Supporting information

(1)

S1

Supporting information

Discovery of a first-in-class potent small molecule antagonist

against the Adrenomedullin-2 receptor

Paris Avgoustou

1^

_{, Ameera BA Jailani}

1^

_{, Jean-Olivier Zirimwabagabo}

2^

_{, Matthew J}

Tozer

3

_{, Karl R Gibson}

4

_{, Paul A Glossop}

4

_{, James EJ Mills}

4

_{, Roderick A Porter}

5

_,

Paul Blaney

6

_{, Peter J Bungay}

7

_,

_{Ning Wang}

1

_{, Alice P Shaw}

1

_{, Kamilla JA Bigos}

1

_,

Joseph L Holmes

1

_,

_{Jessica I Warrington}

8

_,

_{Timothy M Skerry}

1ɫ*

_{, Joseph PA Harrity}

2ɫ

and Gareth O Richards

1ɫ

.

1. Department of Oncology and Metabolism, University of Sheffield, UK

2. Department of Chemistry, University of Sheffield, UK

3. Matt Tozer Consultancy, Cambridge, UK

4. Sandexis Medicinal Chemistry Ltd, Sandwich, Kent, UK

5. Rod Porter Consultancy, Ashwell, Hertfordshire, UK

6. Concept Life Sciences, High Peak UK

7. Sympetrus Ltd., Bishop’s Stortford, Hertfordshire, UK

8. Faculty of Biology, University of Manchester, UK

^

_{These authors contributed equally to the work}

ɫ

These authors contributed equally to the work

(2)

S2

Supplementary information – Chemistry (page S4)

Abbreviations

General analytical methods Chemical synthesis procedures

Synthesis of compound 2 Synthesis of compound 4 Synthesis of compound 5 Synthesis of compound 6 Synthesis of compound 7 Synthesis of compounds 8 and 9

CGRP receptor antagonists purchased from MedChemExpress Modelling and docking

Supplementary information – Biology (page S28)

Supplementary Methods

Endpoint PCR qRT-PCR Supplementary Results

DiscoveRx overexpressing cell line validation Supplementary Figures

Figure S1: Activity and selectivity of 2, 4 and 5 in cAMP assays

Figure S2: Activity lead compounds 7 and 8 on dog, human and mouse cells in cAMP assays

Figure S3: Pharmacokinetics (PK) of lead compound 7 and 8

Figure S4: Activity and selectivity of lead compound 7 and selective CGRP antagonists in cAMP assays

(3)

S3

Supplementary Tables

Table S1: Melting/annealing temperatures, expected product sizes and sequences for primers used in endpoint PCR

Table S2: Primer sequences with double-dye hydrolysis probe and FAM reporter Table S3: Mean pIC50 from cAMP assays in AMY1 and AMY3 receptor overexpressing cell lines

Table S4: AM, CLR and RAMP mRNA expression in native cell lines Table S5: Overexpressing cell lines purchased from DiscoveRx

Table S6: Potency (pEC50) values for DiscoveRx cells, measuring cAMP accumulation Table S7: mRNA expression levels (Ct values) of RAMP1, RAMP2 and RAMP3 in DiscoveRx cell lines by qRT-PCR

Table S8: Potency (pEC50) values for AM, CGRP naïve cells, measuring cAMP accumulation.

Table S9: Isoform specific substrates and positive control inhibitors

Table S10: Composition of External and Internal Solutions (hERG channel test, ADME) Table S11: Protocols for various immunohistochemistry staining

(4)

S4

Abbreviations

ADME – Absorption, Distribution, Metabolism and Elimination CSH - charged surface hybrid

DCM – dichloromethane

DIPEA – N,N-diisopropylethylamine

EDCI.HCl - 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride salt HOAt – 1-hydroxy-7-azabenzotriazole

HPLC – high performance liquid chromatography HRMS - High resolution mass spectrometry LCMS - liquid chromatography–mass spectrometry MS – mass spectrometry

NMR – nuclear magnetic resonance PDA – photodiode array

pTSA – p-toluene sulfonic acid

QDA - Quadrupole Dalton RT – room temperature rt – retention time

SCX2 – strong cation exchange 2 (SPE from Biotage) SEM – trimethylsilylethoxymethyl

SPE – solid phase extraction THF – tetrahydrofuran

(5)

S5

General analytical methods

All UPLC-MS analyses were carried out using Waters Acquity UPLC-MS (quaternary pump flow 0.8 ml/min, Acquity autosampler, PDA and QDA).

Methods:

All basic methods run using XBridge C18 Column: XB C18 2.5 µm 2.1 x 50 mm

Short Basic: Run Time: 1.40 min; Solvents B) Acetonitrile C) 10 mM NH4HCO3 at pH10

Gradient: 2-98% B with C in 1.2 min, hold at 98% B 2% C to 1.40 min @ 0.8ml/min, 40 o_C;

Long Basic: Run Time: 4.60 min; Solvents B) acetonitrile C) 10 mM NH4HCO3 at pH10

Gradient: 2-98% B with C in 4.0 min, hold at 98% B 2% C to 4.60 min @ 0.8ml/min, 40o_C

All CSH methods are acidic methods using CSH C18 Column: CSH C18 1.7 µm 2.1 x 50 mm.

Short CSH: Run Time: 1.40 min; Solvents A) water B) acetonitrile D) 2% formic acid: the gradient runs with 5% D. Gradient: 2-95% B with A and 5% D in 1.2 min, hold at 95% B 5% D to 1.40 min @ 0.8 ml/min, 40 o_C.

Short CSH 2-50 %: Run Time: 2.0 min; Solvents A) water B) acetonitrile D) 2%formic acid: the gradient runs with 5% D. Gradient: 2-50% B with A and 5% D in 1.0 min, to 95% B with 5% D at 1.8 min, hold at 95% B 5% D to 2.0 min @ 0.8ml/min, 40 o_C.

Short CSH 50%: Run Time: 1.40 min; Solvents: A) 0.1% formic acid, B) acetonitrile; Gradient: 0-50% B in 0.80 min, 50-95% B to 1.20 min, hold @ 95% B to 1.40 min.

Long CSH: Run Time: 4.60 min; Solvents A) water B) acetonitrile D) 2%formic acid: the gradient runs with 5% D. Gradient: 2-95% B with A and 5% D 4.0 min, hold at 95% B 5% D to 4.60 min @ 0.8 ml/min, 40o_C.

(6)

S6

Methods:

Long Basic: Run time: 3.1 min Solvents: A) Water 10 mM ammonium bicarbonate pH 10, B) MeCN; Gradient: 0-95% B with A to 2.0 min, hold at 95% B, 5% A to 3.10 min XBridge IS C18 2.5 µm 2.1 x 2.0 mm.

Long Basic, 11 min, 40%: Run time: 11 min; Solvents: 60% water pH 10 buffer 10 mM NH4HCO3,

40% acetonitrile, Isocratic, XBridge C18 Column: XB C18 5 µm 3 x 150 mm.

All NMR spectra were obtained using Jeol EXC300 MHz or EXC400 MHz NMR spectrometers running Delta software.

Chemical synthesis procedures

Compound 2

(7)

S7

To a mixture of the compound 10 (3.0 g, 13.91 mmol) and diisopropylethylamine (12.1 ml, 69.55 mmol) in dichloromethane (60 ml) was added dropwise pivaloyl chloride (1.9 ml, 15.30 mmol) at RT. The reaction mixture was stirred at RT for 1 h. The mixture was diluted with dichloromethane (100 ml), washed with a solution of saturated sodium bicarbonate (50 ml) and extracted with dichloromethane (2x30 ml).The organic extracts were dried over magnesium sulfate, and evaporated. The residue was purified through flash column chromatography (0-40% ethyl acetate in heptane) to provide the compound 11 (3.54 g, 97% yield). 1_{H NMR (CDCl}

3, 300 MHz): δ 1.34

(s, 9H), 3.71 (s, 3H), 3.91 (s, 2H), 4.83 (s, 2H), 7.21 (d, 2H), 7.28-7.40 (m, 3H). UPLC-MS (short basic) rt 0.87 (264 [M+H]+_{), 98% pure.}

2-(N-Benzylpivalamido)acetic acid 12

Compound 11 (3.0 g, 11.39 mmol) was dissolved in methanol (60 ml) and sodium hydroxide (1.3 g, 31.00 mmol) was added. The reaction mixture was stirred at RT for 16 h. Volatiles were removed under vacuum then dissolved in water (50 ml) and extracted with dichloromethane (60 ml) . Aqueous layer was acidify with 2 M HCl and extracted with ethyl acetate (80 ml then 2x60 ml). Organics were dried over magnesium sulfate and concentrated to provide the compound 12 (2.4 g, 85% yield). 1_{H NMR (DMSO-d}₆_{, 300 MHz): δ 1.19 (s, 9H), 3.60-4.00 (br, 2H), 4.45-4.80}

(br, 2H), 7.13-7.22 (m, 2H), 7.25 (d, 1H), 7.28-7.37 (m, 2H). UPLC-MS (short basic) rt 0.43 (248 [M-H]-_{), 100% pure.}

(8)

S8

N-Benzyl-N-(2-((3-methyl-2,5-dioxo-1',3'-dihydrospiro[imidazolidine-4,2'-inden]-5'-yl)amino)-2-oxoethyl) pivalamide 2

Compound 12 (125 mg, 0.50 mmol), compound 13 (116 mg, 0.50 mmol) and HATU (228 mg, 0.60 mmol) were dissolved in dry N,N-dimethylformamide (5 ml). N-Methylmorpholine (0.5 ml, 9.1 mmol) was added and the mixture was stirred at RT for 25 min. The mixture was diluted with ethyl acetate (50 ml) then washed with brine (3x30 ml), dried over magnesium sulfate filtered and the filtrate evaporated. The crude was purified by preparative HPLC (XBridge Prep OBD C18 5µm 19mmx250mm, from 95:5 to 5:95 water/acetonitrile in 40 minutes, 17 mL.min-1_{, room temperature)}

then freeze-dried to provide the compound 2 as a white solid (157 mg, 68%). 1_{H NMR (400 MHz,}

CDCl3): δ 1.37 (s, 9H), 2.65 (s, 3H), 3.09 (dd, 2H), 3.55 (dd, 2H), 3.99 (s, 2H), 4.91 (s, 2H),

7.26-7.14 (m, 5H), 7.39-7.29 (m, 3H), 7.55 (s, 1H), 8.43 (br, 1H). LCMS [M+Na]+_485.

(9)

S9

Compound 4

Methyl 2-((2-bromobenzyl)amino)acetate 15

Compound 14 (16.8 g, 90.8 mmol) was dissolved in methanol (260 ml) and then methyl glycinate hydrochloride (34 g, 272.4 mmol) and sodium cyanoborohydride (8.6 g, 136.2 mmol) were added and the mixture was stirred at RT for 18 h. The reaction mixture was evaporate under vacuum to remove methanol and dissolved in dichloromethane (150 ml). The organic layer was washed with aqueous sodium bicarbonate (50 ml). The aqueous extract was extracted with dichloromethane (2x50 ml). The combined organics were washed with brine (80 ml) then dried over magnesium sulfate, filtered and evaporated to provide the compound 15 (9.5 g, 41%) as an orange oil. 1_{H NMR}

(CDCl3, 400 MHz) δ 3.44 (s, 2H), 3.71 (s, 3H), 3.89 (s, 2H), 7.12 (td, 1H), 7.28 (td, 1H), 7.38 (dd,

(10)

S10

Methyl 2-(N-(2-bromobenzyl)pivalamido) acetate 16

Compound 15 (9.5 g, 36.8 mmol) was dissolved in dichloromethane (200 ml) under an argon atmosphere then N,N-diisopropylethylamine (22.5 ml, 128.8 mmol) was added and the mixture stirred at 5 °C (ice / water). Trimethylacetyl chloride (4.6 ml, 36.8 mmol) was added dropwise then the mixture was stirred at RT for 18 h. The mixture was washed with 20% aqueous citric acid, saturated sodium bicarbonate, brine, dried over magnesium sulfate, filtered and the filtrate evaporated. The residue was purified via flash silica chromatography (9:1 to 1:1 heptane / EtOAc) to provide the compound 16 (11.8 g, 94%) as a yellow gum. 1_{H NMR (CDCl}₃_{, 300 MHz) δ 1.28 (s,}

9H), 3.73 (s, 3H), 3.95 (br s, 2H), 4.82 (s, 2H), 7.16 (m, 2H), 7.32 (t, 1H), 7.56 (d, 1H). UPLC-MS (short basic) rt 0.87 (342, 344 [M+H]+_{), 99% pure.}

2-(N-(2-Bromobenzyl)pivalamido) acetic acid 17

Compound 16 (8.0 g, 22.4 mmol) was dissolved in methanol (10 ml) and 2.5 M sodium hydroxide (12 ml, 30.0 mmol)) was added and the mixture stirred at RT overnight. The pH was adjusted carefully to 4 by addition of 20% citric acid and the aqueous layer was extracted with dichloromethane (3x50 ml). The organic layer was dried over magnesium sulfate, filtered and the filtrate evaporated to provide the compound 17 (6.8 g, 89% yield). 1_{H NMR (CDCl}₃_{, 300 MHz): δ}

(11)

S11

N-(2-Bromobenzyl)-N-(2-((3-methyl-2,5-dioxo-1',3'-dihydrospiro[imidazolidine-4,2'-inden]-5'-yl)amino)-2-oxoethyl)pivalamide 18

To a solution of 17 (131 mg, 0.40 mmol) in N,N-dimethylformamide (2.3 ml) was added EDCI.HCl (96 mg, 0.50 mmol), HOAt (74 mg, 0.54 mmol) and N,N-diisopropylethylamine (0.190 ml, 1.09 mmol). The mixture was stirred for 10 minutes at RT. Compound 13 (81 mg, 0.35 mmol) was then added and the mixture was stirred at RT for 16 h. The mixture was diluted with ethyl acetate (30 ml) and washed with saturated sodium bicarbonate (~20 ml). The aqueous was extracted with ethyl acetate (2x20 ml). The combined organics were washed with brine (3x50 ml), dried over magnesium sulfate, filtered and the filtrate evaporated. The residue was passed through a pad of silica gel eluting with ethyl acetate to provide the compound 18 as a pale yellow solid. UPLC-MS (long basic) rt 2.13 (541 [M+H]+_{). Used directly without further purification.}

N-(2-Cyanobenzyl)-N-(2-((3-methyl-2,5-dioxo-1',3'-dihydrospiro[imidazolidine-4,2'-inden]-5'-yl)amino)-2-oxoethyl)pivalamide 19

(12)

S12

(0-30% ethyl acetate in dichloromethane) to provide the compound 19 (20 mg, 23%). 1_{H NMR}

(CDCl3, 300 MHz): δ 1.34 (s, 9H), 2.64 (s, 3H), 3.06 (dd, 2H), 3.54 (dd, 2H), 4.10 (s, 2H), 5.08 (s,

2H), 7.15 (d, 1H), 7.24 (d, 1H), 7.35-7.44 (m, 2H), 7.54 (s, 1H), 7.59 (dd, 1H), 7.70 (d, 1H), 8.35-8.50 (m, 2H). UPLC-MS (short basic) rt 0.66 (488 [M+H]+_{), 81% pure.}

N-(2-(Aminomethyl)benzyl)-N-(2-((3-methyl-2,5-dioxo-1',3'-dihydrospiro[imidazolidine-4,2'-inden]-5'-yl)amino)-2-oxoethyl)pivalamide 4

Compound 19 (20 mg, 0.041 mmol) was dissolved in methanol (1 ml) and trifluoroacetic acid (0.1 ml). Palladium-on-carbon (10% wet, 7 mg) was added, the vessel sealed and an atmosphere of hydrogen introduced at atmospheric pressure. The mixture was stirred at RT for 18 h. The reaction mixture was transferred in autoclave and stirred under 700 psi pressure of hydrogen overnight. Then, the reaction mixture was filtered through Celite®, washing with methanol and the filtrate evaporated. The residue was dissolved in ethyl acetate (10 ml) and washed with saturated sodium bicarbonate (5 ml). The aqueous was extracted with ethyl acetate (2x5 ml). The organics were washed with brine (10 ml), dried over magnesium sulfate, filtered and the filtrate evaporated. The residue was purified via flash silica chromatography (ethyl acetate then 10% methanol in dichloromethane with ammonia buffer) to provide the compound 4 (5.2 mg). This compound was further purified by SCX-2/500 mg cartridge (washing with methanol then eluted with methanol/ammonia) to provide the compound 4 (2.0 mg, 10% yield). 1_{H NMR (CD}₃_{OD, 300 MHz):}

(13)

S13

Compound 5

Compound 20 was prepared employing previously described protocol1

N-Benzyl-N-(2-oxo-2-((2'-oxo-1,1',2',3-tetrahydrospiro[indene-2,3'-pyrrolo[2,3-b]pyridin]-5-yl)amino)ethyl)pivalamide 5

Compound 12 (50 mg, 0.20 mmol), compound 20 (54 mg, 0.21 mmol) and HATU (87 mg, 0.23 mmol) were dissolved in dry N,N-dimethylformamide (2 ml). N-Methylmorpholine (0.2 ml, 3.5 mmol) was added and the mixture was stirred at RT for 15 min. The mixture was diluted with ethyl acetate (30 ml) then washed with brine (3x20 ml), dried over magnesium sulfate filtered and the filtrate evaporated. The crude was purified by preparative HPLC (XBridge Prep OBD C18 5µm 19mmx250mm, from 95:5 to 5:95 water/acetonitrile in 30 minutes, 17 mL.min-1_{, room temperature)}

then freeze-dried to provide the compound 5 as a white solid (60.4 mg, 62%). 1_{H NMR (400 MHz,}

CDCl3): δ 1.36 (s, 9H), 3.07 (dd, 2H), 3.52 (dd, 2H), 4.06 (s, br, 2H), 4.85 (s, br, 2H), 6.88 (dd, 1H),

(14)

S14

Compound 6

Methyl 2-(N-(2-cyanobenzyl)pivalamido)acetate 22

(15)

S15

300 MHz) δ 1.30 (s, 9H), 3.74 (s, 3H), 4.00 (br s, 2H), 4.96 (br s, 2H), 7.40 (m, 2H), 7.60 (t, 1H), 7.67 (d, 1H).

Methyl 2-(N-(2-(aminomethyl)benzyl)pivalamido)acetate 23

Compound 22 (320 mg, 1.1 mmol) was dissolved in methanol (14 ml) and trifluoroacetic acid (0.75 ml). Palladium-on-carbon (10% wet, 32 mg) was added, the vessel sealed and an atmosphere of hydrogen introduced at atmospheric pressure. The mixture was stirred at RT for 18 h. The reaction was filtered through Celite®, washing with methanol and the filtrate evaporated. The residue was dissolved in ethyl acetate (60 ml) and washed with saturated sodium bicarbonate (30 ml). The aqueous was extracted with ethyl acetate (2x20 ml). The organics were washed with brine (40 ml), dried over magnesium sulfate, filtered and the filtrate evaporated to provide the compound 23 (132 mg, 41%) as a yellow gum. UPLC-MS (short CSH 2-50%) rt 0.45 (293 [M+H]+_).

Methyl 2-(N-(2-(((tert-butoxycarbonyl)amino)methyl)benzyl)pivalamido)acetate 24

(16)

S16

(br s, 2H), 4.29 (s, 2H), 4.86 (s, 2H), 7.26 (m, 4H). UPLC-MS (short CSH 2-50%) rt 1.21 (293 [M-Boc+H]+_).

2-(N-(2-(((tert-Butoxycarbonyl)amino)methyl)benzyl)pivalamido)acetic acid 25

Compound 24 (300 mg, 0.76 mmol) was dissolved in methanol (10 ml) and 2.5M sodium hydroxide (0.7 ml, 1.75 mmol)) was added and the mixture heated at reflux for 2 h then at RT for 18 h. The volatiles were removed then the residue dissolved in water (30 ml). The pH was adjusted carefully to 4 by addition of 2M HCl and extracted with ethyl acetate (2x50 ml). The aqueous pH was again adjusted to 4 and extracted again with ethyl acetate (2x30 ml). The organics were washed with brine (~60 ml), dried over magnesium sulfate, filtered and the filtrate evaporated to provide the compound 25 as a yellow oil. Used directly.

tert-Butyl 2-((N-(2-oxo-2-((2'-oxo-1,1',2',3-tetrahydrospiro[indene-2,3'-pyrrolo[2,3-b]pyridin]-5-yl)amino)ethyl)pivalamido)methyl)benzylcarbamate 26

(17)

S17

provide the compound 26 (228 mg, 48%) as a pale yellow solid. UPLC-MS (short basic) rt 0.91 (612 [M+H]+_{), 90% pure.}

N-(2-(Aminomethyl)benzyl)-N-(2-oxo-2-((2'-oxo-1,1',2',3-tetrahydrospiro[indene-2,3'-pyrrolo[2,3-b]pyridin]-5-yl)amino)ethyl)pivalamide 6

Compound 26 (228 mg, 0.37 mmol) was dissolved in dichloromethane (6 ml) and cooled on ice / water bath. Trifluoroacetic acid (0.3 ml) was added dropwise, stirred on ice / water bath for 15 min then at RT for 45 min. UPLC-MS suggested slow conversion. Extra trifluoroacetic acid (0.15 ml) was added and the reaction stirred for 55 min. The mixture was poured into saturated sodium bicarbonate (~10 ml) and the aqueous layer was extracted with dichloromethane (3x20 ml) then with 10% methanol/ethyl acetate (2x20 ml). The combined organics were dried over sodium sulfate, filtered and the filtrate evaporated to give 160 mg of material that was a 2:1 mixture of 26 and 6. The 160 mg mixed material was dissolved in dichloromethane (6 ml) and trifluoroacetic acid (0.45 ml) added and the mixture stirred at RT for 1 h. The reaction was worked up as above. The crude residues were purified via SPE (5 g SiO2 10-15% MeOH in DCM then 15% MeOH and ammonia in

DCM) to provide the compound 6 (96 mg, 51%) as a colorless glass. 1_{H NMR (CD}₃_{OD, 300 MHz)}

(18)

S18

Compound 7

1-Bromo-2-(dimethoxymethyl)benzene 28

(19)

S19

for 4 h. The mixture was cooled on ice water then triethylamine (3 ml) was added. The volatiles were removed then the mixture diluted with diethyl ether (80 ml) and water (50 ml). The aqueous layer was extracted with diethyl ether (2x40 ml). The combined organic extracts were washed with brine, dried over sodium sulfate, filtered and the filtrate evaporated. The residue was purified via column chromatography (250 ml silica, 10-15% diethyl ether in hexane ) to provide the compound

28 (3.45 g, 88%) as a colorless oil. 1_{H NMR (CDCl}₃_{, 300 MHz) δ 3.39 (s, 6H), 5.56 (s, 1H), 7.20 (t,}

1H), 7.33 (t, 1H), 7.57 (m, 2H).

2-(Dimethoxymethyl)benzaldehyde 29

Compound 28 (3.60 g, 15.58 mmol) was dissolved in dry tetrahydrofuran (35 ml) under an argon atmosphere then cooled on dry ice / acetone. To this was added a solution of n-butyllithium (2.5 M in hexanes, 9.35 ml, 23.37 mmol) dropwise so that the internal temperature stayed below -60 °C (10 min addition). The reaction was stirred on dry ice / acetone for 70 min. To this was added N,N-dimethylformamide (2.43 ml, 31.16 mmol) in one portion. The mixture was stirred on dry ice / acetone for 60 min before being allowed to warm to RT over 1.5 h. Water (20 ml) was added then the mixture was extracted with diethyl ether (3x50 ml). The combined organic extracts were washed with brine, dried over sodium sulfate, filtered and the filtrate evaporated to provide the compound

29 (2.92 g, quant.) as a straw-colored oil; 1_{H NMR (CDCl}₃_{, 300 MHz) δ 3.39 (s, 6H), 5.87 (s, 1H),}

7.49 (t, 1H), 7.59 (t, 1H), 7.66 (d, 1H), 7.91 (d, 1H), 10.43 (s, 1H) – contains trace THF and minor impurities. Used directly.

(20)

S20

Compound 29 (3.60 g, ~15.58 mmol) was dissolved in dichloromethane (50 ml) under an argon atmosphere. N,N-Diisopropylethylamine (6.1 ml, 35 mmol) was added followed by methyl glycinate hydrochloride (3.92 g, 31.2 mmol) and magnesium sulfate (3.5 g). The mixture was stirred at RT for 2 h. The mixture was filtered then the filtrate was washed with saturated sodium bicarbonate (~30 ml). The aqueous layer was extracted with dichloromethane (2x30 ml). The combined organic extracts were washed with brine, dried over magnesium sulfate, filtered and the filtrate evaporated to provide the compound 30 (4.78 g, quant.) as a pale yellow gum. Used directly. UPLC-MS (short basic) rt 0.70 (220 [M-OMe+H]+_).

Methyl 2-((2-(dimethoxymethyl)benzyl)amino)acetate 31

Compound 30 (4.78 g, ~15.58 mmol) was dissolved in methanol (30 ml) under an argon atmosphere then cooled on ice / water. Sodium borohydride (297 mg, 7.8 mmol) was added portion wise (NOTE: vigorous gas evolution). The mixture was stirred on ice / water for 10 min then allowed to warm to RT and reaction monitored followed by UPLC-MS. After 18 h, extra sodium borohydride (150 mg, 3.94 mmol) was added and reaction was complete after a further 20 min at RT. The mixture was poured into saturated sodium bicarbonate (20 ml). The aqueous layer was extracted with ethyl acetate (100 ml, then 2x50 ml). The combined organic extracts were washed with water, brine, dried over magnesium sulfate, filtered and the filtrate evaporated to provide the compound

31 (4.04 g, quant.) as a pale straw-colored gum. 1_{H NMR (CDCl}₃_{, 300 MHz) δ 3.34 (s, 6H), 3.44}

(21)

S21

Methyl 2-(N-(2-(dimethoxymethyl)benzyl)pivalamido)acetate 32

Compound 31 (4.04 g, ~15.58 mmol) was dissolved in dichloromethane (40 ml) under an argon atmosphere then N,N-diisopropylethylamine (5.45 ml, 31.2 mmol) was added. Trimethylacetyl chloride (1.91 ml, 15.6 mmol) was added dropwise – note: after the addition of 0.4 ml warming was noted - so the flask was cooled on ice / water and the addition continued. The mixture was stirred at RT for 4 h. after which the reaction was complete by UPLC-MS. The mixture was poured into saturated sodium bicarbonate (20 ml). The aqueous layer was extracted with dichloromethane (3x10 ml). The combined organic extracts were dried over magnesium sulfate, filtered and the filtrate evaporated. The residue was purified via column chromatography (300 ml silica, dichloromethane – gradient with ethyl acetate 0% – 20%) to provide the compound 32 (4.32 g, 82%) as a colorless gum, which crystalized on standing. 1_{H NMR (CDCl}₃_{, 300 MHz) δ 1.29 (s, 9H),}

3.32 (s, 6H), 3.72 (s, 3H), 3.93 (br s, 2H), 4.97 (br s, 2H), 5.33 (s, 1H), 7.21 (m, 1H), 7.31 (m, 2H), 7.52 (d, 1H). UPLC-MS (short basic): rt 0.84 (190 fragment).

2-(N-(2-(Dimethoxymethyl)benzyl)pivalamido)acetic acid 33

(22)

S22

indigo / purple – immediately basify with 2.5M NaOH then start pH adjustment again]. The combined organic extracts were washed with brine (50 ml), dried over sodium sulfate, filtered and evaporated carefully (30 °C water bath) not to dryness (NOTE: can be used in next step as ethyl acetate solution or DIPEA can be added before evaporation) to provide the compound 33 which was used directly in the next step as the compound is not stable; UPLC-MS rt 0.51 (322 [M-H]-_).

N-(2-(Dimethoxymethyl)benzyl)-N-(2-oxo-2-((2'-oxo-1,1',2',3-tetrahydrospiro[indene-2,3'-pyrrolo[2,3-b]pyridin]-5-yl)amino)ethyl)pivalamide 34

Compound 33 (1.92 g, 5.93 mmol) was dissolved in N,N-dimethylformamide (30 ml) under an argon atmosphere then N,N-diisopropylethylamine (2.9 ml, 16.3 mmol) was added. EDCI.HCl (1.24 g, 6.5 mmol) and HOAt (0.89 g, 6.5 mmol) were added followed by the compound 20 (1.4 g, 5.60 mmol). The mixture was stirred at RT for 18 h when reaction was complete by UPLC-MS. The mixture was poured into saturated sodium bicarbonate (20 ml). The aqueous layer was extracted with ethyl acetate (2x40 ml). The combined organic extracts were washed with water (2x30 ml) and brine (3x30 ml), dried over sodium sulfate, filtered and the filtrate evaporated. The residue was purified via column chromatography (300 ml silica, 4:1 ethyl acetate / heptanes – ethyl acetate) to provide the compound 34 (2.48 g, 80%) as a colorless glass. 1_{H NMR (CDCl}₃_{, 400 MHz) δ 1.31 (s, 9H),}

(23)

S23

N-(2-Formylbenzyl)-N-(2-oxo-2-((2'-oxo-1,1',2',3-tetrahydrospiro[indene-2,3'-pyrrolo[2,3-b]pyridin]-5-yl)amino)ethyl)pivalamide 35

Compound 34 (2.48 g, 4.46 mmol) was dissolved in acetone (100 ml) then p-toluene sulfonic acid monohydrate (860 mg, 4.9 mmol) was added. The mixture was stirred at RT. After 20 min, the color turned green and UPLC-MS indicated reaction was complete. The mixture was poured into saturated sodium bicarbonate (~30 ml). The aqueous layer was extracted with ethyl acetate (3x60 ml). The combined organic extracts were washed with brine (~50 ml), dried over sodium sulfate, filtered and the filtrate evaporated to provide 35 (2.16 g, 95%) as a yellow solid. 1_{H NMR (CDCl}₃_,

300 MHz) δ 1.30 (s, 9H), 3.05 (dd, 2H), 3.60 (dd, 2H), 4.09 (br s, 2H), 5.36 (s, 2H), 6.82 (dd, 1H), 7.07 (dd, 1H), 7.20 (d, 1H), 7.30 (m, 1H), 7.34 (m, 1H), 7.55 (m, 2H), 7.63 (m, 1H), 8.12 (d, 1H), 8.63 (br s, 1H), 8.90 (br s, 1H), 10.11 (s, 1H). UPLC-MS (short basic) rt 0.74 (509 [M-H]-_{), 96%}

pure.

N-(2-((Methylimino)methyl)benzyl)-N-(2-oxo-2-((2'-oxo-1,1',2',3-tetrahydrospiro[indene-2,3'-pyrrolo[2,3-b]pyridin]-5-yl)amino)ethyl)pivalamide 36

(24)

S24

36 (287 mg, 100%) as a yellow glass. 1_{H NMR (CDCl} 3, 300 MHz) δ 1.33 (s, 9H), 3.05 (dd, 2H), 3.51 (d, 3H), 3.61 (dd, 2H), 4.09 (br s, 2H), 5.26 (s, 2H), 6.82 (dd, 1H), 7.09 (d, 1H), 7.21 (m, 2H), 7.40 (m, 2H), 7.58 (s, 1H), 7.63 (d, 1H), 8.24 (br s, 1H), 8.45 (s, 1H), 8.60 (br s, 1H). UPLC-MS rt 0.75 (524 [M+H]+_{), 92% pure.} N-(2-((Methylamino)methyl)benzyl)-N-(2-oxo-2-((2'-oxo-1,1',2',3-tetrahydrospiro[indene-2,3'-pyrrolo[2,3-b]pyridin]-5-yl)amino)ethyl)pivalamide 7

Compound 36 (287 mg, 0.549 mmol) was dissolved in methanol (10 ml) then sodium borohydride (31 mg, 0.823 mmol) was added portion wise (gas evolution). The mixture was stirred at RT for 180 min. UPLC-MS indicated the reaction was complete. The mixture was poured into saturated sodium bicarbonate (~5 ml) and extracted with ethyl acetate (3x20 ml). The combined organic extracts were washed with brine (20 ml), dried over sodium sulfate, filtered and the filtrate evaporated then purified via flash silica chromatography (10% MeOH in EtOAc, then 10-20% MeOH in DCM, then 20% MeOH with NH3 in DCM) to provide the compound 7 (147 mg, 51%) as a colorless solid. 1H

NMR (CDCl3, 300 MHz) δ 1.32 (s, 9H), 2.48 (s, 3H), 3.02 (d, 2H), 3.58 (d, 2H), 3.84 (br s, 2H), 4.18

(25)

S25

Compound 8 and 9

A sample of compound 7 (49 mg, 0.093 mmol) was purified via chiral semi-preparative HPLC (Chiral IA, ID 20, 250 mm, 85% acetonitrile 15% methanol with 0.1% diethylamine, 18 ml/min) to provide the compound 9 (16 mg, 33%, first to be eluted) and then the compound 8 (13 mg, 26%).

(R)-N-(2-((Methylamino)methyl)benzyl)-N-(2-oxo-2-((2'-oxo-1,1',2',3-tetrahydrospiro[indene-2,3'-pyrrolo[2,3-b]pyridin]-5-yl)amino)ethyl)pivalamide 8

1_{H NMR (CD}₃_{OD, 300 MHz) δ 1.32 (s, 9H), 2.41 (s, 3H), 3.04 (dd, 2H), 3.50 (dd, 2H), 3.72 (s, 2H),}

4.11 (br s, 2H), 4.96 (br s, 2H), 6.86 (dd, 1H), 7.11 (m, 1H), 7.20 (m, 2H), 7.30 (m, 4H), 7.52 (s, 1H), 8.03 (d, 1H). Chiral HPLC (IA, 90% acetonitrile, 10% methanol 0.1% diethylamine, 1 ml/min), 98.1% ee.

(26)

S26

1_{H NMR (CD}

3OD, 300 MHz) δ 1.32 (s, 9H), 2.41 (s, 3H), 3.04 (dd, 2H), 3.50 (dd, 2H), 3.72 (s, 2H),

4.11 (br s, 2H), 4.96 (br s, 2H), 6.86 (dd, 1H), 7.11 (m, 1H), 7.20 (m, 2H), 7.30 (m, 4H), 7.52 (s, 1H), 8.03 (d, 1H). Chiral HPLC (IA, 90% acetonitrile, 10% methanol 0.1% diethylamine, 1 ml/min), 99.4% ee.

CGRP receptor antagonists purchased from MedChemExpress

(27)

S27

Modelling and docking

The initial docking experiment involved predicting a binding pose for MK3207 in the CGRP receptor, using PDB structure 3n7r. The 3D structure of the spiro ring system in this compound was not precedented in the CSD2_{and PDB, so template conformations were built using}

Openbabel3_{(version 2.3.1) and minimized using orca}4_{, initially using AM}

2, followed by DFT. All

candidate puckers were assessed for ability to dock into the pocket. The remaining portion of the ligand was built using Openbabel. The 3D structure of the final compound was minimized using orca. Docking was carried out using GOLD5_{, tethering the lactam portion of the head group such}

that it was overlaid onto that of telcagepant. Standard GOLD settings were applied, with 30 docks requested. Docks were assessed using (i) GOLD docking scores; (ii) quality of hydrogen bonds formed; (iii) similarity to the docked pose as observed in a published image captured from a crystal structure of MK3207 bound to the CGRP receptor6_.

For the purposes of docking AM2 actives, rather than generate a homology model of the AM2

receptor, the antagonist-bound CGRP receptor PDB structure 3n7r was used as a template, with the sidechain of RAMP1 residue Trp74 altered to the RAMP3 equivalent, glutamate. A library of commonly occurring glutamate side-chain conformations that did not clash with the remainder of the site was used to generate a number of putative binding pockets. The conformer used in the final “model” was the one that interacted with the basic side chain of compound 6. It was not felt necessary to deviate further from the CGRP receptor since the compounds were known to demonstrate CGRP antagonism, presumably utilizing a similar binding mode.

(28)

S28

Supplementary Methods

Endpoint PCR

To obtain RNA for endpoint PCR, ReliaPrep™ RNA Cell Miniprep System was used according to standard manufacturer protocol. RNA was quantified before storing at -80°C. High-Capacity RNA-to-cDNA™ Kit (Thermo Fisher) was used to synthesize cDNA. Reaction mixes were made for both reverse transcriptase positive and negative samples (2 µg RNA). Tubes are kept on ice before starting the reaction in a thermal cycler. Samples were incubated for an hour at 37°C, heated for 5 minutes at 95°C, then cooled at 4°C before storing at -20°C.

Endpoint PCR was done using GoTaq® G2 Flexi DNA Polymerase Kit. Reaction components were thawed on ice and vortexed thoroughly before use. Tubes are kept on ice before starting the reaction in a thermal cycler according to general amplification temperatures (denaturation at 95°C; annealing at optimised temperatures; extension at 72°C). The number of cycles ran for CLR, RAMP1 and RAMP2 samples were 35 cycles (40 cycles for RAMP3 samples). Table S1 lists the primers, sequences, expected product sizes and optimised annealing temperatures.

Gel electrophoresis was used to visualise separated PCR products by size. 1.5 g agarose was mixed with 100 mL TBE and fully dissolved in the microwave. Ethidium bromide was added (2.5 μg) and the gel mixture was put into the mould with combs creating wells. After the gel has solidified (30 minutes), combs were removed and samples were loaded. For each reaction, water and GAPDH were used as negative and positive sample controls respectively. DNA ladder (100 to 10,000 bp) was also loaded to confirm PCR product size. Running of gel electrophoresis was done for 30 minutes before visualisation using Gel Doc XR+ System.

To validate endpoint PCR data, Sanger sequencing was used to confirm amplified targets. Samples were analysed by University of Sheffield Core Genomic Facility using BigDye™

(29)

S29

Alignment Search Tool (BLAST) in the National Centre for Biotechnology Information (NCBI) website.

Quantitative reverse transcriptase polymerase chain (qRT-PCR)

Samples were prepared to a final mass of 1.5 μg cDNA using Primerdesign Precision nanoScript2 Reverse Transcription kit using a standard protocol outlined by the manufacturer.

All equipment excluding the reagents were sterilised under UV light for 30 minutes. The cDNA synthesised was diluted to a concentration of 5 ng/µL in nuclease-free water to a total volume of 50 µL. 2.5 µl of the diluted cDNA was loaded into a 384-well plate in triplicate, followed by 7.5 µl of Primerdesign PrecisionPLUS Master Mix containing ROX dye with 0.5 µL of either RAMP, AM or CLR primers designed by Primerdesign (Table S2).

After loading the 384-well plate with samples and Master Mix, the plate was spun at 250 x g for 1 minute to ensure uniform mixing before running on the Applied Biosystems 7900 HT Fast Real-Time PCR System. Each reaction was run for 40 cycles at 95°C for 2 minutes, 95°C for 10 seconds and 60°C for 1 minute. Analysis of qPCR reactions were done using Sequence Detection System v2.4. Results of amplification plots are plotted with y-axis on log-scale. Thresholds used to interpolate Ct values (number of cycles needed to cross background fluorescence threshold) from

(30)

S30

Supplementary Results

DiscoveRx overexpressing cell line validation

Overexpressing cell lines purchased from DiscoveRx were validated for their expression and functional levels using cAMP accumulation assays and qRT-PCR (method described in Supplemental Biology Methods, page S28).

As shown in Table S6 and Figure S5, AM was the most potent ligand when measuring cAMP production in 1321N1-AM2 cells. Both CGRP and amylin were shown to be significantly less

potent than AM on this receptor by 7- and 1000-fold, respectively. Similarly, AM and amylin were significantly less potent than CGRP on 1321N1-CGRPcells by 186- and 1000-fold, respectively. Moreover, a 5 and a 1000-fold difference was also shown when compare the effects of amylin to those of CGRP and AM respectively on 1321N1-AMY1 cells. In CHO-AM1 cells, AM was

significantly more potent than CGRP and amylin, by at least 1000-fold, although it was not possible to determine a potency value. This can be further supported by a recent study published by Hendrikse et al. where they showed that, using both β-arrestin and cAMP studies, CGRP and amylin had significantly lower potency in these cells when compared to AM7_{. Furthermore, similar}

levels of potency to the one shown in 1321N1-AM2 cells was determined in 1321N1-parental cells

when using CGRP suggesting possible basal levels of RAMP1 in the parental cell line. On the other hand, AM showed incredibly low levels of potency in this cell line suggesting no significant levels of RAMP3 present.

To further support the validation of the cells, we determined the mRNA levels of the three different RAMPs in 1321N1-AM2, 1321N1-CGRP, 1321N1-parental and CHO-AM1 cell lines by

qRT-PCR. Comparing the Ct values (Table S7), RAMP1 expression is significantly higher in

1321N1-CGRP cells (18.7±0.21) when compared with the other three cells lines. Similar levels of RAMP1 were detected in 1321N1-AM2 (26.9±0.63) and 1321N1-parental (25.2±0.40) cells, which

(31)

S31

shown in 1321N1-AM2, 1321N1-CGRP, 1321N1-parental cells, which was significantly higher in

CHO-AM1 cells (18.8±0.74). Similarly, RAMP3 mRNA was only detected in 1321N1-AM2 cells

(20.0±0.14) supporting the validity of the cells.

Considering all these and in combination with the results shown in supplementary figure S4 where known CGRP receptor antagonists showed significantly higher affinity levels (consistent with the literature) for 1321N1-CGRP cells when compared to 1321N1-AM2, we believe that the

(32)

S32

Supplementary Figures

Figure S1: Activity and selectivity of 2, 4 and 5 in cAMP assays. Overexpressing cells were

treated with various concentrations of small molecule antagonists (30 mins) before stimulating with an EC50 dose of the receptor peptide agonist (15 mins). Quantification of cAMP was done using

(33)

S33

b

Figure S2: Activity lead compounds 7 and 8 on dog, human and mouse cells in cAMP assays.

a) Dog aortic cells and mouse prostate cancer cells (178-2 BMA) were treated with various

concentrations of small molecule antagonists (30 mins) before stimulating with an EC50 dose of the

receptor peptide agonist (15 mins). Quantification of cAMP was done using LANCE cAMP kit (TR-FRET). Data were normalized to peptide only and blank (stimulation buffer only) wells as 0% and 100% cAMP inhibition, respectively. Dose response curves were analyzed using three-parameter logistic curve. Curves are representative and do not include all data points. b) Table showing the activity (pIC50) of compounds 7 and 8 in different species including human, mouse and dog. Data are from three independent experiments and presented as mean±SEM.

Cell lines (Species) Dog aortic cells Human CFPAC-1 cells Mouse 178-2 BMA cells

Compound Mean pIC50 ± SEM

7 6.41±0.26 9.33±0.40 7.37±0.10

8 6.23±0.23 8.96±0.28 8.40±0.18

(34)

S34

Figure S3: Pharmacokinetics (PK) of lead compounds 7 and 8. Plasma concentration of lead

(35)

S35

Figure S4: Activity and selectivity of lead compound 7 and selective CGRP antagonists in

cAMP assays. Overexpressing cells were treated with various concentrations of small molecule

antagonists (30 mins) before stimulating with an EC50 dose of the receptor peptide agonist (15

mins). Quantification of cAMP was done using LANCE cAMP kit (TR-FRET). Data are from at least three independent experiments and presented as mean±SEM. Curves are representative and do not include all data points. Data were normalized to peptide only and blank (stimulation buffer only) wells as 0% and 100% cAMP inhibition, respectively. Dose response curves were analyzed using three-parameter logistic curve. a_{p<0.05 by unpaired t-test compared to CGRP in the CGRP receptor}

(36)

S36

Figure S5: Validation of DiscoveRx cell lines. cAMP production in response to peptide agonists

(AM, CGRP or amylin) in CHO-AM1 (a), 1321N1-CGRP (b) and 1321N1-AM2 (c)cell lines. (d) cAMP

(37)

S37

Supplementary Tables

Human Primers Tm (°C) Ta (°C) Product size (bp) Sequence CLR 59.4 54.4 302 CTTGGCTGGGGATTTCCACT (F) 59.4 CCTTCAGGTCGCCATGGAAT (R) RAMP1 59 54 193 ATGCAGAGGTGGACAGGTTC (F) 60 GCCTACACAATGCCCTCAGT (R) RAMP2 61 56 256 CTGTCCTGAATCCCCACGAG (F) 60 CTCTCTGCCAAGGGATTGGG (R) RAMP3 59.6 55 227 AAGGTGGACGTCTGGAAGTG (F) 57.2 ATAACGATCAGCGGGATGAG (R) Mouse Primers Tm (°C) Ta (°C) Product size (bp) Sequence CLR 61.4 56.4 280 GGCAGTGGCCAATAACCAGG (F) 62.7 ATGAGTGTCTGAGCTGATCCAGCA (R) RAMP1 60.3 54.5 187 CACCATCTCTTCATGGTCACTG (F) 63.5 CAATCGTGTGCGCCACGTGC (R) RAMP2 62.6 60 312 CATCCCACTGAGGACAGCCT (F) 63.4 GATCATGGCCAGGAGCACAT (R) RAMP3 55.3 50 103 AAAGCCTTCGCTGACATGAT (F) 59.4 CCATCTCGGTGCAGTTAGTG (R)

Table S1: Melting/annealing temperatures, expected product sizes and sequences for primers used in endpoint PCR

(38)

S38

Target Sequence Tm

RAMP-1 Forward TCATATTTCAGCCCATCACCTCTTC 59°C

RAMP-1 Reverse TGCCCCAGTCACACCACA 58°C

RAMP-2 Forward CCAACTGCTCCCTGGTGC 58.1

RAMP-2 Reverse GGAAGGGGATGAGGCAGATG 57.9

RAMP-3 Forward CCAACTGCACCGAGATGGAG 58.8°C

RAMP-3 Reverse GGAGAAGAACTGCCTGTGGAT 58°C

AM Forward GCATGAAAGAGAAAGACTGATTACC 59°C

AM Reverse GCTGTTCGCATATCACCCATT 58°C

Table S2: Primer sequences with double-dye hydrolysis probe and FAM reporter

Tm: primer melting temperature

Receptor 2 4 5 6 7 9 8

Mean pIC50 ± SEM

CTR ND ND <5 <5 <5 <5 <5

AMY1 5.26±0.45 5.36±0.27a 4.78±0.91a 5.71±0.10a 5.90±0.08a 5.78±0.16a 6.02±0.10a

AMY3 5.33±0.40 4.78±0.87a 6.16±0.10a 5.99±0.11a 6.65±0.06a 5.10±0.48a 6.27±0.11a

Table S3: Mean pIC50 of compounds 2 to 8 from cAMP assays in CTR, AMY1 and AMY3

receptor overexpressing cell lines

ND: not determined

(39)

S39

Human pancreatic cancer cell lines

Cell line AMq _CLRep _RAMP1ep _RAMP2ep _RAMP3ep

AsPC-1 23.0±0.06 + + + + BxPC-3 24.1±0.30 + + + - Capan-2 23.5±0.20 + + + + CFPAC-1 23.9±0.10 + + + + HPAF-II 26.1±0.15 + + + + Panc10.05 23.5±0.18 + + + + SW1990 25.2±0.22 + + + +

Mouse prostate cancer cell line

Cell line AMep _CLRep _RAMP1ep _RAMP2ep _RAMP3ep

178-2 BMA + + + + +

Table S4: AM, CLR and RAMP mRNA expression in native cell lines

q: quantitative RT-PCR (Ct value), ep: endpoint RT-PCR. n=3. Data is reported as mean±SD.

(40)

S40

Cell line Transfected receptor complex Parental

cell line Culture media Selection antibiotics CGRP receptor (95-0164C6) CLR/RAMP1 1321N1 AssayComplete Cell Culture Kit 105 (92-3105G) 800 μg/mL G418 and 2.5 μg/mL puromycin AM1 receptor (93-0270C2) CLR/RAMP2 CHO-K1 AssayComplete Cell Culture Kit 107 (92-3107G) 300 μg/mL hygromycin B, 800 μg/mL G418 and 2.5 μg/mL puromycin AM2 receptor (95-0169C6) CLR/RAMP3 1321N1 AssayComplete Cell Culture Kit 105 (92-3105G) 800 μg/mL G418 and 2.5 μg/mL puromycin AMY1 receptor (95-0170C6) CTR/RAMP1 1321N1 AssayComplete Cell Culture Kit 105 (92-3105G) 800 μg/mL G418 and 2.5 μg/mL puromycin AMY3 receptor (95-0166C6) CTR/RAMP3 1321N1 AssayComplete Cell Culture Kit 105 (92-3105G) 800 μg/mL G418 and 2.5 μg/mL puromycin CTR (95-0161C6) CTR 1321N1 AssayComplete Cell Culture Kit 105 (92-3105G) 800 μg/mL G418

Table S5: Overexpressing cell lines purchased from DiscoverX

Table S6: Potency (pEC50) values for DiscoveRx cells, measuring cAMP accumulation

Potency (pEC50) values for AM, CGRP and amylin in 1321N1-AM2, CGRP,

1321N1-AMY1, 1321N1-AMY3, 1321N1-parental and CHO-AM1 cells, measuring cAMP accumulation. Data

are from at least three independent experiments and presented as mean±SEM. ND: experiments not done. a_{p<0.05 by unpaired t-test compared to AM in 1321N1-AM}₂_cells.b_{p<0.05 by unpaired}

t-test compared to CGRP in 1321N1-CGRP cells.

(41)

S41

1321N1-CGRP CHO-AM₁ 1321N1-AM₂ 1321N1 Parental Mean Ct values ± SD

RAMP1 18.7±0.21 30.8±0.13 26.9±0.63 25.2±0.40

RAMP2 >35 18.8±0.74 >35 33.0±0.50

RAMP3 >35 >35 20.0±0.14 >35

Table S7: mRNA expression levels (Ct values) of RAMP1, RAMP2 and RAMP3 in DiscoveRx

cell lines by qRT-PCR

mRNA expression levels (Ct values) of RAMP1, RAMP2 and RAMP3 in DiscoveRx cell lines by

qRT-PCR, using a cut-off of 35 for undetected expression. n=3, triplicates each experiment. Data is reported as mean±SD. Further experimental details are provided on page S27.

Table S8: Potency (pEC50) values for AM, CGRP naïve cells, measuring cAMP accumulation

Data are from at least three independent experiments and presented as mean±SEM.

(42)

S42

CYP450 isoform Isoform-specific Substrate Positive control inhibitor 1A2 Ethoxyresorufin O-deethylation α-Naphthoflavone

2C9 Tolbutamide 4-hydroxylation Sulphaphenazole

2C19 S-mephenytoin 4-hydroxylation Tranylcypromine

2D6 Dextromethorphan O-demethylation Quinidine

3A4 Midazolam 1-hydroxylation Ketoconazole

Table S9: Isoform specific substrates and positive control inhibitors

External Solution (mM) Internal Solution (mM)

NaCl 145 - KCl 4 120 KOH - 31.25 CaCl2 2 5.374 MgCl2 1 1.75 Glucose 10 - Na2ATP - 4 HEPES 10 10 EGTA - 10

pH 7.4 with NaOH 7.2 with KOH

Osmolarity ~295mOsm ~285mOsm

(43)

S43

Antibody Protocol Mouse CD31 (DIA-310) Human Ki67 (ab15580) Mouse αSMA (ab124964) Antigen retrieval Citrate buffer pH 6, 95°C for 25 minutes (PT module) TE buffer pH 8 (0.05% Tween-20) for 20 minutes (food steamer)

Citrate buffer pH 6, 95°C for 25 minutes

(PT module)

Vectastain

ABC Kit Rat Rabbit Rabbit

1° antibody incubation

Rat anti-mouse CD31 1:50, overnight at 4°C

Rabbit anti-human Ki67 1:250, 1 hour at RT Rabbit anti-mouse αSMA 1:1000, overnight at 4°C Wash buffer TBS-T TBS PBS-T DAB

incubation 10 minutes 1.5-2 minutes 1.5-2 minutes Table S11: Protocols for various immunohistochemistry staining

(44)

S44

Supplementary references

Supporting information

S1