Supplementary Materials for

Supplementary Materials for

PI(3,4)P2-mediated cytokinetic abscission prevents early senescence and cataract formation

Federico Gulluni et al.

Corresponding authors: Federico Gulluni, [email protected]; Emilio Hirsch, [email protected]

Science 374, eabk0410 (2021) DOI: 10.1126/science.abk0410

The PDF file includes:

Figs. S1 to S20 Tables S1 to S3

Other Supplementary Material for this manuscript includes the following:

MDAR Reproducibility Checklist Movies S1 to S7

2 Fig. S1. Loss of PI3K-C2α leads to senescence in fibroblasts and lens cells. (A) Representative images of SA-β-gal positive fibroblasts derived from Family I, II and III after two weeks in culture. +/+ and Fam-I^-/- pictures are also reported in Fig. 1A. (B) Quantification and representative images of SA-β-gal positive wild type, Pik3c2a^+/- and Pik3c2a^-/- MEFs. Pik3c2a^-/- MEFs were transfected with either GFP-PI3K-C2α wild type (WT) or GFP-PI3K-C2α kinase inactive (KD) form. (C) Quantification and representative images of SA-β-gal positive HLE-B3 lens cells treated with either control or PI3K-C2α

3 siRNA. siRNA treated HLE-B3 cells were transfected with either GFP-PI3K-C2α wild type (WT) or GFP-PI3K-C2α kinase inactive (KD) form. (D) Immunoblot analysis of p16INK4A protein expression in fibroblasts derived from Families II and III after two weeks in culture. (E) Gene expression (Log2 fold change) of the cyclin-dependent kinase inhibitors p16INK4A and p21, as determined by RT-qPCR, in human fibroblasts and HLE- B3. (F) Gene expression (fold change) of BCL2/BAX ratio of mRNA abundance in human fibroblasts and HLE-B3. (G-H) Gene expression (Log2 fold change) of a panel of SASP factors as determined by RT-qPCR, in human fibroblasts (G) and HLE-B3 (H). *P<0.05;

**P<0.01; ***P<0.001 (unpaired two-tailed Welch's t-test with Dunnett's multiple comparison). (I) Immunoblot analysis of p16INK4A protein level in HLE-B3 lens epithelial cells treated with control or PI3K-C2α siRNA. (J) Immunoblot analysis (left) and protein quantification (right) of p16INK4A protein level in wild-type patient-derived fibroblasts treated with 60 μM PITCOIN1 inhibitor added to normal culture medium every 24 hours for 4 days. If not previously specified, all results are shown as mean or representative picture of at least three independent experiments ± SEM (*P<0.05;

**P<0.01; ***P<0.001).

4 Fig. S2. Loss of PI3K-C2α leads to senescence in zebrafish. (A) Immunoblot analysis (left) and protein quantification (right) of PI3K-C2α in control and pik3c2a morphant 72 hpf embryos (n=4 pools of 15 embryos each). (B) Representative images of SA-β-gal intensity on the lens and body of control and pik3c2a morphant 72 hpf embryos. (C) Gene expression (Log2 fold change) of the cyclin-dependent kinase inhibitors p16INK4A and p21, as determined by RT-qPCR, in 72 hpf embryos (n=3 pools of 15 embryos each). (D) Gene expression (fold change) of BCL2/BAX ratio in in 72 hpf embryos (n=3 pools of 15 embryos each). (E) Gene expression (Log2 fold change) of a panel of SASP factors as determined by RT-qPCR, in 72 hpf embryos. *P<0.05; **P<0.01; ***P<0.001 (unpaired two-tailed Welch's t-test with Dunnett's multiple comparison) (n=3 pools of 15 embryos each). (F) Immunoblot analysis (left) and protein quantification (right) of p16INK4A protein level of 72 hpf zebrafish wild-type embryos treated with daily changed 40 μM PITCOIN1 inhibitor in standard fish water (n=11 pools of 10-15 embryos each). If not previously specified, all results are shown as mean or representative picture of at least three independent experiments ± SEM (*P<0.05; **P<0.01; ***P<0.001).

5 Fig. S3. Loss of PI3K-C2α leads to cataract in zebrafish and human, and increased senescence in the mouse lens. (A) Adult zebrafish were anesthetized with tricaine and examined. Coaxial illumination using a Leica M841 surgical microscope was used to visualize lenticular defects. Optical sectioning by changing the z-axis focus was used to aid in the identification of cataracts. All zebrafish examined for cataracts were offspring of a cross between pik3c2a^sa10124/+ and pik3c2a^sa12328/+ fish. (B) Representative images of posterior lenticonus cataract in one of the PIK3C2A-null patients. Arrows indicate opacities in lens. (C) Representative images of eyes and their H&E-stained sections derived from a wild-type and a Pik3c2a^hypo/hypo mouse 30 days after birth. (D) Immunohistochemistry using anti-KI-67 antibody in eye sections from wild-type and Pik3c2a^hypo/hypo mice at 30 days after born and quantification of percentage of KI-67 positive nuclei in wild-type and Pik3c2a^hypo/hypo mice. (E) Immunohistochemistry using anti-p16INK4A antibody in eye

6 sections as in (C) from wild-type and Pik3c2a^hypo/hypo mice at 30 days after birth. If not previously specified, all results are shown as mean or representative picture of at least three independent experiments ± SEM (*P<0.05; **P<0.01; ***P<0.001).

7 Fig. S4. Loss of PI3K-C2α leads to cataract onset and increased expression of senescence markers in mice. (A) Protein quantification (left) and immunoblot analysis (right) of p16INK4A protein level in lens of adult mice homozygous for a floxed Pik3c2a allele with (Cre+) or without (control, Cre-) tamoxifen-inducible Cre one month after tamoxifen administration by eye drop. (B) Gene expression (Log2 fold change) of the cyclin-dependent kinase inhibitors p16INK4A and p21, as determined by RT-qPCR, in tamoxifen-inducible Cre mice lens after one month from tamoxifen administration by eye drop. (C) Gene expression (fold change) of BCL2/BAX ratio in tamoxifen-inducible Cre mice lens after one month from tamoxifen administration by eye drop. (D) Gene expression (Log2 fold change) of a panel of SASP factors as determined by RT-qPCR, in tamoxifen- inducible Cre mice lens after one month from tamoxifen administration by eye drop.

*P<0.05; **P<0.01; ***P<0.001 (unpaired two-tailed Welch's t-test with Dunnett's multiple comparison). (E) Representative pictures of control (left pictures) and cataract (center and right pictures) observed in tamoxifen-inducible Cre mice lens after three months from tamoxifen administration by eye drop. If not previously specified, all results are shown as mean or representative picture of at least three independent experiments ± SEM (*P<0.05; **P<0.01; ***P<0.001).

8 Fig. S5. Loss of PI3K-C2α impairs cytokinesis. (A) Flow cytometry analysis measuring DNA content (propidium iodide staining) at 72 hpf of control and pik3c2a morphant dissociated head cells (mean ± SEM; n=6 pools of 15 embryos each). (B) Flow cytometry analysis as in panel A of wild-type dissociated head cells derived from embryos treated for 3 days with PITCOIN1 or vehicle (mean ± SEM; n=5 pools of 15 embryos each). (C) Representative flow cytometry profile of DNA content in control and morphant 72hpf embryos head cells. (D, E) Confocal images of whole-mount immunofluorescence

9 performed on 72 hpf embryos lens using MKLP1 (red) and α-tubulin (cyan) antibodies to stain midbody and SYTOX Green (green) to stain nuclei. In (D) are reported representative pictures showing lens cells either connected by midbody (MKLP1)/ α-tubulin in cytokinesis (included in the quantification in E, right panel) or positive for MKLP1 only (likely a midbody remnant, excluded from the quantification in E, right panel). (F-H) Time lapse microscopy measurements. Time required to progress from anaphase onset to abscission in wild-type, Pik3c2a^+/- and Pik3c2a^-/- MEFs (F, G) and percentage of refusion and cell death events in cytokinesis (H). (I) Number of binucleated wild-type, Pik3c2a^+/- and Pik3c2a^-/- MEFs at 7 and 14 days after preparation from mouse embryos (at least 50 cells per genotype were counted). (J) Number of binucleated wild-type or PIK3C2A^-/- fibroblasts after 14 days in culture. All individual genotypes (+/+ or -/- respectively) were polled together in the chart. If not previously specified, all results are shown as mean or representative picture of at least three independent experiments ± SEM (*P<0.05;

**P<0.01; ***P<0.001).

10 Fig. S6. Delayed abscission leads to increased expression of p16INK4A. (A) Immunofluorescence staining of p16INK4A (red), α-tubulin (green) and DNA (blue), in wild-type and PI3K-C2α knock-out fibroblast. Images in the top-right and bottom show a

11 wider field of what reported in Fig. 1K. (B) Immunolabeling as in panel (A) of HLE-B3 lens epithelial cells. (C-E) Quantification of p16INK4A expression in the nucleus during cytokinesis and in binucleated cells in human fibroblasts (C) and HLE-B3 (D, E). If not previously specified, all results are shown as mean or representative picture of at least three independent experiments ± SEM (*P<0.05; **P<0.01).

12

13 Fig. S7. PI3K-C2α localizes at midbody and its loss leads to defective abscission in HeLa cells. (A-E) Time-lapse analysis of HeLa cells infected with control and PI3K-C2α sh-RNA carrying a GFP reporter. Sh1 and Sh2 treated cells are shown as pulled together.

(F) Immunofluorescence staining using anti-α-tubulin and anti-PI3K-C2α or anti-GFP (GFP-tagged PI3K-C2α transfected cells) showing enrichment of PI3K-C2α at the midbody during late cytokinesis in HeLa. (G) Immunofluorescence staining using anti- PI3K-C2α in control and siRNA-treated cells during late cytokinesis. If not previously specified, all results are shown as mean or representative picture of at least three independent experiments ± SEM (*P<0.05; **P<0.01; ***P<0.001).

14 Fig. S8. PI3K-C2α localizes at midbody in HLE-B3 and HeLa cells. (A-B) Immunofluorescence staining using anti-PI3K-C2α (A) and GFP-tagged PI3K-C2α (B) showing enrichment of PI3K-C2α at the midbody during late cytokinesis in HLE-B3. (C) Representative time points extracted from Movie S3. HeLa cells were transfected with GFP-PI3K-C2α and imaged by Leica SP8 confocal microscopy every 2 minutes. If not previously specified, all results are shown as mean or representative picture of at least three independent experiments.

15 Fig. S9. Localization of PI3K-C2α mutants at midbody. (A) HeLa cells where transfected with wild-type, kinase inactive (KD), clathrin-binding deletion (Δ1-380) and PX-binding mutant PI3K-C2α. Immunofluorescence using anti-GFP antibody showing the enrichment of the different PI3K-C2α constructs. Enlarged panels are reported in Fig. 2C.

(B) The 3D molecular model of the PI3K-C2α portion (aa 861-1397) is depicted as cartoon.

Helical domain (aa. 861-1037) and PI3K/PI4K domain (aa. 1133-1397) are shown in yellow and blue. Predicted sequence (P sequence) for binding to gamma-tubulin is marked in red, TM-score of 0.85±0.08 with a RMSD of 5.3±3.4 Å. (C) Model of PI3K-C2α-γ- tubulin. Protein structures are depicted with their surface colored. Gamma tubulin is represented in light cyan, protein-protein interface region is 966.6 Å2 and the calculated binding energy is -598.970 kJ/mol. (D) List of the most important residues driving the PI3K-C2α-γ-tubulin interaction (hb: hydrogen bond; vdw: van der Waals interaction; π-π:

pi stacking interaction). (E, F) Schematic representation of GFP-γ-tubulin-binding domain

16 (GFP-GBD) and its colocalization with γ-tubulin at centrosome. If not previously specified, all results are shown as mean or representative picture of at least three independent experiments.

17 Fig. S10. Analysis of LAP2 positive bridges in siRNA treated HeLa cells. (A) Immunoblot on HeLa cells showing the efficiency of siRNA used to knock-down the expression of CHMP4B, VPS36, TSG101 and PI3K-C2α. (B) Immunofluorescence of HeLa cells transfected with control siRNA, siRNA targeting PI3K-C2α, siRNA targeting PI3K-C2α + PI3K-C2α^WT and siRNA targeting PI3K-C2α + PI3K-C2α^KD stained with anti- LAP2 antibody, anti-α-tubulin antibody and DAPI. If not previously specified, all results are shown as mean or representative picture of at least three independent experiments ± SEM (*P<0.05).

18 Fig. S11. Localization of phosphoinositides during cytokinesis. (A) Immunofluorescence staining using anti-PI(3,4,5)P3 antibody in HeLa cells during cytokinesis. (B) Immunofluorescence staining using anti-PI(3)P antibody in HeLa cells during cytokinesis. (C) Immunofluorescence staining using anti-PI(3)P antibody in HeLa cells during cytokinesis; enlarged view of midbody shown in Fig.3B. (D) Immunofluorescence using anti-PI(3,4)P2 antibody in HeLa cells during cytokinesis;

enlarged view of midbody shown in Fig.3C. (E) Immunofluorescence using either anti- PI(3,4)P2 antibody (upper panel) or anti-GFP antibody (lower panel, cells transfected with

19 GFP-TAPP1-PH plasmid) in HeLa cells during cytokinesis. If not previously specified, all results are shown as representative picture of at least three independent experiments.

20 Fig. S12. Analysis of ALIX and VPS36 expression in the mouse lens and localization of VPS36 at midbody. (A) Immunoblot analysis and protein quantification showing expression of ALIX, PI3K-C2α and VPS36 in adult mouse lens and rest of the eye. (B) Immunofluorescence using anti-VPS36 antibody in control and siRNA-treated HeLa cells during late cytokinesis. Reduced intensity of VPS36 staining upon VPS36 knock-down can be observed. (C) Immunofluorescence using anti-VPS36 antibody showing that VPS36 is not localized at the cleavage furrow but significant enrichment at the midbody during late cytokinesis. (D) Immunofluorescence using anti-GFP and anti-VPS36 antibodies, performed in HeLa cells transfected with GFP-VPS36. As shown in merged image, VPS36 antibody is able to recognize GFP-VPS36 thus confirming the antibody specificity towards VPS36. If not previously specified, all results are shown as mean or representative picture of at least three independent experiments ± SEM (**P<0.01).

21

22 Fig. S13. Analysis of ESCRT components and PI(3,4)P2 localization at the midbody and their impact on cytokinesis. (A) Quantification of time-lapse experiments showing the time required to progress from anaphase onset to abscission in HeLa cells treated with control siRNA and siRNA targeting either PI3K-C2α or VPS36 (n≥30 cells). (B) Quantification of normal cytokinesis (white) and re-fusion or failure (cell death during cytokinesis or cells still connected by intercellular bridge at the end of the time lapse) events (black) during cytokinesis in HeLa cells treated with control siRNA and siRNA targeting either PI3K-C2α or VPS36. (C) Quantification of TSG101 levels at midbody in control and siRNA treated cells (n= ≥110 cells, mean ± SD). (D) Quantification of PI3K- C2α levels at midbody in control and siRNA treated cells (n≥ 35 cells, mean ± SD). (E) Quantification of PI(3,4)P2 levels at midbody in control and siRNA treated cells (N≥ 40 cells, mean ± SD). (F) Quantification of VPS36 levels at midbody in control and in cells treated with VPS34 (class III PI3K) inhibitor (VPS34-IN1) (n≥ 100 cells, mean ± SD). (G) Quantification of VPS36 levels at midbody in control and siRNA treated cells (n≥ 150 cells, mean ± SD). If not previously specified, all results are shown as mean or representative picture of at least three independent experiments ± SEM (n.s. = not significant; *P<0.05; **P<0.01; ***P<0.001).

23 Fig. S14. Analysis of VPS36 and CHMP4B localization at the midbody. (A) Immunofluorescence staining of endogenous VPS36 and PI(3,4)P2 levels at the midbody in PIK3C2A-null fibroblasts. Enlarged panels are reported in Fig. 4F, G. (B) Quantification of CHMP4B levels at midbody in control, siRNA targeting OCRL and A1 treated cells (n≥

48 cells ± SD; n.s = not significant; **P<0.01; ***P<0.001).

24 Fig. S15. Analysis of protein localization/expression at midbody. (A) Representative images and quantification of GFP-CHMP4B enrichment at the midbody in living HeLa cells upon overexpression of mCherry or mCherry-VPS36. (B) Quantification and representative immunoblot of midbody purification in control and siRNA treated HeLa cells (n= 6 independent experiments). (C) Quantification and representative immunoblot of midbody purification in control and siRNA treated 293T cells (n= 6 independent experiments were performed and quantified). (D) Quantification of Citron levels at midbody in control and siRNA treated HeLa cells (n≥ 70 cells, mean ± SD). (E) Representative images of VPS36 levels at midbody in control and siRNA treated cells upon transfection of siRNA resistant WT, KD, and PI3P–producing (C3) forms of PI3K-C2α.

(F) Schematic representation of the ALIX and ESCRT-II pathway involved in CHMP4B recruitment at the midbody. If not previously specified, all results are shown as mean or representative picture of at least three independent experiments ± SEM (*P<0.05;

**P<0.01; ***P<0.001).

25

26 Fig. S16. Analysis of VPS36 binding to PI(3)P/PI(3,4)P2 and its localization at the midbody. (A) Schematic representation of the strategy to create yMut VPS36, resembling the PI-binding properties of yeast VPS36. Light blue, red and green highlight basic conserved residues, yeast residues not found in vertebrate homologues, mutant residues inserted in the human sequence to phenocopy the yeast protein, respectively. Arrows and waves indicate β-sheets α-helices, respectively. (B) Snapshot from time-lapse of HeLa cells in interphase, transfected with WT or yMut GFP-VPS36. (C) Lipid sedimentation assay showing binding of WT and yMut VPS36 to PI(3,4)P2 and PI(3)P. As shown, yMut had reduced binding to PI(3,4)P2 and increased affinity to PI(3)P. (D) Time-lapse of living HeLa cells stably expressing RFP-α-tubulin, showing localization of WT, yMut or H0m VPS36 enrichment at the midbody during abscission. Enlarged panels showing localization at midbody are reported in Fig. 6E. If not previously specified, all results are shown as mean or representative picture of at least three independent experiments.

27 Fig. S17. Loss of PI3K-C2α results in impaired secondary ingression formation. (A) Immunofluorescence of early and late cytokinesis in control and siRNA treated cells,

28 showing intercellular bridges stained with α-tubulin (red) and phase contrast. Secondary ingression at one or both sides of the midbody (phase dense region in black) are indicated by yellow arrows. Upon PI3K-C2α or VPS36 depletion, in late cytokinesis is observable an elongated and thick intercellular bridge with no secondary ingression at both sides of the midbody (representative picture of n≥ 75 cells in three independent experiments). (B) Quantification indicating the percentage of cytokinesis in which one, two or no secondary ingression is found in both control and siRNA treated HeLa cells (n≥75 cells in three independent experiments). (C)The distance between the end of the midbody dark zone and the site of microtubule constriction was measured in control and siRNA treated HeLa cells stained with anti-α-tubulin antibody. (D) Time lapse analysis showing normal waves and constrictions at the intercellular bridge regions flanking the midbody in control HeLa cells (upper panel). Upon PI3K-C2α or VPS36 down-modulation, elongated intercellular bridges and reduced number of waves or constrictions at both sides of the midbody were observed (lower panel). (E, F) Kymograph analysis showing reduced number of waves/constrictions in siRNA treated cells compared to control (n≥43 intercellular bridges in three independent experiments). (G) HeLa cells treated with control or PI3K-C2α- targeting siRNA and expressing both alpha-tubulin-RFP and FIP3-GFP were imaged using confocal microscopy (n≥25, mean ± SD). (H) Immunofluorescence staining using anti α- tubulin (red) and Alexa-488-Phalloidin in cells treated with control or PI3K-C2α-targeting siRNA (n≥20, mean ± SD). If not previously specified, all results are shown as mean or representative picture of at least three independent experiments ± SEM (n.s. = not significant; ***P<0.001).

29 Fig. S18. Analysis of cell cycle in zebrafish lens and HLE-B3. (A) Immunoblot quantification of VPS36 protein expression in control and vps36 morphants (n=4 pools of 15 embryos each). (B) Quantification and representative picture showing phospho-H3 (Ser10)-positive cells in the lens of control, pik3c2a and vps36 morphant 72 hpf embryos.

(C) Quantification and representative pictures showing EdU-positive HLE-B3 cells upon PI3K-C2α or VPS36 knockdown (upper panel) or Paprotrain treatment (lower panel). If not previously specified, all results are shown as mean or representative picture of at least three independent experiments ± SEM (***P<0.001).

30

31 Fig. S19. Suppression of vps36 in zebrafish leads to senescence. (A) Gene expression (Log2 fold change) of the cyclin-dependent kinase inhibitors p16INK4A and p21, as determined by RT-qPCR, in 72 hpf embryos (n=3 pools of 15 embryos each). (B) Gene expression (fold change) of BCL2/BAX ratio in in 72 hpf embryos (n=3 pools of 15 embryos each). (C) Gene expression (Log2 fold change) of a panel of SASP factors as determined by RT-qPCR, in 72 hpf embryos. *P<0.05; **P<0.01; ***P<0.001 (unpaired two-tailed Welch's t-test with Dunnett's multiple comparison) (n=3 pools of 15 embryos each). (D) Immunoblot analysis of p16INK4A protein level in HLE-B3 lens epithelial cells treated with control or VPS36 siRNA. Whole immunoblot previously shown for clarity in a cut version in Fig. S1I. (E) Quantification and representative images of SA-β-gal positive HLE-B3 lens cells treated with control or VPS36 siRNA. (F) Immunofluorescence staining of p16INK4A (red), α-tubulin (green) and DNA (blue), in wild-type and HLE-B3 lens epithelial cells. (G) Quantification and representative images of SA-β-gal intensity on the lens of control, morphant (pik3c2a), morphant + wt (pik3c2a mRNA morpholino resistant), morphant + kd (pik3c2a mRNA morpholino resistant) and morphant + c3 (pik3c2a mRNA morpholino resistant) 72 hpf embryos. (H-I) Gene expression (Log2 fold change) of the cyclin-dependent kinase inhibitors p16INK4A (cdkn2a/b) (n=3 pools of 15 embryos each) (H) and p21 (cdkn1a) (I), as determined by RT-qPCR, in control, pik3c2a morphant, morphant + wt (pik3c2a mRNA morpholino resistant), morphant + kd (pik3c2a mRNA morpholino resistant) and morphant + c3 (pik3c2a mRNA morpholino resistant) 72 hpf embryos. *P<0.05; **P<0.01; ***P<0.001 (unpaired two-tailed Welch's t-test with Dunnett's multiple comparison). (J) Quantification and representative images of SA-β-gal intensity on the lens of 72 hpf embryos treated with DMSO (control), blebbistatin, Paprotrain or ZM-447439. (K) Gene expression (Log2 fold change) of a panel of SASP factors as determined by RT-qPCR, in 72 hpf embryos treated with DMSO (control), blebbistatin, Paprotrain or ZM-447439. *P<0.05; **P<0.01; ***P<0.001 (unpaired two- tailed Welch's t-test with Dunnett's multiple comparison) (n=3 pools of 15 embryos each).

If not previously specified, all results are shown as mean or representative picture of at least three independent experiments ± SEM (*P<0.05; **P<0.01; ***P<0.001).

32 Fig. S20. Immunofluorescence quantification method. Protocol for immunofluorescence quantification, as outlined in Material and Methods. Letters indicating measured areas are described in the table to the right.

33 Table S1. Distribution of offspring genotypes from a zebrafish pik3c2a^+/- intercross.

Cross Age pik3c2a genotype p value

-/- +/- +/+

10124 +/- X 12328 +/- 1 week 33 83 31 0,29 3 weeks 16 25 10 0,49 1-2 months 23 54 20 0,49 2-3 months 18 44 18 0,67

>3 months 28 37 28 0,14

Total 118 243 107 0,55

p value was calculated by a chi-squared analysis based on the expected 1:2:1 inheritance pattern

34 Table S2. Proteomic analysis identified TUBG1 as PI3K-C2 binding partner that associates with independent of the association of its N-terminal domain with clathrin.

Protein names Gene names Intensity_GFP_IP

Intensity_GFPPI3K C2α FL_IP

Intensity_GFPPI3KC2a delta N_IP

Gamma-tubulin complex component 4 TUBGCP4 0 2103100 5219100

Tubulin gamma-1 chain;Tubulin gamma-2 chain;Tubulin gamma chain TUBG1;TUBG2 757980 16495000 12173000

Clathrin heavy chain 2 CLTCL1 0 276580000 159590

Clathrin light chain B CLTB 155780 390170000 95886

AP-2 complex subunit alpha-2 AP2A2 0 2316700 32608

Anaphase-promoting complex subunit 1 ANAPC1 0 707230 3941200

Cell division cycle protein 23 homolog CDC23 0 1304000 5332900

Cell division cycle 5-like protein CDC5L 0 11233000 21601000

Anaphase-promoting complex subunit 5 ANAPC5 0 994530 3078200

Anaphase-promoting complex subunit 7 ANAPC7 0 1466600 7323200

Cell division cycle protein 16 homolog CDC16 0 237950 2556000

Anaphase-promoting complex subunit 4 ANAPC4 0 270810 2416400

Anaphase-promoting complex subunit 2 ANAPC2 0 225210 983160

Tubulin beta-4A chain TUBB4A 0 368520 505580

Anaphase-promoting complex subunit CDC26 CDC26 0 179160 1666000

Tubulin-specific chaperone A TBCA 0 563450 412010

Cell division control protein 42 homolog CDC42;hCG_39634 0 1214200 637140

Tubulin beta-3 chain TUBB3 0 4512100 798130

Clathrin interactor 1 CLINT1 0 163090 0

35 Table S3. List of primers used for quantitative RT-PCR.

 Human

CDKN2A GAGCAGCATGGAGCCTTC CCTCCGACCGTAACTATTCG CDKN1A GGGACAGCAGAGGAAGACC GACTAAGGCAGAAGATGTAGAGC BAX TCCACCAAGAAGCTGAGCGAG GTCCAGCCCATGATGGTTCT BACL2 GTACCTGCAGCTTCTTTCCCC AAGAAGGCCACAATCCTCCCC IL1B CAACCAACAAGTGATATTCTCCATG GATCCACACTCTCCAGCTGCA IL6 ACAGCCACTCACCTCTTCAGAACG CCAGGCAAGTCTCCTCATTGAATCC IL8 CATCCATCTCGTGCTACTTGTGTT CATCTATCCAGTTGGCCTCTGT

CCL4 GCTAGTAGCTGCCTTCTGCT CCACAAAGTTGCGAGGAAGC

MMP1 AAGACAGATTCTACATGCGCACA CCTTGGGGTATCCGTGTAGCA TGFB GGAAACCCACAACGAAATCTATGAC GCTGAGGTATCGCCAGGAATT IFNY GCAGAGCCAAATTGTCTCCT ATGCTCTTCGACCTCGAAAC TNFA CCTCTCTCTAATCAGCCCTCTG GAGGACCTGGGAGTAGATGAG GAPDH AGACCACAGTCCATGCCATC TTGCCCACAGCCTTGGCAG

 Murine

Cdkn2a GAACTCTTTCGGTCGTACCC CGAATCTGCACCGTAGTTGA Cdkn1a CGAGAACGGTGGAACTTTGAC CAGGGCTCAGGTAGACCTTG bax GAGAGGTCTTCTTCCGGGTG TCTTGGATCCAGACAAGCAGC

bcl2 AACATCGCCCTGTGGATGAC TGCACCCAGAGTGATGCAG

il1a AGACTACAGTTCTGCCATTGACCA TCAGAATCTTCCCGTTGCTTG

il1b AGATGAAGGGCTGCTTCCAAA AATGGGAACGTCACACACCA

36 il6 GACAAAGCCAGAGTCCTTCAGAGAGA GGTCTTGGTCCTTAGCCACTCCTT

il15 CATCCATCTCGTGCTACTT TTCTCCAGGTCATATCTTACAT

Cxcl1 CCACACTCAAGAATGGTCGC TCTCCGTTACTTGGGGACAC

mmp1 AAGACAGTCTGGAAATACCTG TATGGGGCCACATCAGGCACCC

mmp10 GATCTTGCTCAGCAATACCTAG CTTCCCTGTCATCTCCAACCCG tgfb1 CCGCAACAACGCCATCTATG GATTTTAATCTCTGCAAGCGCA

ifny GTCAACAACCCACAGGTCCAG TCAGCAGCGACTCCTTTTCC

tnfa GATCGGTCCCCAAAGGGATG CACTGGTGGTTTGCTACGAC

gapdh AGACCACAGTCCATGCCATC TTGCCCACAGCCTTGGCAG

 Fish

cdkn2a/b GGTTAACAAATTTAGAAGAACGCCTA CGGGGTCAGGCACATTAG cdkn1a AAGCGCAAACAGACCAACAT TCAGCTACTGGCCGGATTT bax CTTCAGCCGACTCAAGACGT GGGTGCCAAAATAACTGCGG bcl2a AACCGACTCTTTCCTGCTCG TTCAGAGTTGTTCCCTCCGC

il1fma GGAGGCAGATGTGATACCGG CAAGGGTTGTCAGGGTCACA

il1b CGGAAGCAGCGACTTGAAAG GTACGAGATGTGGAGCGGAG

il6 CCTCAGTCCTGGTGAACGAC GAACAGGATCGAGTGGACCG

il15 CACAGCACACTTGTACACGC ACAAAGTGGAGTTGGTGAGCT

cxcl8 GTGAAGCTCTACCTCCACCG GAAATCACCCACGTCTCGGT

ccl35.2 TGCGCATTGGACCAAAGAGA GCCAACACGTTTGCTGTCAA

37

mmp9 AACCACTGCTTCCACCACAA ACCTTTGCGTTCACCATTGC

mmp13 GACCAAGACACACTCGCAGA GTCTCCTGGTCCAGCTTTCC

tgfb1 GTCCGAGATGAAGCGCAGTA GGAGACAAAGCGAGTTCCCA

ifng1 GCTTTGCCTGGGGAGTATGT CAGGAAGATGGGGTGTGCAT

tnfa CCACAGTTCAGCAGGACCTC TTTCCTGCGTGCTCTCATGT

gapdh GATGGTCATGCAATCACAGTCTA ATCATACTTGGCAGGTTTCTCAA