Structural and kinetic analyses of herpes
simplex virus type 1 latency-associated
transcripts in human trigeminal ganglia and in
cell culture.
P R Krause, … , J M Ostrove, S E Straus
J Clin Invest.
1990;
86(1)
:235-241.
https://doi.org/10.1172/JCI114689
.
Only one herpes simplex virus type 1 (HSV-1) gene is expressed in sensory neurons of
latently infected animals and humans, yielding two RNAs, called latency-associated
transcripts (LATs). The LATs appear to modulate virus reactivation. In mice and rabbits the
5' origins, kinetics of synthesis, and splicing pattern of the LATs are well established.
Because these details of LAT structure and expression have not been defined in humans,
we sought to do so. Using primer extension and Northern hybridization analyses, we
demonstrate that in human trigeminal ganglia, the smaller (1.35 kb) HSV-1 transcript differs
from the larger (1.85 kb) LAT by excision of an intron near its 5' end; they are otherwise
colinear, and 5' coterminal. In infected cells only the 1.85 kb LAT is detected. Its expression
is inhibited by cycloheximide or acyclovir, indicating this LAT is synthesized late in the viral
replicative cycle. All of these features of the LATs in humans are consistent with those
reported in rabbits and mice and further validate the animal models of human HSV-1
infection.
Research Article
Find the latest version:
http://jci.me/114689/pdf
Structural
and
Kinetic Analyses
of
Herpes Simplex
Virus
Type
ILatency-associated
Transcripts in Human Trigeminal
Ganglia
and
in
Cell
Culture
Philip R. Krause, Kenneth D. Croen, Jeffrey M. Ostrove, and Stephen E. Straus
Medical Virology Section, Laboratory of Clinical Investigation, NationalInstitute ofAllergy and InfectiousDiseases,
National Institutes ofHealth, Bethesda, Maryland 20892
Abstract
Only one herpes simplex virus type 1 (HSV-1) gene is
ex-pressed in sensory neurons oflatently infected animals and humans, yielding two RNAs, called latency-associated tran-scripts(LATs).TheLATs appeartomodulate virus reactiva-tion. In mice and rabbitsthe 5'origins, kineticsofsynthesis,
andsplicingpattern of the LATsarewell established. Because thesedetails ofLATstructure and expressionhave notbeen
definedin humans,wesoughttodoso.Using primer extension
andNorthern hybridization analyses,we demonstrate that in humantrigeminal
ganglia,
thesmaller (135 kb)HSV-1tran-script differs fromthelarger(1.85 kb)LATbyexcision of an intron near its5' end;theyareotherwise colinear,and5'
coter-minal. Ininfected cellsonly the1.85kb LATis detected.Its
expression isinhibitedby cycloheximide oracyclovir, indicat-ingthisLATissynthesized lateinthe viralreplicativecycle. Allof these featuresofthe LATs in humansareconsistent with
those reported in rabbits and mice and further validate the animal models ofhuman HSV-1 infection. (J. Clin. Invest. 1990. 86:235-241.) Key words: herpes infection * viral latency-neurons
Introduction
A fundamental hallmark ofherpessimplex virus (HSV)' in-fectionof humans is its abilitytorecur(1). Abundant evidence indicatesthat recurrentinfections ariseas a resultof
reactiva-tion oflatentvirus insensory nerveganglia. The virus gains
access tothe
ganglia
early in infection by local spread fromepithelial
cells to sensory nerve endings and ascent up theaxon. The latent state is
characterized
bypersistence
of theviralgenomeinanepisomal form in neuronal nuclei (2). Only one ofthe80ormoreviralgenesis active untilasyet unde-finedsignals trigger reactivation via expression ofthe remain-inggenesand the resultantreplicationand assembly of prog-enyvirions. Virusthenspreads centrifugallytocausea
recur-rentmucocutaneousinfection.
Transcription ofthesinglegenethatis active inlatency has
primarily
beenexamined in rabbitsandmice,
inwhich studiesAddressreprint requests to Dr. Stephen E. Straus, Bldg. 10,Room 1
INI
13, 9000 RockvillePike, Bethesda,MD20892.Receivedfor publication4December 1989 and inrevisedform27
February1990.
1. Abbreviations usedinthis paper:HSV, herpes simplex virus;HSV-1,
HSV type 1; LAT,latency-associated transcripts.
The Journal of ClinicalInvestigation,Inc.
Volume86,July 1990,235-241
of HSVtype 1 (HSV- 1) infectedsensoryganglia revealedthe
expression
oftwoabundant viralRNAs,termedlatency-asso-ciated transcripts (LATs) (3-9). Thesmaller LAT, orpossibly a pair of transcripts estimated to be 1.3-1.5 kb in size, are
spliced forms ofalarger2.0-2.3-kb transcript.The LATs ap-pear to be localized to the ganglion neuronal nuclei. They possess common 5' startsites within the long inverted repeat sequencesofthe genome and there are thus twocopiesof the LAT gene pervirus. They overlap the geneencodingthe viral
immediate-early protein ICP0 (see reference 10 for a
discus-sion of
ICPO),
but are transcribed from the opposite DNAstrand relativeto the ICPO message. Studies of
ganglia
from mice latently infected with HSV-1 indicate thatthe LATs are notrequired fortheestablishmentormaintenance oflatency. Rather, they appear to play aroleinpromoting viral reactiva-tion(1 1-13).Studies of human tissues also demonstrated abundant
HSV-I LATsin latently infected
trigeminal
nerveganglion
cellnuclei. The LATs were estimated to be 1.85-2.0 kb and
1.35-1.5kb inlength
(14-19).
Noother viraltranscription
has beendetected inhumantissues.Inthepresentworkweundertooka detailed examination ofthe nature, structure, and
expression
of HSV-1 LATs inhuman tissues. Should these aspects ofHSV-1 latency in
humantissues resemble the
findings
inrabbits andmice, they
would further validate the use of the animal models in the
study ofHSVdisease
pathogenesis.
Methods
Cellsandinfections.Vero cells weregrown at
370C
in 5%CO2incuba-torsina1:1mixture of minimal essential medium(MEM)/199 (Qual-ity Biological, Inc., Rockville, MD), supplemented with 10% FBS
(Quality Biological, Inc.),glutamine (29.2 mg/ml), aureamycin(2.6 mg/ml), streptomycin (25 mg/ml), and penicillin (100 U/ml). For some experiments, cellswere treated withacyclovir (30
gM;
Bur-roughs-Wellcome Co., Research Triangle Park, NC), beginning 24h
before infection, while in others, cycloheximide (50 gg/ml,
Boehringer-MannheimBiochemicals, Indianapolis, IN) was added 3 h before infection.
Cells wereinfected with a plaque titered stockof
HSV-l
strain KOS,orwithalow passageHSV-l
clinical isolate recovered from arecurrent lip lesion ofan immune competent patient. Human
trigeminal gangliaremovedatautopsyperformed within 24hof death were frozen and stored at -70'C until the RNA was extracted as described(15).
RNApurification. RNAwaspurified from infected oruninfected
Vero cells by lysis in situ and from human trigeminal ganglia by
poly-tronhomogenizationin4Mguanidinium thiocyanate (Fluka, Buchs,
Switzerland)with 0.5%sarkosyl.RNA waspurified by the guanidin-ium thiocyanate/cesium chloride method as described (20). Yields wereestimated by spectrophotometry, and averaged 150
Mg/75
cm2 tissue culture flask and 100jtg
pertrigeminal
ganglion.DNAhomologoustothelong repeats of HSV-1 strain KOSwas
single-stranded RNA transcription from inserts in the plasmid templates. RNA markers for hybridization controls were prepared by in vitro transcription, from the appropriate clones using SP6 or T7 polymer-ases (21),transcribed in the same direction as the LATs. These reac-tionsyielded full length RNAs homologous to the HSV-I 1,660-bp Eco RV-Hinc II fragment (bases 1,479-3,139 relative to thejunction ofthe unique long segment[UL]and the internal repeat[IRLI,seeFig. 1 for a map), the 2,866-bp Sph I-Sph I fragment (bases2,913-5,779),and the 786-bp Sph I-Sph I fragment (bases 2,127-2,913).
Northern hybridizations. RNA samples (- 5 tg per lane) were subjected to electrophoresis in 20 mM morpholinopropanesulfonic
acid (MOPS; Sigma Chemical Co., St. Louis, MO) buffer (pH 7.0) through 1.5% agarose-6%formaldehydegels,aspreviously described (22). RNA was transferred to nitrocellulose paper or Nytran mem-branes (Schleicher & Schuell, Inc., Keene, NH), hybridized, and washed according to the instructions of the manufacturer. Membranes were autoradiographed with Kodak XAR-5 film in cassettes with in-tensifyingscreens.
Hybridization probes. Oligonucleotide probes designedto detect
RNAtranscription in the region ofthe LATs (see TableI)werechosen based on the knownDNAsequence of HSV-1 strain 17,kindly pro-vided by D. McGeoch (10, 23). The probes (20-mers) were manufac-tured ona DNAsynthesizer(model380A;AppliedBiosystems, Inc., FosterCity, CA), purified free of partial lengtholigonucleotidesby use of oligonucleotidepurificationcolumnspurchased fromApplied Bio-systems,Inc., and 5' end-labeled in the presence of32P-_y-ATP (Amer-sham Corp., Arlington Heights,IL) usingT4 polynucleotidekinase (Life Technologies/Bethesda Research Laboratories, Gaithersburg,
MD)or3' end-labeled in the presence of32P-a-dATPwith terminal
deoxynucleotidyl transferase (Boehringer-Mannheim).
Unincorpor-atedcounts were removedbyethanol precipitation. Approximately
6-10 X 106 cpmwereused per Northern hybridization.Gel-purified
double-stranded DNA probes from the HSV-l KOS Sal I-Hinc II
subfragmentregion(seeFig. 1)werepreparedaspreviouslydescribed (15) and radiolabeled in vitroto aspecific activityof - 108_109
cpm/ggby nick translation in the presence of 32P-a-dCTP (Amersham Corp.).
Primer extension. Primerextension wasdone byaslight
modifica-tion of the procedure ofSpalholz (24). RNA(10 ug)purified from tissue culture cellsorhumantrigeminal gangliawasincubatedwith 10
mM methyl-mercury hydroxide (Morton Thiokol, Denver, CO) at
42°Cfor 10 min. 2-mercaptoethanol (Sigma Chemical Co.)wasadded
to afinal concentration of 200mMandtheRNA washeldatroom
temperature for 5 min.5'end-labeled probes (- 2 pmol perreaction)
forprimerextensionwereannealedtotheRNAin the presence of 100
mM sodium chloride, 20mMTris (pH 7.6), and 0.1 mMEDTA by
heating at90°Cfor 3 min,incubatingat56°Cfor 20 min, and then
coolingto42°Cover20 min. Primer extension with clonedMoloney
Murine Leukemia Virus(M-MLV)reversetranscriptase(Bethesda
ResearchLaboratories)wasconductedat37°Cfor 1haccordingtothe instructions of themanufacturer, using I mMdNTPs (Bethesda Re-search Laboratories), 50 ug/mlactinomycin D
(Boehringer-Mann-heim),and1000g/mlnuclease-free BSA (BethesdaResearch
Labora-tories).Primer extended productswerethen extracted withphenoland
chloroform, precipitated,and washed in ethanol, andone-quarterof theproductwassubjectedto electrophoresis through8 M urea, 6%
polyacrylamidedenaturinggelsat60Wfor4h,dried,and autoradio-graphed asdescribed above forNorthern blot analyses. Primer ex-tendedproductsweresized relativeto a DNAsequenceladderfroman unrelatedgene.
Results
Splicing of HSV-J
LATs. In earlierstudies
of sequences thatare
transcribed during
acute and latent HSV-1infections,
cloned genomic
fragments spanning
the region of the viral long repeats (Fig. 1) weregel purified and used as probes inHSV-1
TRL
I
UL
I a - N- XR
--- -l! F4
-;
IR, IRS Us TRS
i=
}\ wN
\dt
.1
I
Eco RV SphI SphIHincII SalI HincI1 SphI BanHI
LATENCY- | *
--ASSOCIATED
TRANSCRIPTS < -
-A -CPO
Figure1. Mapof HSV-Igenome and summaryof data onphysical
characterization of thelatency-associated transcripts.Basesare la-beled relativetothestartof thelongrepeats.
Northern hybridizations.Inthoseexperimentsweshowedthat
a
probe consisting
ofthe1,256-bp
Sal I-Hinc IIfragment
(bases 3,743-4,999
relativetothe junctionof the repeatwiththe
unique long
MULl
segment) hybridizes toboth thelarger
and smallerLATsin
latently
infected human trigeminalgan-glia,
butonly
to thelarger
LAT and the overlappingICPO
transcript
in acutely infectedVero cells(15). To moreaccu-rately
map the LATs andtodiscern regionsofidentity betweenthe
larger
and smallertranscripts, Northernhybridizations
wereperformed using synthetic oligonucleotideprobes
repre-senting
the sequences spanning this area of the genome(Fig. 1).
Each oligonucleotide probewashybridizedtofour differ-entRNA preparations.Theseincludedaganglion RNA dem-onstratedby previous Northern hybridizationtocontain both thelargerand smallerLATs,a ganglion RNAwhich showed
noevidence ofLAT transcription upon Northern
hybridiza-tion,
RNA from Vero cellsinfectedfor 24 h withHSV-1 ata multiplicityoftwoplaque formingunits(pfu)percell, andinvitro transcribedRNAmarkersrepresenting the 786-bp Sph I
fragment
(spanning bases 2,127-2,913 relativetothejunction
ofthe repeat and unique sequences), the 1,660-bp Eco
RV-Hinc II fragment (spanning bases 1,479-3,139), and the
2,866-bp SphIfragment (spanningbases2,914-5,779). These markerswere usedto verifythe quality of thehybridization conditions and, moreover, these controls allowed us toeasily discriminatebetween the 1.85-kb HSV-1 LAT and 18S ribo-somalRNA,whichmigratetosimilar positions in the formal-dehyde-agarose gels.
Typical Northern hybridizationsusing theoligonucleotide probesare shownin Fig. 2. The oligonucleotide probe
span-ning bases 2,282-2,301 detected only the 786- and 1,660-b
control marker RNAs. The oligonucleotide probe representing
bases 2,400-2,419 detectedthese same markerRNAs,both the 1.85-kb and the 1.35-kb LAT RNAs from a known positive ganglion, but only the 1.85-kb LAT in RNA from HSV-1-in-fected Vero cells. Neither LAT was detected in thenegative
ganglion. The probe spanning bases2,711-2,730detected only the 1.85-kbLAT in RNA from HSV- 1-infected Vero cells and
fromthepositive ganglion,aswell as the appropriate marker RNAs. The 2,866-b marker could now be detected duetothe location of this oligonucleotide's sequence. Failure of the probe to detect the smallertranscriptinseveral similar hybrid-izations indicates that the 1.35-kb LAT lackssignificant
4,089-M I +
.... .e
1:i~::-
2866-1850 -1660 1350
-786
-2282-2301 2400-2419 2711-2730 4089-4108 4499-4518
Figure 2.Typical Northern hybridizations using oligonucleotide probes to detect theHSV-ILATs. The larger LAT is seen at 1.85 kb, the smaller LATis at 1.35 kb. Eachblotcontains RNA fromHSV-1-infected Vero cells (MOI 2, harvested at 20 h, lanes marked I), RNA from a humantrigeminal ganglion preparation previously shown to include (lanes marked +) or not to include (lanes marked -) both LATs by
North-ernhybridization, or in vitro synthesized control marker RNAs at 2,866 b (from bases 2,913 to 5,779), 1660 b (from bases 1,479 to 3,139), and 786 b(frombases 2,127 to 2,913) (all in lanes marked M).
4,108, however, detected both the 1.85-kb and the 1.35-kb LAT RNAs in ganglia extracts, andagain only the 1.85 kb LATfrom infected cells. The probe representing bases 4,499-4,518detectedonly the control RNA, and neitherLATfrom ganglion orinfectedVerocell RNAs. Smallamountsof 28 S ribosomalRNA
(migrating
at - 4.4kb)werealsoseenin thesehybridizations. Resultsofhybridizations using these and other
oligonucleotide
probesspanning
theLATregion
aresumma-rizedinTableI.
Theobvious interpretation of the results ofthis series of
experimentsis thattranscriptionof the HSV-1 LATs is initi-ated somewhere in the region of bases2,301-2,307 andthat the smaller RNA is a spliced form of the larger one with an
intronexcised from theregionbetween bases2,419-2,711 and 3,134-3,201. We found no evidence for additional splices using these probes.
LA Tinitiation site. Topreciselylocalize the 5' end of these LATs, we performed a primer extension analysis on RNA
Table I. ResultsofNorthernHybridizations ofRNAExtractedfromHSV-1KOS-infectedVero Cells andLatently InfectedHuman
TrigeminalGanglia Using
Synthetic
Oligonucleotide
ProbesTranscriptdeted Ganglia Verocells
Position Sequence 1.85 kb 1.85 kb 1.35 kb
2282-2301 TGGAAACGCGGCGTCTTTGT - -
-2307-2326 GGGAGAAGCAGGTGTCTAAC + + +
2400-2419 CTGGTGTGCTGTAACACGAG + + +
2711-2730 CGTATCCTCGCTTTAGGAAC + +
-3115-3134 CTATAGGGCAACAAAGGATG + +
-3202-3221 GTGTGGGTGTTAAGTTTCCG + + +
3487-3506 CTGTCTGTGTTGGATGTATC + + +
4089-4108 GGTCTCTAGCGTGGTCGCCC + + +
4176-4195 GAGGAAGTGTGCCCGGAAGA + + +
4499-4518 GAAAACCCCTCCCCCCAGTC
Shownarethepositionsand sequences of theoligonucleotide probesused and the results of NorthernhybridizationwithRNAextractedfrom
HSV-1 infectedVerocells andlatentlyinfected humantrigeminalganglia. Oligonucleotide probesarenumberedrelativetothe
junction
of theuniquelong (UL)andlonginternal repeat(IRL)segments.
hA I - + M I - + m I +
1.
:.
M I - +
fromhuman trigeminalganglia. Theprimerused in these
reac-tionsspannedbases2,400-2,419, andhybridized toboth the
1.85-kband the 1.35-kbLATs, as shown in Fig. 2. As controls, RNAswere also chosenfromextractsofuninfectedVero cells, HSV- 1 KOS-infected cellsandfromcellsinfected witha low passage HSV-1 clinical isolate. RNAsfromthree human tri-geminalgangliawerestudied, twoof whichwerepositive and
oneof whichwasnegative forthe LATsby Northern
hybrid-ization. The sizes oftheextension products in each reaction
weredetermined relativeto a DNA sequence ladder.
Autoradiogramsofgelscontaining primer extendedRNA
from Verocells infected with HSV-l strain KOS showedan
intensediscreteband at 1 17basesfromthe 5' endofthe oligo-nucleotideprimer,nocorresponding bandwasseenusing
un-infected Vero cells (Fig. 3). Primer extension ofRNAfrom
cellsinfected withaclinicalisolategaveriseto a band onebase smaller.Extension reactions with ganglionRNApreparations previouslyshown tocontainboth LATs byNorthern hybrid-ization eachyielded asingle intense discrete band(ganglia 1
and 2), and the primer extension product ofRNA from a
negative ganglion preparation (ganglion 3) yielded no band.
The extendedproducts of the positive ganglia showed slight variation in the size of this band, compatible either with a
single base differenceinthe 5'startsiteor a
single
basedeletionin the sequenceofonelatent HSV- 1 genomerelative tothe
otherinthis region. Afainter band isseen - 35bases above
Z (n
A
G C
T
U
°SI
..
I'
fl_'- '..bm
_I-7 ":.# 6b.
_u~ _. -4
_ .. *Pip
UL
2
2
:D
this band in ganglion number 1. As this is not seen in either the otherpositiveganglion or the negative ganglion, it is not clear whetherit represents the 5' end of a minor latency-associated RNAspeciesinitiated further upstream from the more abun-dant LATs.Becauseofasinglebasedifferencein thesequences
near the 5' endof LAT between strain KOS (8) and strain 17 (22), these data indicate that the 5' end of the major HSV-l LATsis2,304 bases from the junctions ofthe long repeats and the UL segment in virus strain 17.
LAT kinetics. In acute infection, HSV gene expression
occursin a coordinated, cascade fashion over a period of 12-18 h. By 1-2 h after infection, 5 viral "immediate-early" (alpha) genes are transcribed. These regulate and promote the synthesis of over a dozen viral "early" (beta) gene products necessary for DNA replication. By 6-10 h after infection, nu-merous viral "late" (gamma) gene products are synthesized, which participate invirusassembly,maturation, and release.
Inthe followingexperimentsourgoal was todeterminethe temporal order of HSV-l LAT gene expression by using drug blocktechniques. To do this, RNAs were extracted at various time points after HSV- 1 infection from cells treated or un-treated with cycloheximide or acyclovir. Cycloheximide is known to block transcription of all HSV-l RNAs that are
dependentupon earliersynthesisof viralproteins, namelythe viral early and late genes. Acyclovir inhibits thetranscription
of HSV- 1 late genes, whoseexpressionisdependentupon
ear-GANGLIA
1 2
3
Figure 3. Primer extensiontodetermine the5'endof the LATs. TheRNAusedwasextractedfromVero
cells acutely infected withalowpassageHSV-I clini-calisolate (lane marked CLIN)orstrain KOS (lane markedKOS), from uninfected Vero cells (lane
markedUNINF),andfrom humantrigeminal
gan-glia showntocontain both species ofLATby North-ernhybridization (lanesmarked1 and 2),andfroma
humantrigeminalganglion shownnot tocontain
de-tectable levelsof eitherLATbyNorthern hybridiza-tion(lanemarked3).Anunrelated humanDNA
se-quenceis shownas asizemarker.The 5' end of the LATswasdetected1 7basesupstreamof the end of theprimer(whichspanned bases2,400-2,419).
117-
*1
am ob..
a_,M
tm t-W,
4%-*,
am 89
t:=
-%, *AM gmftm "
ilk,.
him-lier viral DNA synthesis. The 1,256-bp Sal I-Hinc II subfrag-ment was gelpurifiedand used as a DNA probe in Northern
hybridization analyses of the RNAs. This probe detects the 2.6-kb immediate-earlyICPO transcript and both the 1.85-kb
and 1.35-kbLATs(15).
Inthefirstdrug block experiment Vero cells were treated withcycloheximide(50
,g/ml)
starting at 3 h before infectionwith5 pfu/cell of a low passageHSV-1 clinical isolate. Total RNA was extracted 18 h afterinfection and analyzed by
Northern hybridization (Fig. 4). Cycloheximide treatment substantially reducedLATlevels as compared to that seen in RNAfrom untreated infectedcells. RNA species migrating at
- 4.2 kb proved upon subsequent hybridization with a
single-strandedoligonucleotide probeto behomologousto theICPO
X
0
-)
z
+
ZUL
z
ML
Lv
Z Z
geneandtobe transcribed fromthesame strand as theICPO
message (data not shown), thus suggesting it to be an ICPO splicing precursor. In cycloheximide-treated cells, transcrip-tion of boththe2.6-kbICPOmessage andofthe 4.2-kb
ICPO-related message were increased.
Inthesecond series ofstudies thetimecourse of, and the
effect of acycloviron LAT gene expression was investigated (Fig. 5). Hybridizations ofRNA extractedfromcells infected
with a low multiplicity
(0.1
pfu/cell) ofHSV-l
strain KOS (lanesmarked LO) showedno LATexpressionat 6 h, althoughthe 2.6-kb ICPORNA wasalready evident. By24 hafter infec-tion, the 1.85-kbLATwasdetectable. UsingRNAfromcells
infected withahigher virus multiplicity(2pfu/cell,HIlanesin Fig. 5),
ICPO
RNAcould beseen asearlyas 2 hafter infection, whileno LAT was detectedeither2 h or 6 hafter infection.By 24h,the 1.85-kb LAT wasreadilyseen. In cellsinfected with2pfu/cellandtreated with30
,M
acyclovir
toinhibit viralDNAsynthesis, ICPORNA was seen at 6h, butwasnolonger appar-ent at 24h.LAT RNAswere neverevident inextractsfromthe
acyclovir-treated
HSV-l
infected cells.L -~
.z
qqjr
Zco
cN
Z
O
CONjO
-s z
_-_
t~~~
(0
CNN (D CN
>
>u C
I
I:
I<
<
-
2.6 Kb
-1.85 Kb
1.4-Figure4.LATexpressioninthepresenceofcycloheximide.RNA
ex-tractedfromuninfectedVerocells(lane UNINF)orVerocells in-fected withanHSV-I clinical isolateinthepresence(laneINF+ Cy-clohex)orabsence(lane INF)ofcycloheximidewashybridizedwith
agelpure I,256-bpSalI-HincIIDNAprobe.
Figure5. Kineticanalysisof LATexpressionand effect ofacyclovir onLATexpression.RNA from uninfectedVero cells(laneUNINF)
orfromVero cells infectedatalowmultiplicity (0.1 pfu/cell)
ex-tractedat6(laneLO6h)or24(laneLO24h)hafterinfection;Vero
cells infectedatahigher multiplicity (2 pfu/cell)extracted at2(lane
HI2h),6(laneHI6h),or24(laneHI24h)hafterinfection;or
acy-clovir-treatedVerocells infectedatamultiplicityof 2pfu/cell
ex-tractedat6(laneACV6h)or24(laneACV24h)hwashybridized
withagelpure1,256-bpSalI-HincIIDNAprobe.
9.5-7.5
4.4
2.4
-
4.2
-
2.6
The data in Figs.4and5reveal that HSV-l 1.85-kb LAT is not expressed early in infection, and that its synthesis, or at leastits accumulation to detectable levels, requires both pro-tein and viralDNAsynthesis. Thus, HSV-l LAT is expressed in a manner similar to that of the many HSV-l "late" (gamma) genes.
Discussion
Inthisreport we summarize our findings with respect to the structure, localization, splicing and kinetics of the HSV-1 LATs in human ganglia and in cell culture. By Northern hy-bridization with oligonucleotide probes, two LATs, 1.85 kb and 1.35 kb in length, are recognized (Table I, Fig. 2). Primer
extension analysisfixed the 5' ends of these LATs from the
diploidlatency gene at 2,304 bases from the junctions of the repeat andunique long segments (or at genome bases 6,911 and 119,461 relative to the strain 17 sequence; Fig. 3), i.e., within two bases of the location assigned in rabbit and murine
studies (8, 9). Both LATs possess identical 5' ends but the smaller transcript differsfromthelargeroneby excision of a single intron that is 400-800 bases in length.
Comparison of our data on the structure of the 1.85-kb LATinhumantrigeminal gangliashows no differences from that foundinacutelyinfected Vero cells. Northern hybridiza-tions of each yielded equivalent resultswith oligonucleotide probes, andprimer extension analysisshowed that these RNAs also have the same 5' end. Therefore, we believe that tissue culture is a valid system in which to study the nature and
expressionof these genesduringacuteinfection.Duringacute infection,LATexpression requiresbothprotein synthesis and viralDNAsynthesisto accumulate to detectable levels (Figs. 4 and 5). This isin fullconcordance with Spivack andFraser,
who also found LATtorequire protein and DNA synthesis
(25), but differs fromthe report ofWagner et al. (7), which concludedthat LATis transcribed as an immediate-early gene.
DuringHSVlatency,there isnoevidence for viral transcrip-tion(otherthanthatleadingtotheproductionofLAT) or for
viralDNAsynthesis. Thissuggestseitherthat LAT transcrip-tion occurs only during theacuteganglionic infection when
viral protein and DNA synthesis occur and that the LATs
persist
duetohigh stability,orthat LATexpressioninganglia
isnotdependentupontheexpression of other viralgenes or uponviralDNA
synthesis,
asitappearstobein culturednon-neuronal cells. Given the maintenance of HSV-1 latency in humansformany decades the former possibility is unlikely. Thus, weconclude thatthe LATs must be synthesized in
la-tently infectedneurons.Spivackand Frasersuggestedthatthe
HSV-l
latencygene beconsidereda "lambdagene"todistin-guish
itfrom the classicalalpha,
beta,and gamma viral genesdefined by studies of
acutely
infectedcells(25). LATexpres-sion inneurons would haveto beregulated by, as-yet
unde-fined,
host,orviral factors whichevolve inthecontextoftheunique milieu of these terminally differentiated, nondividing cells.
The
HSV-l
LATshavebeen shown toplayaroleinpro-moting
reactivation by cocultivation intissue culture ofgan-glia from latently infected mice. Viruses with mutations up-stream of theLAT gene
produce
noLAT butarecapable ofestablishing
latency (11-13).
Aviralmutantlacking
sequencesin the longrepeatsand
producing
no LATwas able toreacti-vate upon explant cocultivation of latently infected ganglia
fromlatent infection, but at a lower rate than virus without thesemutations. Nine oftenganglia from mice infected with
nonmutatedvirushadreactivatedby 7 d,whilethe first reacti-vationof mutantvirusoccurredafter 10 d, and by 31 d virus had reactivatedfromonly 14 of 18 ganglia. This mutant virus was also less lethal to mice (21 vs. 62% death rate) (13). In separatestudies,viruscontainingadifferent deletion mutation preventingLATexpression was also able toestablishlatency.
Only 21 of43 cocultivated ganglia yielded this virus, while virusrecovery rates from ganglia infected with the wild-type andmarker rescued viruswere 17of18 and 17 of20, respec-tively. Thismutantvirus exhibitednormalgrowth characteris-tics in culture, andexhibitedno alteration in virulence (12). Although these data failed to elucidate the mechanism of LAT
action, theydid establish a role forthe LATs in modulating viralreactivation and possibly virulence.
Thestructure andexpressionof the HSV-I LATsin
exper-imentally infected miceandrabbits,and in naturallyinfected
humans seem virtually identical. These data further validate thefindings in miceandrabbitsasbearingonthe nature and
pathogenesis ofhuman HSVdisease.
Acknowledgments
Sunil Nagpal, Alison Freifeld, and William Reinholdprovidedhelpful suggestions. We thank Barbara Spalholz forherprimerextension
pro-tocol, Duncan McGeoch for unpublished
HSV-l
sequenceinforma-tion,HarryMalech for critical review ofthis paper, and Pat Stallsmith
formanuscript preparation.Also,specialthankstoJohn Smialek and Mario Golle of the Baltimore Medical Examiners office for assistance inobtaining thetissues. We areparticularly indebtedto Dr. David
Katzof the NationalInstituteof Neurological Disorders andStrokefor sharing his expertise intheremovaland handling ofhumantrigeminal ganglia.
References
1.Corey, L., andP.G.Spear. 1986. Infections with herpessimplex
viruses.N.Engl. J. Med. 314:686-691.
2.Mellerick,D.M.,andN. W.Fraser. 1987.Physicalstateof the latentherpes simplex virusgenomeinamousemodelsystem:evidence suggestinganepisomalstate. Virology. 15:265-275.
3. Stevens,J.G., E.K. Wagner, G. B. Devi-Rao,M. Cook,and
L. T. Feldman. 1987. RNA complementary to a herpesvirus alpha
gene mRNAisprominentinlatentlyinfectedneurons.Science(Wash.
DC). 235:1056-1059.
4.Deatly,A.M., G.Spivack,E.Lavi,andW.Fraser. 1987. RNA
from an immediate early regionof the type 1 herpessimplex virus
genomeispresentin thetrigeminal gangliaoflatentlyinfected mice.
Proc.Natil.Acad. Sci. USA. 84:3204-3208.
5. Spivack, J.G., and N. W. Fraser. 1987. Detection ofherpes simplex virus type 1 transcripts duringlatent infection in mice. J.
Virol. 61:3841-3847.
6. Spivack, J. G.,and N. W. Fraser. 1988. Expressionofherpes simplexvirustype 1 latency-associated transcriptsin thetrigeminal gangliaof miceduringacuteinfection andreactivation oflatent infec-tion.J. Virol. 62:1479-1485.
7.Wagner,E.K.,W. M.Flanagan, G. Devi-Rao,Y.F.Zhang,J. M.
Hill, K. P. Anderson,and J. G. Stevens. 1988. The herpessimplex
viruslatency-associated transcript is spliced during thelatentphase of infection. J. Virol. 62:4577-4585.
8.Wagner, E. K., G.Devi-Rao,L. T.Feldman,A.T.Dobson,Y.
character-ization of the herpes simplex virus latency-associated transcript in
neurons. J. Virol. 62:1194-1202.
9. Wechsler,S. L.,A.B. Nesburn,R. Watson,S. M.Slanina,and H.
Ghiasi. 1988. Fine mapping ofthe latency-related geneofherpes
sim-plex virustype 1: alternate splicingproducesdistinctlatency-related RNAscontainingopenreading frames.J. Virol. 62:4051-4058.
10.Perry, L.F., F. J.Rixon,R. D. Everett, M.G.Frame, and D. J. McGeoch. 1987.Characterization ofthe IEI10geneofherpessimplex virustype 1.J. Gen. Virol. 67:2365-2380.
11.Javier,R.T., J.G.Stevens,V.B.Dissette,and E. K. Wagner.
1988. The herpes simplex virus transcript abundant in latently infected
neuronsis dispensable for establishment of the latentstate. Virology. 166:254-257.
12. Leib,D. A., C. L.Bogard, M.Kosz-Vnenchak, K. A.Hicks,
D. M.Coen,D.M.Knipe, andP. A.Schaffer. 1989.Adeletionmutant
ofthelatency-associated transcript ofherpessimplex virustype 1
reac-tivates from the latent state with reduced frequency. J. Virol. 63:2893-2900.
13. Steiner, I.,J. G. Spivack, R. P. Lirette, S. M.Brown, A. R.
Maclean, J. Subak-Sharpe, and N. W. Fraser. 1989.Herpessimplex viruslatency-associated transcriptsareevidentlynotessential forlatent
infection. EMBO (Eur. Mol. Biol. Organ.) J. 8:505-511.
14.Croen,K.D., J. M.Ostrove,L. J.Dragovic,J. E.Smialek,and
S.E.Straus. 1987. Latent herpes simplex virus inhumantrigeminal ganglia.N.Engl. J. Med. 314:1427-1432.
15. Krause, P. R.,K. D.Croen, S. E.Straus, andJ. M.Ostrove.
1988. Detectionand preliminary characterization ofherpessimplex virustype 1 transcripts inlatentlyinfectedhumantrigeminal ganglia.
J. Virol. 62:4819-4823.
16. Stevens, J. G.,L.Haarr,D. D.Porter, M. L.Cook, andE. K. Wagner. 1988. Prominence ofthe herpessimplexvirus
latency-asso-ciatedtranscript in trigeminal ganglia from seropositive humans. J. Infect.Dis. 158:117-123.
17. Steiner, I., J.G. Spivack, D. R. O'Boyle, E. Lavi, and N. W. Fraser. 1988. Latentherpessimplex virus type 1 transcription in
humantrigeminal ganglia. J. Virol. 62:3493-3496.
18. Gordon, Y.J., B. Johnson, E. Romanowski,and T.
Araullo-Cruz. 1988.RNAcomplementarytoherpessimplextype 1ICP0gene
demonstrated in neurons of human trigeminal ganglia. J. Virol. 62:1832-1835.
19. Wechsler, S.L., A. B.Nesburn, R.Watson, S. Slanina,and H.
Ghiasi. 1988. Fine mapping of the major latency-related RNA of
herpessimplex virustype 1in humans.J.Gen. Virol. 69:3101-3106.
20. Chirgwin,J. M., A. E. Przbyla, R. J.MacDonald, andW. J. Rutter. 1979. Isolation of biologically active ribonucleic acid from
sourcesenriched inribonuclease.Biochemistry. 18:5294-5299. 21.Melton, D. A., P. A.Kreig,M. R.Rebagliati,T. Maniatis,K.
Zinn, andM. R.Green. 1984. Efficient in vitro synthesis of biologi-cally activeRNAandRNAhybridization probes from plasmids
con-tainingabacteriophage SP6promoter.Nucleic AcidsRes.
12:7035-7056.
22.Ostrove,J. M., W.Reinhold, C.Fan,S. Zorn,J. Hay,and S.E.
Straus. 1985. Transcription mapping of the varicella-zoster virus ge-nome.J. Virol. 56:600-606.
23. McGeoch, D. J., M. A. Dalrymple, A. J.Davison,A. Dolan, M.C. Frame,D.McNab,L.J.Perry,J. E.Scott,and P.Taylor. 1988. ThecompleteDNA sequenceof the long unique region in thegenome
of herpessimplex virustype 1.J. Gen. Virol. 69:1531-1574.
24.Spalholz,B. A., P. F.Lambert, C.L.Yee, andP. M.Howley. 1987.Bovine papilloma virus transcriptional coagulation: localization of the E2-responsive elements of the long control region. J. Virol. 61:2128-2137.
25.Spivack, J. G., andN. W. Fraser. 1988. Expression of herpes simplex virustype 1 (HSV- 1)latency-associated transcriptsand