induced inthe absenceofprotein synthesis, suggestingthat the

effect of

ionizing

radiation is mediated inpartbya

posttransla-tional activationof

cytoplasmic

NF-KB.

Methods

Cellculture. Human KG-I myeloid leukemia cells (American Type

CultureCollection,Bethesda, MD) were maintained in Iscove's me-diumsupplementedwith10%fetal bovine serum,100U/mlpenicillin, and 100

jsg/ml

streptomycin.Cells wereirradiatedusingaGammacell 1000(Atomic Energy of Canada, Ottawa) with a

137CS

source emitting

atafixed dose rateof 14.3 grays (Gy)/min as determined by dosimetry. Control cellswerehandled under the sameconditions but not irra-diated. Cellswerealso treated with 10

gg/ml

cycloheximide (Sigma ChemicalCo.,St.Louis,MO).

J.Clin. Invest.

(3)

Electrophoretic mobility shiftassays. Nuclear proteinswere pre-pared accordingtopreviously described methods (26). A 22-bp syn-thetic oligomer (5'GATCGAGGGGACTTTCCCTAGC 3') contain-ing the 1l-bpNF-KB binding sequence (GGGGACTTTTCC) was end labeledwith[a-32P]dATPusingDNApolymeraseIandpurified in a 12%polyacrylamide gel. Radiolabeled DNA (1 ng) was incubated with 10

Ag

nuclearproteinfor 20 min at 20'C in 25 mM Tris-HCl, pH 7.6, 250 ng/ml polydI/dC, 5 mM MgCl2, 0.5 mM EDTA, 1 mM DTT, and 10% (vol/vol) glycerol.Competition studies with unlabeled NF-KB oli-gonucleotide wereperformed by adding upto a25-fold excess com-pared totheend-labeled fragment. Thereaction products were ana-lyzed by 5%polyacrylamide gel electrophoresis and autoradiography.

Northern blot analysis. Total cellular RNA (30 jg) wasisolatedas described (27, 28), separated in a1%agarose/2.2Mformaldehyde gel, transferred to anitrocellulose filter, and hybridizedtothefollowing 32P-labeled DNA probes: (a) the 3.9-kb EcoRI fragment isolated from theNF-KBcDNA (29); and(b) the 2.0-kbPstI ,B-actin cDNA insert

purifiedfrom the pAl plasmid (30).

Results

To study theeffects of ionizing radiation on NF-KB binding activity, wefirstperformed

electrophoretic mobility

shift as-says(EMSAs) with nuclear

proteins

isolated from KG-1 cells exposedtovarying doses of ionizing radiation. Incubation ofa

radiolabeled 22-bpoligonucleotidecontainingthe NF-KB bind-ing site with nuclear proteins from untreated KG-1 cells

re-sulted in the retardation ofasingleband(Fig. 1A).The

inten-sity

of this bandwasincreasedwhen nuclear extracts from cells

exposedto 2 Gy

ionizing

radiationwereused in these assays

(Fig. 1A). Maximal increasesinsignal intensitywereobserved whenusing doses of 5-50 Gy.

Competition

studieswere next

performed

with unlabeled

NF-KBoligonucleotide to ensurespecificity ofthe

DNA-pro-on

B.

=~

r

a) _.=

CL_c o a

0

1

B. z

2

D) Figure1. Dose effects of ionizing radiationon

NF-KBbindingactivity.

e (A) Nuclearextracts

wereisolatedfrom KG-Z 1cellsat2 hafter

expo-sure to varyingdoses of

ionizingradiation. EMSAswereperformed using 10jgnuclear

proteinand 1 ng ofa

32p-labeled

22-bp

oligo-nucleotidecontaining

the NF-KBconsensus

sequence.(B)KG-l

cellsweretreatedwith 20Gyionizingradiation and nuclearextracts

prepared after 2 h. The

nuclear proteinswere

incubated with end-la-beled NF-KB

oligonucle-otide in the absence and

presenceofa25-fold

excessofthe unlabeled DNA

fragment.

tein interaction. Addition of the unlabeled fragment to nuclear

proteins from20 Gyirradiated cells and end-labeled

oligonucle-otide decreased appearance of the retarded band. Complete

inhibition was obtained when using a 25-fold excess of unla-beled NF-KBfragment (Fig.1B).Takentogether,thesefindings

indicated that ionizing radiation activates DNA binding of NF-KB.

EMSAswerealso used to study thekinetics ofNF-KB bind-ing. Nuclear proteins were isolated at varying intervals after treatmentwith20 Gy. Ionizingradiation treatment was asso-ciated with an increase in intensity of the retarded fragmentby

15 min (Fig. 2). This effect was maximal at 2-4 h and was

associated with adeclinein DNAbindingtonearly pretreat-ment levels by 12 h(Fig. 2).

Thestimulation ofNF-KB binding to DNA by ionizing

radi-ationcouldberelated toincreasesinexpression ofthis gene or toactivation ofpreexisting protein. To examine these possibili-ties, we initially performed Northern analyses of RNA from

irradiatedcells. There was a low but detectable levelof4.0-kb NF-KBtranscripts incontrol cells(Fig.3). Moreover,therewas

littleif anyeffectof 20 Gy on NF-KB mRNA levels at 1 h (Fig.

3).Incontrast, there was adetectableincreasein NF-KB expres-sion at 3 and 6 h after irradiation. This effect was transient and levelsofNF-KBtranscripts returnedtothat incontrolcellsby 15 h. These findingsand the lack ofan effecton actin gene expression indicated that ionizing radiation regulates NF-KB

expressionatthemRNAlevel.

Theabsenceofadetectableincreasein NF-KBtranscriptsat 1 h suggestedthat therapid stimulation ofNF-KBbindingto DNAmightberelated at least in part toactivation of preexist-ingNF-KBprotein. This possibilitywasaddressedbystudying

DNAbinding of nuclear proteinsfrom cells treated with

cyclo-heximide. Nuclearproteins isolated2 haftertreatingcellswith 20Gy resultedin anincreaseinretardation oftheend-labeled

NF-KBoligonucleotide (Fig. 4). Similar resultswereobtained with nuclearproteins from cells that were pretreatedwith 10

0

O L '-CLO o o

O Ci ib

Figure 2. Kinetics of NF-KB bind-ing activity. Nuclearextractswere

isolatedatvaryingtimes after

ex-posureof KG-l cellsto20Gy ionizingradiation. EMSAswere

performedasdescribedinthe

leg-endtoFig.1.

O- > >,4 >% >% >

O-

N

U)

O

O!

O

A-

_o

O

_C'J4 _{1)0 000}0000

(4)

XRT

7 .~- : .c:

Figure3. Induction of

NF-KBmRNAlevelsby

ionizingradiation.

KG-28S- I cellsweretreatedwith

NF-XB

20 Gy ionizing

radia-18 S tion (XR7). Total

cellu-lar RNA(30Ag/lane)

wasisolated after 1, 3,

6,and 15h,and hy-2 8 S- H bridized to 32P-labeled

actin

NF-KBor actin DNA

SAX

* * At a c I n

_{probes. The}

_KG-1

_lane

18S

-representsRNAfrom untreated cells.

,gg/ml

cycloheximide

for 2 h before and for 2 h after irradiation

(Fig. 4). Although previous

studies have demonstrated that

treatmentwith

cycloheximide

alone

modestly

activatesNF-KB

(22),

exposureof

KG-1

cellstothisagentfor4 hhadno

detect-able effect on retardation ofthe NF-KB

fragment (data

not

shown).

These

findings

indicated that

ionizing

radiation

acti-vatesNF-KB in theabsenceofde novo

protein

synthesis.

Discussion

Although

ionizing

ra-diation activates the

transcription

of

specific

genes such as

TNF,

the

signaling

eventsthatcontributetogeneinduction by this agentremain undefined. These

signaling

events may be

o _X

C X

U

X0

Figure4.Activation of NF-KB in the presence of cy-cloheximide. KG-I cellsweretreatedwith 20Gy

ion-izingradiation(XRT)after 2 h pretreatment with 10

Ag/ml

cycloheximide (CHX). Nuclearproteinswere

isolated afteranadditional 2 h in the presence of CHX.

Binding

was

performed

with 10_,gnuclear

proteinand1 ng 32P-labeled22-bpNF-KB

oligonucle-otide.

important not onlyforcytokineinduction, but also for awide varietyof cellulareventsfollowing radiationexposure. Inthis

context, wehaverecentlystudied the effects ofionizing radia-tion on activaradia-tion of immediateearlyresponse genes that code fortranscriptionfactors. These studies have shown that expo-sure to ionizing radiation is associated with activation of the

c-jun

gene

(31).

The

_c-jun

gene codes for the

major

form of the 40-44-kD AP-l leucine zipper transcription factor and isa

member of a family of other related genes, such as jun-Band

c-fos,

which are also induced byionizing radiation (31). Other studies have shown thata43-kD DNAbinding proteinis acti-vated by gammairradiation inEpstein-Barrvirus-transformed

human lymphoblastoid cells (32). The DNA binding motiffor

this novel protein has been identified in the 72-bp tandem re-peatof the SV40 enhancerregionand thusbinds to sequences distinct from the heptameric AP- 1 consensus

(TGAG/cTCA)

(32). More recent work has demonstrated that ionizing

radiationinduces expression of the EGR- 1 gene which codes for a zinc finger transcription factor that binds to the GCGGGGGCG sequence (33). Taken together, these results

indicatethationizing radiation induces distinctclassesof tran-scription factors. These findings may contribute to our under-standing of molecular events involved in cellular responsesto

radiation, such as DNArepair,cellcycle arrest, and cytokine induction.

Recentfindings suggest that NF-KB motifs play a role in

lipopolysaccharide-mediated transcriptional activation of the TNFgene (34, 35).Since ionizingradiationalsoinducesTNF geneexpression by a transcriptional mechanism (5), our

stud-ieswereperformedtodetermine ifNF-KBis activated in irra-diated cells. The results demonstrate thationizing radiation regulates NF-KB expression at both the mRNA and protein levels. NF-KBtranscripts were transiently increased after

irra-diation, although this effect occurred after evidence for

en-hancedDNAbinding activity. Moreover,thefinding that in-creasedprotein bindingtothe NF-KBoligonucleotidewas de-tectable in the presence of cycloheximide indicated that

preexistingNF-KBis also activated by ionizing radiation.These results suggestthat theeffects ofionizing radiationon NF-KB

expressionmay occurbyindependentmechanisms at two lev-els. Alternatively, activation ofNF-KB protein by this agent

could be associated with autoinduction of the NF-KB gene.

Previous studieshave demonstrated that4.0-kbNF-KB

tran-scripts

aredetectablein a

variety

of celltypes(29, 36). Further-more, recent work hasdemonstratedthatdiverse cytoplasmic

NF-KB complexes mayexist that includethe product ofthe

c-relprotooncogene(29, 36-38). Althoughthisstudyhas not

addressed thesubunitstructure oftheNF-KBcomplexes acti-vatedbyionizing radiation, othermembersof the rel-related familymay beregulated bythis agent at the pre-or posttransla-tional level.

Theavailable evidence suggeststhat

protein

kinase Cmay be involved in intracellular signaling

pathways

activated by

ionizing

radiation.In onestudy,

transcriptional

activationof a constructcontainingthelong terminalrepeatofMoloney

mu-rinesarcomavirus linkedtothechloramphenicol acetyltrans-ferasegene wasexamined aftergammairradiation

(39).

Irra-diation stimulated

expression

ofthe construct

twofold,

while treatmentwith H7,a

nonspecific isoquinolinesulfonamide

in-hibitor ofprotein kinases, orpreincubation with

(5)

ki-nase C,abolished the response of x rays (39). Similar inhibitory effects have been obtained with H7 and prolonged TPA

stimu-lation duringinduction ofTNF gene expression by ionizing

radiation (unpublished data). Protein kinaseC has been impli-catedintheactivation ofNF-KBbindingto DNA. Inthis con-text, treatment of cells by certain agents, notably phorbol esters that activate protein kinase C, results in dissociation of the

cytoplasmicNF-KB/IKB complexand movement of NF-KB to the nucleus(40). The activation of NF-KB byionizingradiation could therefore be mediatedbyaproteinkinaseC-dependent mechanism.

Finally,thedemonstrationthationizingradiation activates NF-KB implicates the activation of cytoplasmic signaling events. Previousworkhasclearlydemonstratedthat NF-KB is presentinthe cytoplasm in aninactive form(20,21, 40). Our studies demonstrate thatmaximalDNAbinding of theNF-KB

complexinKG-l cells isactivated byadoseofionizing radia-tion between2 and 5 Gy.While theNF-KBresponseinother

celltypesmaydiffer, doses of 2-20 Gyinduce free radical for-mation, DNAdamage, andneoplastictransformation,as well ascell killing (41). Free radicalformation coulddirectly

acti-vate a cytoplasmic signaling pathway. Alternatively, DNA

strand breakage ordistortion ofDNA nucleoprotein confor-mation may transduce signals from the nucleusto the cyto-plasm.Indeed,activation ofNF-KBhas recently beendescribed during cellular exposure to UV irradiation, another

DNA-damagingagent(42).While signal transductiongenerally

pro-ceedsfrom the cell membranetothenucleus,reversesignaling mechanisms from the nucleus to cytoplasm could represent part ofthecellularresponse to DNAdamage. Thesefindings

with NF-KB would support this mechanism.

Acknowledgments

This investigation was supportedby Public Health Service Grants

CA29431 and CA44068 awardedby theNational CancerInstitute,

Dept. of Health and HumanServices,agrant from theDr. Mildred-Scheel Stiftung(M. A. Brach),afellowship from the Deutsche

For-schungsgemeinschaft (R. Hass),andaBurroughsWellcome Clinical Pharmacology Scholar Award(D.Kufe).

References

1.Hallahan, D. E., D. R.Spriggs, M. A.Beckett,D. W. Kufe,and R. R. Weichselbaum. 1989. Increasedtumornecrosis factoramRNAafter cellular exposuretoionizingradiation. Proc. Nail. Acad. Sci. USA. 86:10104-10107.

2. Hallahan, D. E., M.A.Beckett,D. W.Kufe,andR. R.Weichselbaum. 1990. The interaction betweenrecombinant humantumornecrosis factor and radiation inthirteen humantumorcelllines. Int.J.Radiat.Oncol. Biol.Phys.

19:69-74.

3. Witte, L., Z. Fuks, A.Haimonovitz-Freidman,I.Vlodavsky, D. S. Good-man, andA.Eldor.1989.Effects of irradiationonthereleaseof growth factors from cultured bovine, porcine, and human endothelial cells. Cancer Res. 49:5066-5072.

4.Woloschak, G. E., C.-M.Chang-Liu,P.S. Jones, and C.A.Jones. 1990.

Modulation ofgeneexpression in Syrian hamsterembryo cellsfollowing ionizing

radiation. Cancer Res. 50:339-344.

5.Sherman,M. L.,R.Datta,D. E.Hallahan,R.R.Weichselbaum,andD. W.

Kufe. 1991.Regulationoftumornecrosisfactor geneexpression byionizing

radiation in humanmyeloidleukemia cells andperipheralblood monocytes. J.

Clin.Invest. 87:1794-1797.

6.Mitchell,P. J., and R.Tjian.1989.Transcriptional regulationin

mamma-lian cells by sequence-specific DNA binding proteins. Science(Wash. DC).

245:371-378.

7.Sen,R., and D. Baltimore. 1986. Multiple nuclear factors interact with the immunoglobin enhancersequences.Cell. 46:705-716.

8. Boshart, M., F. Weber, G. Jahn, K. Dorsch-Hasler, B. Fleckstein, and W. Schaffner. 1985.Averystrong enhancer is located upstream ofanimmediate earlygeneofhuman cytomegalovirus. Cell. 41:521-530.

9. Leung, K., and G. Nabel. 1988.HTLV-Itransactivator induces interleu-kin-2 receptor expression through an NF-KB-like factor. Nature (Lond.).

333:776-778.

10. Mitchell, P. J., C. Wang, and R. Tjian. 1987. Positive and negative regula-tion of transcripregula-tion in vitro: enhancer-binding proteinAP-2 is inhibitedbySV40

Tantigen. Cell. 50:847-861.

11. Nabel,G., and D. Baltimore. 1987.Aninducibletranscriptionfactor

activates expression ofhuman immunodeficiency virus in T cells. Nature(Lond.). 326:711-713.

12.Baldwin,A.S., Jr., and P.A.Sharp. 1987.Bindingofanuclear factorto a

regulatory sequenceinthepromoterofthe mouse H-2Kb classImajor histocom-patibility gene. Mol. Cell. Biol. 7:305-313.

13. Baldwin,A.S.,Jr.,andP. A.Sharp. 1988. Twotranscriptionfactors, NF-KBand H2TF1, interactwith a single regulatory sequence in the class I major histocompatibility complex promoter. Proc.Nadl.Acad. Sci. USA. 85:723-727. 14. Israel, A., A. Kimura, M. Kieran, 0. Yano, J. Kanellopoulos, 0. LeBail, andP.Kourilsky. 1987. A common positive transacting factor binds to enhancer sequencesinthe promoters of mouseH-2and(12-microglobulin genes. Proc. Nail. Acad.Sci. USA. 84:2653-2657.

15. Miyatake, S., M. Seiki, M.Yoshida, and K.-I. Arai. 1988. T-cell activation signals and human T-cell leukemia virus type I-encoded p40' protein activate the mousegranulocyte-macrophage colony-stimulating factor gene through a com-monDNA element. Mol.Cell. Biol. 8:5581-5587.

16. Schreck, R., and P. A. Baeuerle. 1990. NF-KB as inducible transcriptional activator of the granulocyte-macrophage colony-stimulating factor gene. Mol. Cell. Biol. 10:1281-1286.

17. Hoyos, B., D. W. Ballard, E.Bohnlein, M.Siekevitz, and W. C. Greene. 1989.Kappa-B-specific DNAbinding proteins: role in the regulation of human interleukin-2 gene expression. Science (Wash. DC). 244:457-460.

18. Lenardo,M.J.,A.Kuang,A.Gifford, and D.Baltimore. 1988. NF-xB proteinpurification from bovine spleen: nucleotide stimulation and binding site

specificity.Proc.Nail.Acad. Sci. USA. 85:8825-8829.

19.Bohnlein, E., J. W. Lowenthal, M. Siekevitz, D. W. Ballard,B. R.Franza, and W.C. Greene. 1988. The same inducible nuclear proteins regulates mitogen activation of both the interleukin-2 receptor-alpha gene and type1 HIV.Cell. 53:827-836.

20. Baeuerle, P. A., and D. Baltimore. 1988.Activation of DNA-binding activity in an apparently cytoplasmic precursor ofthe NF-KBtranscriptionfactor. Cell. 53:211-217.

21. Baeuerle, P. A., and D.Baltimore. 1988. IKB: a specific inhibitor ofthe

NF-KBtranscription factor. Science(Wash.DC). 242:540-546.

22. Sen, R., andD. Baltimore. 1986. InducibilityofKimmunoglobin en-hancer-binding protein NF-KB by aposttranslational mechanism.Cell. 47:921-928.

23.Ballard, D. W.,E.Bohnlein,J. W.Lowenthal,Y.Wano,B. R.Franza, and W. C.Greene. 1988. HTLV-1 taxinduces cellular proteins that activate the KB element in the IL-2 receptoragene. Science(Wash. DC). 241:1652-1655.

24. Ruben,S.,H.Poteat, T.Tan,K.Kawakami,R.Roeder,W.Haseltine,and C.A.Rosen. 1988. Cellulartranscriptionfactors andregulationof IL-2 receptor geneexpressionbyHTLV-I taxgeneproduct.Science(Wash.DC).241:89-92.

25. Osborn, L., S. Kunkel, and G.J.Nabel. 1989. Tumornecrosisfactoraand interleukin 1 stimulate the humanimmunodeficiencyvirus enhancerby

activa-tionof the nuclear factor KB. Proc.Natl. Acad. Sci. USA. 86:2336-2340. 26.Schreiber,E.,P.Matthias,M. M.Muller, and W. Schaffner. 1989.Rapid direction ofoctamerbinding proteinswith'mini-extracts', preparedfromasmall

number of cells.NucleicAcidsRes.17:6419.

27.Chirgwin, J. M., A. E. Przybyla,R. J.MacDonald, andW. J. Rutter.1979. Isolation ofbiologicallyactive ribonucleic acid fromsourcesenrichedin ribonu-clease.Biochemistry. 18:5294-5299.

28.Sherman,M.L.,R. M.Stone,R.Datta, S.H.Bernstein,and D. W. Kufe. 1990.Transcriptional andposttranscriptional regulation ofc-junexpression dur-ingmonocytic differentiation of humanmyeloid leukemic cells. J. Biol. Chem. 265:3320-3323.

29.Ghosh, S.,A. M.Gifford,L.R.Riviere, P. Tempst, G.P.Nolan,and D. Baltimore. 1990.Cloningof thep50DNAbinding subunitofNF-KB:homologto

reland dorsal.Cell.62:1019-1029.

30.Cleveland, D. W., M.A.Lopata,R.J.MacDonald,N.J.Cowan,W.J.

Rutter, and M. W. Kirschner. 1980. Number andevolutionaryconservation of

a-andfl-tubulinandcytoplasmic,l-and-y-actingenesusing specificcloned cDNA probes.Cell.20:95-105.

31.Sherman, M. L., R. Datta, D. E.Hallahan, R. R.Weichselbaum,and D.W.Kufe.1990.Ionizingradiation regulatesexpression ofthec-jun protoonco-gene.Proc.Natl. Acad.Sci. USA.87:5663-5666.

(6)

32. Singh, S. P.,and M. F. Lavin. 1990. DNA-bindingproteinactivatedby gamma radiation in human cells. Mol. Cell.Biod.10:5279-5285.

33. Hallahan,D.E.,V. P.Sukhatme,M. L.Sherman, S. Virudachalam,D.

Kufe,and R. R.Weichselbaum. 1991. Protein kinaseCmediatesx-ray inducibil-ityofnuclearsignal transducersEGRI and JUN. Proc.Natl. Acad. Sci. USA.

88:2 156-2 160.

34.Collart,M. A., P.Baeuerle,and P.Vassalli. 1990.Regulation oftumor

necrosisfactor alpha transcription in macrophages: involvement of four KB-like motifs and of constitutive and inducible formsof NF-KB. Mol. Cell. Bio!.

10:1498-1506.

35. Shakhov,A.N., M. A.Collart,P.Vassalli,S. A.Nedospasov,and C. V.

Jongeneel. 1990. KB-Type enhancersare involved in lipopolysaccharide-me-diatedtranscriptional activation of thetumornecrosis factoragene inprimary macrophages.J. Exp.Med. 171:35-47.

36.Kieran, M., V. Blank, F. Logeat,J.Vandekerckhove,F.Lottspeich, 0. Le Bail,M. B.Urban,P.Kourilsky,P. A. Baeuerle, and A.Israel.1990. The DNA

binding subunit of NF-KB is identicaltofactorKBFI andhomologousto the rel oncogeneproduct. Cell. 62:1007-1018.

37. Molitor,J. A., W. H. Walker, S.Doerre,D. W. Ballard, and W. C. Greene.

1990.NF-KB:afamily of inducibleanddifferentially expressed enhancer-binding proteins in humanTcells. Proc. NatL. Acad. Sci. USA. 87:10028-10032.

38. Ruben, S. M., P. J. Dillon,R.Schreck,T.Henkel,C.-H.Chen,M.Maher, P.A.Baeuerle,and C.A.Rosen. 1991.Isolationofarel-related humancDNA

that potentially encodes the 65-kD subunit ofNF-KB. Science(Wash. DC). 251:1490-1493.

39.Lin, C. S.,D.A.Goldthwait, and D. Samols. 1990. Induction oftranscrip-tionfrom the long terminalrepeatof Moloney murinesarcomaprovirusby

UV-irradiation,x-irradiation, and phorbol ester.Proc. Natl. Acad. Sci. USA. 87:36-40.

40. Ghosh, S., andD.Baltimore. 1990. Activation in vitro of NF-KB by phos-phorylation of its inhibitor IKB.Nature(Lond.).344:678-682.

41. Rauth, A. M. 1987.Radiation carcinogenesis.InBasic Science of

Oncol-ogy.I. F. Tannock andR. P.Hill, editors. PergamonPressInc.,Elmsford,NY.

106-124.