Here, we identify a sequence element, 5ⴕ-CAGGTA-3ⴕ, called ZV, located at nucleotidesⴚ17 toⴚ12 relative to the transcription initiation site of the BZLF1 promoter. ZV sequence-specifically binds a cellular nuclear factor(s), ZVR. ZVR DNA-binding activity was present in the EBV-negative B-lymphocytic cell line DG75, the EBV-positive B-lymphocytic cell lines GG68 and 721, the cervical cell line C33A, and the kidney cell line CV-1 but not in the breast carcinoma cell line MCF-7. Mutations in ZV that relieve binding of ZVR lead to a two-to fourfold increase in basal expression of the BZLF1 promoter in DG75, C33A, and CV-1 cells. The same mutants exhibited a 40- to 180-fold increase in tetradecanoyl phorbol acetate-ionomycin-induced expression in DG75 cells and a 22-fold increase in C33A cells. Thus, ZVR functions as a regulator of the BZLF1 promoter, repressing transcription when bound to the ZV site in the absence of inducers. No differences in basal or induced transcription between wild-type and ZV mutant BZLF1 promoters were observed in ZVR-negative MCF-7 cells. ZVR failed to bind any of the previously identified negative regulatory elements within the BZLF1 promoter. We conclude that ZV functions as an important regulatory element of the BZLF1 promoter, with ZVR likely playing important roles in the maintenance of latency and reactivation of EBV.
Epstein-Barr virus (EBV) is a human herpesvirus that is estimated to infect up to 90% of the world’s population (28, 29). EBV infection is associated with several human diseases, including infectious mononucleosis, nasopharyngeal carci-noma, Burkitt’s lymphoma, and, in immunosuppressed pa-tients, B-cell and T-cell lymphomas (28, 29). Thus, EBV is a serious pathogen and poses a significant threat to human health.
Like other herpesviruses, primary infection with EBV is followed by a persistent infection of the human host. Oropha-ryngeal epithelium is thought to be the primary site of EBV infection and replication and of viral spread (28–30, 51), while B cells are the major site of persistent latency (28–31). Eleven of EBV’s approximately 100 viral genes are expressed during latency. These include ones encoding the EBV-encoded nu-clear antigens (EBNAs 1 to 6), the latent membrane proteins (LMPs 1 and 2), two EBV-encoded small nuclear RNAs, and theBamHIA transcripts (28, 29). Expression of a subset of the latter genes is sufficient to immortalize B cells and to maintain steady-state levels of the viral genome (31). Treatment of cer-tain latently infected B-cell populations with reagents such as phorbol esters (5, 17, 64), Ca2⫹ionophores (15), sodium bu-tyrate (26, 38), and serum factors (2) or cross-linking of surface anti-immunoglobulin (12, 21, 50, 53) leads to cellular differen-tiation and the concomitant induction of the rest of EBV’s genes, followed by viral genome replication to higher copy number and production of infectious virus particles (28–30).
Two immediate-early genes, BZLF1 and BRLF1, are the first to be expressed during induction of EBV out of latency (11, 23, 32, 52). The protein products of both of these genes are strong transcriptional transactivators (9, 16). The product of the BZLF1 gene, referred to as Zta, ZEBRA, or EB1, plays a crucial role in the disruption of latency and initiation of the viral infectious cycle (10, 11, 41, 46, 52). Thus, regulation of Zta expression is critical to the state of EBV in cells.
The transcriptional regulation of the BZLF1 promoter (also referred to as Zp) has been studied extensively. Zp exhibits very low basal activity and is readily activated by inducers of the viral infectious cycle. The cis-acting elements necessary both for basal activity and for response to exogenous inducers lie within the nucleotide (nt)⫺221 to⫹12 region of the pro-moter relative to the transcriptional initiation site (12, 17, 18). These elements have been divided into three classes (Fig. 1; also, see reference 36 and references therein). Four AT-rich elements, termed ZIA to ZID, are dispersed throughout the promoter. They can bind the transcription factors Sp1 and Sp3 (34) and myocyte enhancer factor 2D (37, 44). A second type of element, ZII, shares significant homology with the consen-sus CRE/AP-1 binding site (1, 13, 25, 54). Finally, a region called ZIII contains multiple binding sites for the Zta protein itself (18). It has been proposed that activation of the BZLF1 gene occurs via a two-step process involving induction by ex-ogenous factors mediated through the ZI and ZII domains, followed by autoactivation by Zta binding to the ZIII elements (18).
During the latent state of infection, expression of the BZLF1 gene remains quiescent, suggesting the presence of silencing elements within the promoter. Recently, Liu et al. (36) iden-tified a negative,cis-acting element located between nt ⫺77 * Corresponding author. Mailing address: McArdle Laboratory for
Cancer Research, University of Wisconsin Medical School, 1400 Uni-versity Ave., Madison, WI 53706-1599. Phone: (608) 262-2383. Fax: (608) 262-2824. E-mail: [email protected].
867
on November 9, 2019 by guest
and⫺70, immediately upstream of the consensus CRE/AP-1 binding site. Mutations within this region, termed ZIIR, relieve repression of both basal and activated transcription. Unfortu-nately, the authors failed to detect a specific protein complex that recognized this sequence. Recently, Zhang et al. (60) showed that the ubiquitous factor Sbp-2 represses transcrip-tion of the BZLF1 promoter, with this repression being signif-icantly affected by an element located between nt⫺93 and ⫺79. Whether this or the ZIIR element is an Sbp-2 DNA-binding site remains unclear.
In earlier reports, Montalvo et al. (42) identified a negative, cis-acting region they called ZIV, between nt⫺551 and⫺386 relative to the transcriptional start site of the BZLF1 pro-moter. They went on to show that the transcription factor YY1 recognized a sequence within nt⫺433 to⫺386 (43). Similarly, Schwarzmann et al. (49) identified a silencing element, termed HI, repeated throughout the BZLF1 promoter region five times. This element contains the consensus sequence 5⬘- ACA GA(T/G)G(A/G)-3⬘. Four of the five HI elements are located between nt⫺551 and⫺227. The fifth HI element, termed HIε, is located between nt⫺60 and⫺53.
We report here the identification of a previously unknown regulatory element within the nt⫺17 to ⫺12 region of the BZLF1 promoter that plays a significant role in maintaining basal activity at low levels. In keeping with previous nomen-clature identifyingcis-acting regions of the BZLF1 promoter, we named this element ZV. We also show that ZV sequence-specifically binds a cellular factor(s) we call ZVR for “ZV regulator.” ZVR activity is present in several cell lines, includ-ing EBV-positive and -negative B-lymphocytic cell lines. ZVR fails to recognize previously identified negative regulatory el-ements in the BZLF1 promoter. Thus, ZVR is a novel regu-lator of the BZLF1 promoter. It probably plays a significant role in regulation of the life cycle of EBV as well.
MATERIALS AND METHODS
Cells.All B-lymphocytic cell lines were grown in 100-mm tissue culture dishes and maintained at 37°C in a 5% CO2atmosphere. The EBV-negative Burkitt’s
lymphoma cell line DG75 and the EBV-positive B lymphocytic cell lines 721 (27) and GG68, a clone of EBV strain P3/HR1-infected B lymphocytes (55), were grown in RPMI 1640 medium supplemented with 10% fetal bovine serum and 100 U of penicillin and streptomycin per ml. The human papillomavirus (HPV)-negative human cervical cell line C33A and the monkey kidney cell line CV-1 were grown in Dulbecco’s modified Eagle’s medium supplemented with 10 or 5% fetal bovine serum, respectively, and 100 U of penicillin and streptomycin per ml. The human breast cancer cell line MCF-7 was grown in RPMI 1640 medium supplemented with 10% fetal bovine serum, 6 ng of insulin per ml, 3g of glutamine per ml, and 100 U of penicillin and streptomycin per ml.
Where indicated, transcription was induced by addition to the media at the times indicated of tetradecanoyl phorbol acetate (TPA; 20 ng/ml; Sigma Chem-ical Co.) and ionomycin (1M; Sigma Chemical Co).
[image:2.612.123.483.74.258.2]Plasmids.Plasmid DNAs were constructed by standard recombinant DNA techniques (48). Plasmid⫺221ZpCAT (reference 36 and references therein), a generous gift from Sam Speck, contains the nt⫺221 to⫹12 region relative to the transcription initiation site of the BZLF1 promoter driving the expression of the chloramphenicol acetyltransferase gene. We transferred this promoter sequence and variants of it into luciferase reporter plasmids by insertion of appropriate PCR-generated fragments into the KpnI andHindIII restriction sites of the pGL3 basic luciferase vector (Promega Corp., Madison, Wis.). The PCR frag-ments were obtained using⫺221ZpCAT as a template and the following oligo-nucleotides as primers. The forward primer, 5⬘-GAGGTACCCCATGCATATT TCAACTGGGCTGTCTATTTTTGACACCAGCTT-3⬘, annealed to nt⫺221 to⫺178 of the BZLF1 promoter. The primers containing the wild-type sequence or mutations (underlined) within or adjacent to the ZVR DNA-binding site annealed to the complementary strand corresponding to the⫹10 to⫺40 region of the BZLF1 promoter. They were 5⬘- GTGTAAGCTTGCAAGGTGCAATG TTTAGTGAGTTACCTGTCTAACATCTCCC-3⬘for WTZpLUC, 5⬘-GTGTA AGCTTGCAAGGTGCAATGTTTAGTGAGTTAgCTGTCTAACATCTCC C-3⬘for⫺23CZpLUC, 5⬘-GTGTAAGCTTGCAAGGTGCAATGTTTAGTGA GTTAgCTGTCTAAgATCTCCC-3⬘for⫺23C/⫺14CZpLUC, 5⬘- GTGTAAGC TTGCAAGGTGCAATGTTTAGTGAGTTACCTGTCctgCATCTCCC-3⬘ for ⫺22/⫺20CAGZpLUC, 5⬘-GTGTAAGCTTGCAAGGTGCAATGTTTAGTGA GTTACCTactTAACATCTCCC-3⬘for⫺19/⫺17AGTZpLUC, 5⬘- GTGTAAG CTTGCAAGGTGCAATGTTTAGTagaTTACCTGTCTAACATCTCCC-3⬘ for ⫺10/⫺8TCTZpLUC, and5⬘-GTGTAAGCTTGCAAGGTGCAATGTTTA GTGAGTgACCTGTCTAACATCTCCC-3⬘for⫺12CZpLUC. The sequences FIG. 1. BZLF1 promoter. (A) Schematic representation of thecis-acting elements and their binding factors present within the⫺221 to⫹20 region of the BZLF1 promoter. The rectangles denote the approximate locations of thecis-acting sites. Binding factors are indicated above the sites. ZV, previously unknowncis-acting element identified here along with its binding factor, ZVR. Solid bars,cis-acting sites of previously identified negative regulatory elements for whichtrans-acting factors are not yet known. Numbering is relative to the transcriptional initiation site at⫹1. (B) Nucleotide sequence of the⫺30 to⫹20 region of the BZLF1 promoter used as the probe to identify the regulatory element ZV. The ZV site sequence is boxed.
on November 9, 2019 by guest
http://jvi.asm.org/
of the promoter regions of all of the luciferase reporter plasmids were confirmed by DNA sequence analysis. All oligonucleotides were purchased from Integrated DNA Technologies Inc. (Coralville, Iowa).
Nuclear extracts.Nuclear extracts were prepared essentially as described by Dignam et al. (14) as modified by Zuo (63). B-lymphocytic cells (5⫻108), grown
to a density of approximately 1⫻106/ml, were harvested by centrifugation at
2,000⫻gfor 10 min at 4°C. The cells were washed twice with cold phosphate-buffered saline (PBS), and the packed-cell volume (PCV) was determined. The cells were resuspended in 2 PCVs of buffer A (10 mM HEPES [pH 7.9], 1.5 mM MgCl2, 10 mM KCl, 1 mM dithiothreitol [DTT]), incubated for 10 min on ice,
and lysed by 10 strokes in a Dounce homogenizer using a B pestle. The nuclei were recovered by centrifugation at 17,000⫻gfor 30 min at 4°C and resus-pended in 3 ml of buffer C (20 mM HEPES [pH 7.9], 1.5 mM MgCl2, 0.42 M
NaCl, 0.2 mM EDTA, 1 mM phenylmethylsulfonyl fluoride [PMSF], 1 mM DTT, 25% glycerol) per 109cells. The resuspended nuclei were extracted by 5 strokes
in a Dounce homogenizer using a B pestle. Extraction was continued for an additional 30 min at 4°C. The nuclear debris was removed by centrifugation at 17,000⫻gfor 30 min at 4°C. The supernatant containing the nuclear extract was dialyzed against 50 volumes of buffer D (20 mM HEPES [pH 7.9], 6 mM MgCl2,
100 mM KCl, 0.2 mM EDTA, 1 mM PMSF, 1 mM DTT, 20% glycerol) overnight at 4°C. Aliquots of nuclear extract were stored at⫺70°C until use.
C33A, CV-1, and MCF-7 cells were grown to confluency in dishes, and nuclear extracts were prepared from approximately 5 ⫻108 cells. Since these cells
adhere, they were scraped from the dishes into 2 ml of cold PBS and pelleted by centrifugation. The PCVs were determined and nuclear extracts were prepared exactly as described above.
EMSAs.Electrophoretic mobility shift assays (EMSAs) were performed as follows. The probes consisted of gel-purified, double-stranded synthetic oligo-nucleotides that had been 5⬘-end labeled with T4 polynucleotide kinase and 50 Ci of [␥-32P]ATP. The binding reaction mixtures typically contained 2 to 12g
of nuclear extract incubated in 20 M HEPES (pH 7.9)–0.1 M KCl–6 mM MgCl2–4g of poly(dI-dC)䡠(dI-dC)–0.5 mM PMSF–0.5 mM DTT–8% Ficoll.
Following incubation for 20 min at 4oC, 0.5 to 1.0 ng (25,000 to 50,000 cpm) of
the desired probe was added and the mixture was incubated at 25°C for 15 min. For those experiments in which competition EMSAs were performed, the
de-sired unlabeled competitor oligonucleotides were added to the reaction mixture, which was incubated for 20 min at 4°C, after which the desired probe was added and the incubation was continued. The protein-DNA complexes were separated from the free probe by electrophoresis at 200 V for 2 h at 4°C in a nondenaturing 4% polyacrylamide gel with 0.5⫻Tris-borate-EDTA as the running buffer. The gels were dried and exposed to X-ray films.
Transient transfections and luciferase assays.DG75 cells were transfected by the DEAE-dextran—dimethyl sulfoxide (DMSO) shock method described by Liu et al. (36) with the minor modification that the 20% DMSO stock solution was prepared in RPMI 1640 medium. Transfected cells were harvested 72 h posttransfection, washed twice with PBS, and suspended in 300l of luciferase assay cell lysis buffer provided by the manufacturer (Promega Corp., Madison, Wis.). The suspension was cleared of debris by microcentrifugation. Luciferase activity present in the cell extracts was assayed according to the manufacturer’s protocol (Promega Corp.). Luciferase activities were normalized to protein con-centrations determined by a modified Bradford assay that utilizes a protein assay dye (Bio-Rad Laboratories, Hercules, Calif.).
C33A, CV-1, and MCF-7 cells, grown to approximately 80% confluency in 100-mm dishes, were transfected with 2g of reporter plasmid by the DEAE-dextran–chloroquine method as described by Good et al. (22). Cells were har-vested 48 h after transfection, and luciferase activities were determined as de-scribed above.
RESULTS
Identification of a novel sequence-specific binding site in the
BZLF1 promoter.To look for putative binding sites for cellular
[image:3.612.90.513.74.294.2]factors that might regulate the BZLF1 promoter, we per-formed EMSAs using nuclear extracts prepared from DG75 cells and radiolabeled double-stranded oligonucleotides corre-sponding to various regions of the BZLF1 promoter as probes. We observed the binding of a factor(s) to the ⫺30 to ⫹20 region of the BZLF1 promoter (Fig. 2A, lane 2), a region not FIG. 2. Identification of a novel binding site within the BZLF1 promoter. (A) A cellular factor(s) binds sequence specifically to the⫺30 to⫹20 region of the BZLF1 promoter. Six micrograms of protein from a nuclear extract prepared from DG75 cells was incubated with the indicated amounts of unlabeled double-stranded DNA corresponding to the⫺30 to⫹20 (lanes 3 to 5) and⫺165 to⫺115 (lanes 6 to 8) regions of the BZLF1 promoter as competitors, respectively, and then with a radiolabeled double-stranded oligonucleotide corresponding to the⫺30 to⫹20 region of the BZLF1 promoter as probe. The protein-DNA complexes were separated from free probe by electrophoresis in a native 4% polyacrylamide gel. The location of the sequence-specific binding complex (ZVR) identified here is indicated. (B) ZVR binding localizes to the⫺25 to⫺11 region of the BZLF1 promoter. Competition EMSAs were performed as described for panel A. Unlabeled double-stranded DNAs corresponding to the ⫺30 to⫹20 (lanes 3 to 5) and⫺165 to⫺115 (lanes 6 to 8) regions of the BZLF1 promoter and unlabeled double-stranded oligonucleotides containing the sequences 5⬘-ATGTTAGACAGGTAACTCACTAAACATTGCC-3⬘(⫺25/⫹5, lanes 9 to 11) and 5⬘- CTCACTAAACATTGCA CCTTGCCGGCCACC-3⬘(⫺10/⫹20, lanes 12 to 14) were used as competitors.
on November 9, 2019 by guest
previously reported to bind regulatory factors. Data from com-petition EMSAs indicated that the cellular factor(s) present in the DG75 nuclear extract bound sequence specifically to this region of the BZLF1 promoter (Fig. 2A, lanes 3 to 5 versus lanes 6 to 8). Four regulatory regions of the BZLF1 promoter have been defined previously. Therefore, we chose to term this new element ZV.
To begin to localize the sequence-specific binding element, we performed competition EMSAs using unlabeled double-stranded oligonucleotides that spanned nt⫺25 to⫹5 and⫺10 to⫹20 as competitors for binding of the factor(s) to the ra-diolabeled⫺30 to ⫹20 probe. Only the oligonucleotide con-taining nt ⫺25 to ⫹5 competed efficiently for binding the factor (Fig. 2B, lanes 9 to 11). Thus, we conclude that the binding element maps at least partially within the sequence 5⬘ -ATGTTAGACAGGTAA-3⬘ located between nt ⫺25 and ⫺11.
To identify more precisely the specific region involved in binding cellular factors, we next performed competition EMSAs utilizing a series of competitor oligonucleotides that contained 3-bp cluster point mutations spanning nt⫺22 to⫺7. The results of these experiments (Fig. 3A; summarized in Fig. 3B) mapped the binding site to approximately nt⫺19 to⫺11, containing the sequence 5⬘-GACAGGTAA-3⬘.
To identify specific bases important for the binding, we lastly performed competition EMSAs utilizing competitor oligonu-cleotides containing single base pair mutations in the binding site (Fig. 4). While G3C and A3C mutations at nt⫺19 and ⫺18, respectively, recognized the binding complex as efficiently
as did the wild-type competitor (Fig. 4A, lanes 6 to 11 versus lanes 3 to 5), G3C and A3C mutations at nt⫺14 and⫺12, respectively, completely abrogated binding activity (Fig. 4A, lanes 12 to 17 versus lanes 3 to 5). Finally, the mutant with the A3C base change at nt⫺11 retained efficient binding activity (Fig. 4A lanes 19 to 21 versus lanes 3 to 5). Given that the ⫺19/⫺17 cluster point mutation also abrogated binding, we conclude that the 5⬘end of the binding region likely maps to nt ⫺17. Based on the binding data presented here, the 3⬘end of the binding region likely maps to nt⫺12. Thus, the ZV binding site sequence is more accurately defined as 5⬘-CAGGTA-3⬘.
Mutations within ZV relieve transcriptional repression of
the BZLF1 promoter.Having identified a previously unknown
[image:4.612.130.475.78.336.2]sequence-specific binding site in the BZLF1 promoter, we wished to determine the role this element plays in regulating expression of the BZLF1 promoter. To achieve this end, we cloned the wild-type and mutant versions of the nt⫺221 to ⫹10 region of the BZLF1 promoter into a luciferase reporter plasmid. DG75 cells were transiently transfected in parallel with these plasmids and incubated at 37°C for 72 h in the presence or absence of TPA plus ionomycin as inducers. Mu-tations in sequences flanking ZV that do not affect protein binding had little or no effect on the transcriptional activity of the BZLF1 promoter in either the uninduced or the induced state (Fig. 5, mutants⫺23C,⫺22/⫺20CAG, and⫺10/⫺8TCT versus the wild type). On the other hand, mutations that ab-rogate protein binding increased uninduced transcriptional ac-tivity 2- to 4-fold and induced acac-tivity 40- to 180-fold (Fig. 5, mutants⫺19/⫺17 AGT,⫺23C/⫺14C, and⫺12C versus the FIG. 3. The cellular factor ZVR recognizes bases within the⫺19 to⫺11 region of the BZLF1 promoter. (A) Competition EMSAs performed by incubation of 6g of protein obtained from a DG75 nuclear extract with the indicated amounts of the 25-bp oligonucleotides shown in panel B as competitors and approximately 1 ng of the⫺30 to⫹20 radiolabeled probe. The protein-DNA complexes were separated from free probe by electrophoresis in a native 4% polyacrylamide gel. No comp, no competitor. (B) Nucleotide sequences of the oligonucleotides used as competitors in the experiment in panel A and binding affinities for ZVR as determined from these data.
on November 9, 2019 by guest
http://jvi.asm.org/
wild type). Interestingly, the mutations that partially relieve repression of the BZLF1 promoter permit superactivation of transcription by the inducers: whereas the wild-type promoter was activated 6- to 7-fold by the inducers, the mutant promot-ers were activated 20- to 45-fold above their uninduced levels. Thus, we conclude that the⫺17 to⫺12 region of the BZLF1 promoter sequence-specifically binds a factor(s) that can func-tion as a potent repressor of the BZLF1 promoter when in-ducers are not present. We named this factor ZVR, for “ZV regulator.”
Repression of the BZLF1 promoter through the ZV element
requires the presence of ZVR DNA-binding activity.If the ZV
element does, indeed, function by binding ZVR, mutations in ZV may have little effect on transcriptional activity in cell lines lacking ZVR activity. Thus, we tested several additional cell lines for ZVR activity: the HPV-negative human cervical cell line C33A, the human breast cancer cell line MCF-7, and the monkey kidney cell line CV-1. All three are epithelium de-rived. Nuclear extracts were prepared from each of these cell lines and assayed for ZVR DNA-binding activity as described above. The C33A and CV-1 cell lines were found to contain as much ZVR DNA-binding activity as do DG75 cells, if not slightly more (Fig. 6, lanes 5 to 7 and 8 to 10, respectively, versus lanes 2 to 4). MCF-7 cells appeared to lack detectable ZVR DNA-binding activity (Fig. 6, lanes 11 to 13), at least with the electrophoretic mobility observed with the other cell lines. Therefore, MCF-7 cells likely represent a cell line one can use to examine regulation of the BZLF1 promoter in the absence of significant levels of ZVR.
To look for cell-dependent effects on transcription of the
BZLF1 promoter, each of these cell lines was transfected in parallel with luciferase reporter constructs containing the wild-type or⫺23C/⫺14C mutant version of the BZLF1 promoter. Luciferase activity was assayed after incubation for 2 days with or without the inducers. As expected, the mutation in the ZVR element led to approximately three- to fourfold derepression of basal transcription in the ZVR-positive cell lines C33A and CV-1 (Fig. 7A and B). Treatment with TPA plus ionomycin induced wild-type activity approximately sevenfold in C33A cells and three- to fourfold in CV-1 cells. Interestingly, super-activation was not observed with the mutant promoter in either C33A or CV-1 cells. This finding probably reflects differences in other factors involved in the transcriptional regulation of the BZLF1 promoter between epithelial and B-lymphocytic cells. The effects of the mutation in the ZV site and inducers on expression of the BZLF1 promoters were markedly different in the ZVR-negative cell line MCF-7. In this case, both the mu-tation and the inducers had at most marginally significant ef-fects on transcription (Fig. 7C). The former finding provides further support for our hypothesis that the primary function of the ZV element is to serve as a binding site for a regulatory factor. The latter finding may reflect differences between MCF-7 and DG75 cells in their responses to the inducers as well as factors present in these cells. We conclude that, at least for these four cell lines examined to date, a correlation exists between the presence of ZVR DNA-binding activity and reg-ulation of the BZLF1 promoter via the ZV element.
ZVR does not bind previously identified repressor elements
within the BZLF1 promoter.Three other negative cis-acting
elements have previously been identified within the nt⫺221 to FIG. 4. Identification of specific bases within the BZLF1 promoter necessary for binding of ZVR. (A) Competition EMSAs performed by incubation of 6g of protein obtained from a DG75 nuclear extract with the indicated amounts of the 25-bp competitor oligonucleotides shown in panel B and approximately 1 ng of the⫺30 to⫹20 radiolabeled probe. The protein-DNA complexes were separated from free probe by electrophoresis in a native 4% polyacrylamide gel. No comp, no competitor. (B) Nucleotide sequences of the oligonucleotides used as competitors and binding affinities for ZVR as determined from the data shown in panel A.
on November 9, 2019 by guest
⫹20 region of the BZLF1 promoter. No sequence-specific factors have been identified to date that bind these three neg-ative elements. One, called ZIIR, is centered around nt⫺70 (36). Another, HI⑀, is located between nt⫺59 and⫺52 (49). The third region maps to nt ⫺93 to ⫺79 (60). To examine
whether ZVR recognizes any of these sequences, we per-formed EMSAs utilizing as competitors unlabeled double-stranded oligonucleotides containing the sequences of the ZIIR, HI⑀, and⫺93/⫺79 elements (Fig. 8B). None of these oligonucleotides competed effectively for ZVR DNA binding (Fig. 8A). Thus, the factor(s) that binds to the⫺17 to ⫺12 region of the BZLF1 promoter is distinct from the ones yet to be identified that interact with the previously known negative regulatory elements of the BZLF1 promoter.
Effect of EBV latent products on ZVR DNA-binding activity.
To determine the effects of EBV latent proteins on the DNA-binding activity of ZVR, we performed EMSAs with nuclear extracts obtained from two EBV-positive B-lymphocytic cell lines, GG68 and 721. ZVR DNA-binding activity was readily observed in both of these cell lines (Fig. 9). Competition EMSAs with wild-type and mutant oligonucleotides as com-petitors confirmed that these DNA-protein complexes con-tained ZVR (data not shown). Thus, the amount of DNA-binding activity present in B-lymphocytic cells is probably not appreciably affected by the presence of the EBV latent gene products responsible for cellular immortalization. However, the effects EBV latent gene products have on other activities of ZVR, e.g., transcriptional activities, remain unknown.
Treatment with TPA plus ionomycin enhances the
DNA-binding activity of ZVR. The BZLF1 promoter contains a
[image:6.612.80.262.70.474.2]recognizable CRE/AP-1 motif previously shown to be essential for transcriptional activation by phorbol esters (5, 17). Treat-ment with inducing agents enhances the binding activity of the trans-acting factors that recognize these sequences (33). Like-wise, incubation of cells with TPA has been shown to relieve binding activities of transcriptional repressors that recognize elements lying 300 to 400 bp upstream of the transcriptional start site of the BZLF1 promoter (43, 49). To determine
[image:6.612.319.543.462.661.2]FIG. 5. Correlation between binding of ZVR and repression from the BZLF1 promoter. (A) Structure of the wild-type reporter plasmid WTZpLUC constructs. The cloning vector was the pGL3 basic vector, whose sequences are not shown. Arrow, transcription initiation site. The location of the ZV element is indicated, as are sequences encod-ing luciferase (LUC). Nucleotides are numbered relative to the tran-scription initiation site. (B) Effects of ZV mutations on trantran-scription in DG-75 cells. Luciferase reporter plasmids (2g/100-mm dish) con-taining the wild-type sequence or the indicated mutations in the BZLF1 promoter were transfected in parallel into DG75 cells, incu-bated for 72 h, and then harvested. Luciferase activities were deter-mined and normalized to the protein concentration of each extract. The data are presented relative to the activity observed for the wild-type promoter not treated with inducers (rel. to WT). They are the means with standard errors of the means for three sets of transfections performed on different days. (C) Effects of ZV mutations on transcrip-tion in the presence of inducers. Cells were treated in parallel with the ones in panel B, except for incubation after transfection with TPA (20 ng/ml) plus ionomycin (1M) until harvesting.
FIG. 6. ZVR DNA-binding activity is present in C33A and CV-1 cells but not MCF-7 cells. The indicated amounts of protein from nuclear extracts obtained from DG75 cells (lanes 2 to 4), C33A cells (lanes 5 to 7), CV-1 cells (lanes 8 to 10), and MCF-7 cells (lanes 11 to 13) were incubated with approximately 1 ng of the⫺30 to⫹20 radio-labeled probe. The DNA-protein complexes were separated from free probe by electrophoresis in a native 4% polyacrylamide gel.
on November 9, 2019 by guest
http://jvi.asm.org/
whether inducers also affect ZVR DNA-binding activity in ways that might directly contribute toward activation of the BZLF1 promoter, we prepared nuclear extracts from DG75 cells treated with TPA plus ionomycin for 72 h prior to har-vesting the cells. In contrast to the response observed with previously identified transcriptional repressors of the BZLF1 promoter, treatment with TPA plus ionomycin led to a three-fold enhancement of ZVR DNA-binding activity (Fig. 10A, lanes 2 to 4 versus lanes 5 to 7). Competition EMSAs con-firmed that this binding activity was, indeed, ZVR (Fig. 10B). Thus, we conclude that induction of the BZLF1 promoter by TPA plus ionomycin does not occur in part via inactivation of binding of ZVR to the BZLF1 promoter. Other models by which it might act are discussed below.
DISCUSSION
We report here the identification within the BZLF1 pro-moter of a previously unknown regulatory element called ZV and the cellular factor(s), named ZVR, which sequence-spe-cifically binds to it. The ZV element maps to nt⫺17 to⫺12 of the BZLF1 promoter (Fig. 3 and 4), although flanking bases may contribute to its specificity. We demonstrated a correla-tion between binding of ZVR to the ZV element and regula-tion of the BZLF1 promoter both with mutaregula-tions in the ZV element (Fig. 5) and with cell lines lacking ZVR DNA-binding activity (Fig. 6 and 7). We further showed that ZVR does not bind to previously identified negative regulatory elements of the BZLF1 promoter (Fig. 8). Thus, we conclude that ZVR is a previously unknown regulator of the BZLF1 promoter. Fi-nally, we found that ZVR DNA-binding activity remains abun-dant in lymphocytes that had been immortalized by EBV and express EBV’s latent gene products (Fig. 9), and it is not inactivated by treatment of cells with the inducers TPA and ionomycin (Fig. 10).
ZV element.Using EMSAs and nuclear extracts from DG75
cells as a protein source, we identified a novel factor-binding site located at nt⫺17 to⫺12 of the BZLF1 promoter (Fig. 2
to 4). Our data showed that these 6 bp are required for binding activity. Mutations outside this region did not affect binding. However, we have not ruled out the possibility that additional bases also contribute to binding specificity.
FIG. 7. The presence of ZVR correlates with regulation of expression of the BZLF1 promoter via the ZV element. Luciferase reporter plasmids (2g/100-mm dish) containing the wild-type sequence or the⫺23C/⫺14C mutation in the BZLF1 promoter were transfected in parallel into C33A (A), CV-1 (B), and MCF-7 (C) cells. Cells were incubated for 48 h with or without TPA (20 ng/ml) plus ionomycin (1M) and then harvested. Luciferase activities (act.) were determined and normalized to the protein concentration of each extract. The data are presented relative to the activity observed for the wild-type promoter not treated with inducers (rel. to WT). They are the means with standard errors of the means for three experiments performed on different days.
FIG. 8. ZVR is a previously unidentified DNA-binding factor. (A) Competition EMSAs performed by incubation of 6 g of nuclear extract obtained from DG75 cells with the radiolabeled⫺30 to⫹20 region oligonucleotide as probe and the indicated amounts of unla-beled⫺30 to⫹20 wild-type DNA (lanes 3 to 5),⫺23/⫺14 mutant DNA (lanes 6 to 8), or the double-stranded oligonucleotides shown in panel B containing the ZIIR (lanes 9 to 11), the HI⑀(lanes 12 to 14), or the⫺93/⫺79 (lanes 15 to 17) element as a competitor. (B) Se-quences of the oligonucleotides used as competitors in the experiment shown in panel A. Bases shown by others to play roles in repression of the BZLF1 promoter are boxed.
on November 9, 2019 by guest
Interestingly, the ZV element lies between the ⫺30 and initiator basal elements of the BZLF1 promoter. There are numerous viral promoters that contain regulatory sequences at this location. For example, we have previously identified a regulatory element that overlaps the initiator site of the simian virus 40 major late promoter (56). Binding of specific members of the nuclear factor receptor superfamily to this element pre-vents the formation of transcriptional preinitiation complexes (61–63). Likewise, Yu and Mertz (59) found a hormone re-sponse element that overlaps the⫺30 element of the human hepatitis B virus pre-C promoter.
Both the major immediate-early gene and the US3 gene promoters of human cytomegalovirus contain cis repression sequences that lie immediately upstream of their respective transcriptional start sites (3, 4, 8, 35, 39, 40, 47). The regulatory effect of this sequence is position dependent; that is, these sequences no longer repress when placed upstream of the TATA box or downstream of the initiator (35). Whether the location of the ZV element is important for its effects on transcription of the BZLF1 promoter remains to be deter-mined.
Role of ZVR in regulation of the BZLF1 promoter. Our
experiments demonstrated a correlation between binding of ZVR to the ZV element and repression of the BZLF1 pro-moter. First, we found that promoters containing mutations in the ZV element that abrogated ZVR binding exhibited higher levels of both basal and induced transcription than the wild-type promoter in ZVR-positive cells (Fig. 3 to 7). Second, statistically significant differences were not observed between the wild-type and mutant promoters in the cell line MCF-7, which lacks ZVR DNA-binding activity (Fig. 7C). Thus, the
ZV element is a regulatory element of the BZLF1 promoter that functions as a transcriptional silencing element in the absence of inducers.
[image:8.612.89.255.70.299.2]Interesting was the finding that some mutants exhibited su-peractivation of transcription by inducers in DG75 cells, i.e., levels of transcription from the BZLF1 promoter after induc-tion that were significantly greater than the product of the increases due to the mutation and inducers alone (e.g., Fig. 5, mutant⫺23C/⫺14C). One hypothesis to explain this finding is the following. The wild-type BZLF1 promoter is normally qui-escent in B lymphocytes and other ZVR-positive cell types because it is bound by multiple negative regulatory factors, including ZVR, repressing transcription (Fig. 11, diagram A1). Treatment with exogenous inducers leads to modest activation of transcription of the BZLF1 promoter through signal trans-duction pathways affecting the activities of some of the positive and negative trans-acting regulatory factors that bind re-sponsivecis-acting elements situated throughout the BZLF1 promoter (Fig. 11, diagram A2). Mutations in the ZVR DNA-binding site prevent ZVR DNA-binding, leading to partial, incom-plete derepression of basal transcription because other repres-sors remain bound to the promoter (Fig. 11, diagram A3). Treatment with inducers leads to superactivation of transcrip-tion of ZV mutant promoters because, in this case, neither FIG. 9. Presence of EBV’s products expressed during latency does
not affect the DNA-binding activity of ZVR. Nuclear extracts were prepared from the EBV-negative cell line DG75 (lanes 2 to 4) and the EBV-positive cell lines 721 (lanes 5 to 7) and GG68 (lanes 8 to 10). The indicated amounts of protein from these extracts were incubated with approximately 1 ng of the⫺30 to⫹20 region radiolabeled probe. The DNA-protein complexes were separated from free probe by elec-trophoresis in a native 4% polyacrylamide gel.
FIG. 10. ZVR DNA-binding activity is increased by treatment with inducers of the BZLF1 promoter. (A) EMSAs performed with the indicated amounts of protein obtained from a nuclear extract prepared from DG75 cells either untreated (lanes 2 to 4) (⫺) or treated (lanes 5 to 7) (⫹) with TPA (20 ng/ml) plus ionomycin (1M) for 72 h prior to harvesting. Each reaction mixture also contained approximately 1 ng of radiolabeled probe corresponding to the⫺30 to⫹20 region of the BZLF1 promoter. The protein-DNA complexes were separated from free probe by electrophoresis in a native 4% polyacrylamide gel. The position of the ZVR-DNA complex is indicated. (B) Competition EMSAs performed with nuclear extract prepared from DG75 cells treated with TPA (20 ng/ml) plus ionomycin (1M). The reactions were performed with 6g of protein, the indicated amounts of the unlabeled wild-type (lanes 3 to 5) or mutant (lanes 6 to 8) double-stranded oligonucleotides shown in Fig. 3B as competitors, and the radiolabeled probe corresponding to the⫺30 to⫹20 region of the BZLF1 promoter. No comp, no competitor.
on November 9, 2019 by guest
http://jvi.asm.org/
[image:8.612.313.547.359.568.2]ZVR nor the repressors that are inactivated by the inducers remain bound (Fig. 11, diagram A4). Superactivation of the mutant promoters does not occur in the ZVR-positive epithe-lial cells because of cell-type-specific differences in available signal transduction pathways and regulatory factors (Fig. 11, diagrams B1 to B4). In addition, basal activity in these cells may already be higher than it is in B lymphocytes because of an absence of some of the sequence-specific repressors of this promoter. In the absence of both ZVR and the B-lymphocytic factors and pathways, neither mutation of the ZV element nor inducers have a significant effect on transcription of the BZLF1 promoter (Fig. 11, diagrams C1 to C4). Quite likely, the tissue tropism of EBV is related to these differences.
Effect of EBV-encoded factors on ZVR activities.Negative
regulatory elements of the BZLF1 promoter lie both within (36, 43, 60) and outside (42, 43, 49) the⫺221 to⫹20 region. We showed here that ZVR does not bind any of the known proximal negative elements (Fig. 8). Specific factors that rec-ognize the distal negative elements have been found only in nuclear extracts obtained from cells latently infected with EBV (49). We found that ZVR is abundant not only in B lympho-cytes that express EBV’s latent gene products (Fig. 9) but also in B lymphocytes that do not (Fig. 2 to 4). Thus, ZVR DNA-binding activity is independent of EBV status. Therefore, we conclude that ZVR is, indeed, distinct from any of the previ-ously identified repressors of the BZLF1 promoter.
Effect of inducers on ZVR activities.We found that
treat-ment of cells with the inducers TPA and ionomycin did not
eliminate the DNA-binding activity of ZVR; if anything, it enhanced it (Fig. 10). Likewise, Grove and Mastro (24) found enhanced binding activity in extracts obtained from TPA-treated bovine lymphocytes of a transcription factor that inter-acts with the negative regulatory element (NRE-A) of the interleukin-2 (IL-2) promoter. Since the sequences of these two elements are identical, it is quite likely that we have iden-tified a similar binding activity. Yet to be determined is the effect of inducers on ZVR’s transcriptional activities. Possibly, inducers change ZVR from a repressor to an activator by modifying ZVR directly or altering factors with which it inter-acts, e.g., corepressor and coactivator complexes, some of which may be lymphoid specific. The inducers may also be directly or indirectly increasing the specific DNA-binding ac-tivity or half-life of ZVR. Alternatively, although less likely, the inducers may lead indirectly to another, similar-mobility factor binding to the ZV site. On the other hand, treatment of EBV-positive cells with TPA relieves binding to the distal HI and YY1 elements (43, 49). Thus, relief of repression and activation of transcription represent non-mutually exclusive mechanisms by which TPA may induce the transcriptional ac-tivity of the BZLF1 promoter.
Possible identity of ZVR.We showed here that ZVR
recog-nizes the sequence 5⬘-CAGGTA-3⬘. This sequence is identical to the NRE-A within the IL-2 promoter (57). Originally, a T-cell-specific zinc finger binding protein, termed Nil-2-a, was identified as the transcription factor that mediates its effects through NRE-A (57). Subsequently, a similar zinc finger/ho-FIG. 11. Model for regulation of the BZLF1 promoter by ZVR. See the text for details. Relative levels of transcription are indicated by the heights and thicknesses of the arrows. Rectangles, ZV elements; X, mutations within the ZV element; R, cellular repressors inactivated by inducers such as TPA; A, sequence-specific positive factors activated by inducers in B lymphocytes (triangles) or positive factors present in epithelial cells (rhomboids).
on November 9, 2019 by guest
[image:9.612.127.481.71.351.2]meodomain protein, termed ZEB for “zinc finger E-box bind-ing protein,” was isolated from B cells (19, 20, 58). It is now known that Nil-2-a is a partial cDNA clone of ZEB. ZEB represents the full-length protein and is present in a number of cell types including T cells.
We also found that ZVR binds to the sequence 5⬘-CAGG TG-3⬘ (data not shown). Thus, the sequences recognized by ZVR, 5⬘-CAGGT(A/G)-3⬘, do not match those of a consensus E box [CAC(C/G)(T/G)(G/T)] but can be defined as E box like (19). Previous reports show that ZEB binds these sequences (19, 20). Therefore, based on binding sequence specificity, we hypothesize that ZVR may be ZEB or a closely related zinc finger/homeodomain protein family member (6).
Role of ZVR in the life cycle of EBV. The fundamental
question yet to be answered is the role played by ZVR in EBV latency and the induction out of latency. We hypothesize that ZVR repressor activity may predispose a cell toward establish-ing a latent state of infection. Target cells of EBV lackestablish-ing ZVR repressor activity may overproduce Zta, producing infectious virus rather than entering a latent immortalized state. Gener-ating strains of EBV containing mutations within the ZV ele-ment and cell lines with levels of ZVR that can be regulated experimentally should enable one to determine the role of this regulatory element and itstrans-acting factors in the life cycle of EBV.
ACKNOWLEDGMENTS
The first two authors contributed equally to this work.
We thank Sam Speck for plasmid⫺221ZpCAT. We are especially grateful to Bill Sugden and members of his laboratory for the B-lymphocytic cell lines and advice for growing them as well as helpful discussions and comments on this paper. We also thank members of the Mertz laboratory for helpful discussions.
This work was supported by Public Health Service research grants CA22443 and CA07175 from the National Cancer Institute.
REFERENCES
1.Angel, P., M. Imagawa, R. Chiu, B. Stein, R. J. Imbra, H. J. Rahmsdorf, C. Jonat, P. Herrlich, and M. Karin.1987. Phorbol ester-inducible genes con-tain a commonciselement recognized by a TPA-modulatedtrans-acting factor. Cell49:729–739.
2.Bauer, G., P. Ho¨fler, and H. zur Hausen.1982. Epstein-Barr virus induction by a serum factor. I. Induction and cooperation with additional inducers. Virology121:184–194.
3.Biegalke, B. J.1995. Regulation of human cytomegalovirus US3 gene tran-scription by acis-repressive sequence. J. Virol.69:5362–5367.
4.Biegalke, B. J.1997. IE2 protein is sufficient for transcriptional repression of the human cytomegalovirus US3 promoter. J. Virol.71:8056–8060. 5.Borras, A. M., J. L. Strominger, and S. H. Speck.1996. Characterization of
the ZI domains in the Epstein-Barr virus BZLF1 gene promoter: role in phorbol ester induction. J. Virol.70:3894–3901.
6.Chamberlain, E. M., and M. M. Sanders.1999. Identification of the novel player␦EF1 in estrogen transcriptional cascades. Mol. Cell. Biol.19:3600– 3606.
7.Chatila, T., N. Ho, P. Liu, S. Liu, G. Mosialos, E. Kieff, and S. H. Speck. 1997. The Epstein-Barr virus-induced Ca2⫹/calmodulin-dependent kinase type IV/Gr promotes a Ca2⫹-dependent switch from latency to viral repli-cation. J. Virol.71:6560–6567.
8.Cherrington, J. M., E. L. Khoury, and E. S. Mocarski.1991. Human cyto-megalovirusie2 negatively regulates␣gene expression via a short target sequence near the transcription start site. J. Virol.65:887–896.
9.Chevallier-Greco, A., E. Manet, P. Chavrier, C. Mosnier, J. Daillie, and A. Sergeant.1986. Both Epstein-Barr virus (EBV)-encodedtrans-acting factors, EB1 and EB2, are required to activate transcription from an EBV early promoter. EMBO J.5:3243–3249.
10. Countryman, J., and G. Miller.1985. Activation of expression of latent Epstein-Barr herpesvirus after gene transfer with a small cloned subfragment of heterogeneous viral DNA. Proc. Natl. Acad. Sci. USA82:4085–4089. 11. Countryman, J., H. Jenson, R. Seibl, H. Wolf, and G. Miller.1987.
Poly-morphic proteins encoded within BZLF1 of defective and standard
Epstein-Barr viruses disrupt latency. J. Virol.61:3672–3679.
12. Daibata, M., S. H. Speck, C. Mulder, and T. Sairenji.1994. Regulation of the BZLF1 promoter of Epstein-Barr virus by second messengers in anti-immu-noglobulin-treated B cells. Virology198:446–454.
13. Delegeane, A. M., L. H. Ferland, and P. L. Mellon.1987. Tissue-specific enhancer of the human glycoprotein hormone␣-subunit gene: dependence on cyclic AMP-inducible elements. Mol. Cell. Biol.7:3994–4002. 14. Dignam, J. D., R. M. Lebovitz, and R. R. Roeder.1983. Accurate
transcrip-tion initiatranscrip-tion by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res.11:1475–1489.
15. Faggioni, A., C. Zompetta, S. Grimaldi, G. Barile, L. Frati, and J. Lazdins. 1986. Calcium modulation activates Epstein-Barr virus genome in latently infected cells. Science232:1554–1556.
16. Farrell, P. J., D. T. Rowe, C. M. Rooney, and T. Kouzarides.1989. Epstein-Barr virus BZLF1trans-activator specifically binds to a consensus AP-1 site and is related to c-fos. EMBO J.8:127–132.
17. Flemington, E., and S. H. Speck.1990. Identification of phorbol ester re-sponsive elements in the promoter of Epstein-Barr virus putative lytic switch gene BZLF1. J. Virol.64:1217–1226.
18. Flemington, E., and S. H. Speck.1990. Autoregulation of Epstein-Barr virus putative lytic switch gene BZLF1. J. Virol.64:1227–1232.
19. Genetta, T., D. Ruezinsky, and T. Kadesch.1994. Displacement of an E-box-binding repressor by basic helix-loop-helix proteins: implications for B-cell specificity of the immunoglobulin heavy-chain enhancer. Mol. Cell. Biol. 14:6153–6163.
20. Genetta, T., and T. Kadesch.1996. Cloning of a cDNA encoding a mouse transcriptional repressor displaying striking sequence conservation across vertebrates. Gene169:289–290.
21. Goldfeld, A. E., P. Liu, S. Liu, E. K. Flemington, J. L. Strominger, and S. H. Speck.1995. Cyclosporin A and FK506 block induction of the Epstein-Barr virus lytic cycle by anti-immunoglobulin. Virology209:225–229.
22. Good, P. J., R. C. Welch, W.-S. Ryu, and J. E. Mertz.1988. The late spliced 19S and 16S RNAs of simian virus 40 can be synthesized from a common pool of transcripts. J. Virol.62:563–571.
23. Grogan, E., H. Jenson, J. Countryman, L. Heston, L. Gradoville, and G. Miller.1987. Transfection of a rearranged viral DNA fragment, WZhet, stably converts latent Epstein-Barr viral infection to productive infection in lymphoid cells. Proc. Natl. Acad. Sci. USA84:1332–1336.
24. Grove, D. S., and A. M. Mastro.1996. Modulation of the levels of a negative transcription factor for IL-2 by 12-O-tetradecanoyl phorbol-13-acetate and okadaic acid. Cytokine8:809–816.
25. Habener, J. F.1990. Cyclic AMP response element binding proteins: a cornucopia of transcription factors. Mol. Endocrinol.4:1087–1094. 26. Kallin, B., J. Luka, and G. Klein.1979. Immunochemical characterization of
Epstein-Barr virus-associated early and late antigens inn-butyrate-treated P3HR-1 cells. J. Virol.32:710–716.
27. Kavathas, P., F. H. Bach, and R. DeMars.1980. Gamma ray-induced loss of expression of HLA and glyoxalase 1 alleles in lymphoblastoid cells. Proc. Natl. Acad. Sci. USA77:4251–4255.
28. Kieff, E., and D. Liebowitz.1990. Epstein-Barr virus and its replication, p. 1889–1920.InB. N. Fields, D. M. Knipe, R. M. Chanock, M. S. Hirsch, J. L. Melnick, T. P. Monath, and B. Roizman (ed.), Fields virology, 2nd ed. Raven Press, New York, N.Y.
29. Kieff, E., and D. Liebowitz.1991. Epstein-Barr virus and its replication, p. 897–928.InB. N. Fields and D. M. Knipe (ed.), Fundamental virology, 2nd ed. Raven Press, New York, N.Y.
30. Kieff, E.1995. Epstein-Barr virus and its replication, p. 2343–2396.InB. N. Fields, D. M. Knipe, P. M. Howley, R. M. Chanock, J. L. Melnick, T. P. Monath, B. Roizman, and S. E. Straus (ed.), Fields virology, 3rd ed. Lippin-cott, Philadelphia, Pa.
31. Knutson, J. C., and B. Sugden.1989. Immortalization of B lymphocytes by Epstein-Barr virus: what does the virus contribute to the cell? Adv. Viral Oncol.8:151–172.
32. Laux, G., U. K. Freese, R. Fischer, A. Polack, E. Kofler, and G. W. Bornkamm.1988. TPA-inducible Epstein-Barr virus genes in Raji cells and their regulation. Virology162:503–507.
33. Lee, W., P. Mitchell, and R. Tjian.1987. Purified transcription factor AP-1 interacts with TPA-inducible enhancer elements. Cell49:741–752. 34. Liu, S., A. M. Borras, P. Liu, G. Suske, and S. H. Speck.1997. Binding of the
ubiquitous cellular transcription factors Sp1 and Sp3 to the ZI domains in the Epstein-Barr virus lytic switch BZLF1 gene promoter. Virology228:11– 18.
35. Liu, B., T. W. Hermiston, and M. F. Stinski.1991. Acis-acting element in the major immediate-early (IE) promoter of human cytomegalovirus is required for negative regulation by IE2. J. Virol.65:897–903.
36. Liu, P., S. Liu, and S. H. Speck.1998. Identification of a negativeciselement within the ZII domain of the Epstein-Barr virus lytic switch BZLF1 gene promoter. J. Virol.72:8230–8239.
37. Liu, S., P. Liu, A. Borras, T. Chatila, and S. H. Speck.1997. Cyclosporin A-sensitive induction of the Epstein-Barr lytic switch is mediated via a novel pathway involving a MEF2 family member. EMBO J.16:143–153. 38. Luka, J., B. Kallin, and G. Klein.1979. Induction of the Epstein-Barr virus
on November 9, 2019 by guest
http://jvi.asm.org/
45. Niederman, J. C., A. S. Evans, L. Subrahmanyan, and R. W. McCollum. 1970. Prevalence, incidence and persistence of EB virus antibody in young adults. N. Engl. J. Med.282:361–365.
46. Patton, D. F., R. C. Ribeiro, J. J. Jenkins, and J. W. Sixbey.1994. Thymic carcinoma with a defective Epstein-Barr virus encoding the BZLF1trans -activator. J. Infect. Dis.170:7–12.
47. Pizzorno, M. C., and G. S. Hayward.1990. The IE2 gene products of human cytomegalovirus specifically down-regulate expression from the major imme-diate-early promoter through a target sequence located near the cap site. J. Virol.64:6154–6165.
48. Sambrook, J., E. F. Fritsch, and T. Maniatis.1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
49. Schwarzmann, F., N. Prang, B. Reichelt, B. Rinkes, S. Haist, M. Marschall, and H. Wolf.1994. Negativelycis-acting elements in the distal part of the promoter of Epstein-Barr virus trans-activator gene BZLF1. J. Gen. Virol. 75:1999–2006.
50. Shimizu, N., and K. Takada.1993. Analysis of the BZLF1 promoter of Epstein-Barr virus: identification of an anti-immunoglobulin response se-quence. J. Virol.67:3240–3245.
51. Sixbey, J. W., J. G. Nedrud, N. Raab-Traub, R. A. Hanes, and J. S. Pagano.
1794.
58. Yasui, D. H., T. Genetta, T. Kadesch, T. M. Williams, S. L. Swain, L. V. Tsui, and B. T. Huber.1998. Transcriptional repression of the IL-2 gene in Th cells by ZEB. J. Immunol.160:4433–4440.
59. Yu, X., and J. E. Mertz.1996. Promoters for the synthesis of the pre-C and pregenomic mRNAs of human hepatitis B virus are genetically distinct and differentially regulated. J. Virol.70:8719–8726.
60. Zhang, Q., Y.-C. J. Wang, and E. A. Montalvo.1999. Sbp-2 represses the Epstein-Barr virus lytic switch promoter. Virology255:160–170.
61. Zuo, F., and J. E. Mertz.1995. Simian virus 40 late gene expression is regulated by members of the steroid/thyroid hormone receptor superfamily. Proc. Natl. Acad. Sci. USA92:8586–8590.
62. Zuo, F., R. J. Kraus, T. Gulick, D. D. Moore, and J. E. Mertz.1997. Direct modulation of simian virus 40 late gene expression by thyroid hormone and its receptor. J. Virol.71:427–436.
63. Zuo, F.1995. Regulation of the SV40 late promoter by members of the steroid/thyroid hormone receptor superfamily. Ph.D. thesis. University of Wisconsin—Madison, Madison, Wis.
64. zur Hausen H., F. J. O’Neill, U. K. Freese, and E. Hecker.1978. Persisting oncogenic herpesvirus induced by the tumour promoter TPA. Nature272: 373–375.