the regulation of development. In plants, miRNAs have Hristo B. Houbaviy,1Michael F. Murray,1
a striking propensity to target transcription factors in-and Phillip A. Sharp1,2,*
volved in development (Rhoades et al., 2002), inC.
ele-1Center for Cancer Research
gans, mutations inlin-4andlet-7cause heterochronic 2The McGovern Institute for Brain Research and
phenotypes (Lee et al., 1993; Olsen and Ambros, 1999; Department of Biology
Reinhart et al., 2000), and, inD. melanogaster, the miRNA Massachusetts Institute of Technology
encoded by the genebantamis temporally and spatially 77 Massachusetts Avenue
expressed during development to control cell prolifera-Cambridge, Massachusetts 02139
tion and apoptosis (Brennecke et al., 2003). A survey of miRNAs cloned from mouse organs revealed that many were organ specific, consistent with roles in develop-Summary
ment (Lagos-Quintana et al., 2002, 2003).
Embryonic stem (ES) cells are totipotent cell lines de-We have identified microRNAs (miRNAs) in
undifferen-rived from the inner cell mass (ICM) of the mammalian tiated and differentiated mouse embryonic stem (ES)
blastocyst (Smith, 2001). In vitro differentiation of ES cells. Some of these appear to be ES cell specific,
cells recapitulates some of the global genomic methyla-have related sequences, and are encoded by genomic
tion that takes place shortly after implantation and has loci clustered within 2.2 kb of each other. Their
expres-been used to study the epigenetic events that accom-sion is repressed as ES cells differentiate into
em-pany X chromosome inactivation during midblastula bryoid bodies and is undetectable in adult mouse
or-(Wutz and Jaenisch, 2000). To elucidate the roles of gans. In contrast, the levels of many previously
miRNAs during these early developmental transitions, described miRNAs remain constant or increase upon
we cloned short, 20–26 nt RNAs from undifferentiated differentiation. Our results suggest that miRNAs may
and differentiated ES cells. have a role in the maintenance of the pluripotent cell
state and in the regulation of early mammalian
devel-Results and Discussion opment.
miRNA Libraries from Undifferentiated Introduction
and Differentiated ES Cells
We constructed miRNA libraries from three different Cloning of short, 20–24 nt RNAs from a variety of sources
sources: (1) ES cells grown on a feeder layer of irradiated identified a family of RNA species designated as microRNAs
mouse embryonic fibroblasts (MEF) and in the presence (miRNAs) (Dostie et al., 2003; Lagos-Quintana et al.,
of 500 U/ml leukemia inhibitory factor (LIF) (library L1), 2001, 2002, 2003; Lau et al., 2001; Lim et al., 2003a,
(2) ES cells grown in the absence of feeders and in the 2003b; Llave et al., 2002a; Mourelatos et al., 2002;
Rein-presence of 1000 U/mL LIF (library L2), and (3) differenti-hart et al., 2002). Over 200 distinct miRNAs have been
ated ES cells maintained for 4 days in media containing discovered experimentally, and additional ones have
100 nmol/l all-trans-retinoic acid (RA) and no LIF (library been identified via computational approaches (Lim et al.,
L3). While library L1 could potentially be contaminated 2003a, 2003b). miRNAs are structurally and functionally
by MEF-derived miRNA sequences, the corresponding related to the short interfering RNAs (siRNA) that cause
culture should contain the highest fraction of undifferen-RNA silencing (Elbashir et al., 2001a, 2001b; Hamilton
tiated ES cells. Conversely, while some differentiation and Baulcombe, 1999; Hammond et al., 2000; Zamore
may have occurred in the cell population used to generate et al., 2000). Both miRNAs and siRNAs are produced by
library L2, it should not contain MEF-derived sequences. the RNase III nuclease Dicer, and both depend on the
Finally, the sequences of miRNAs induced during ES cell PAZ/PIWI domain (PPD) proteins for function and/or
differentiation should be present in library L3. stability (Grishok et al., 2001; Hutvagner et al., 2001).
To assess the degree of differentiation, we determined miRNAs silence gene expression by repressing trans- the steady-state levels of Oct4 mRNA by Northern analy-lation or by directing the degradation of mRNA. For
sis, and the distribution of alternatively spliced isoforms example, miRNAs encoded by theC. elegansgeneslin-4 of the␣6-integrin mRNA was analyzed by RT-PCR
(Fig-andlet-7(Lee et al., 1993; Reinhart et al., 2000) bind to ure 1). Oct4 is dramatically downregulated during differ-partially complementary sites within their mRNA targets entiation (Rosner et al., 1990), and there are quantitative and cause translational repression (Olsen and Ambros, shifts among the splicing isoforms of the ␣6-integrin 1999; Slack et al., 2000). However, thelet-7miRNA can (Cooper et al., 1991). ES cells grown with and without cause mRNA degradation in vitro if a perfectly comple- feeders were indistinguishable by both criteria—they mentary target site is present (Hutvagner and Zamore, expressed high levels of Oct4 mRNA and the short iso-2002), and, similarly, many plant miRNAs cleave mRNA form of the␣6-integrin message (Figure 1, lanes 1 and in vivo and in vitro (Llave et al., 2002b; Tang et al., 2003; 2). In contrast, after 4 days of growth in the presence
Xie et al., 2003). of RA, the Oct4 mRNA levels decreased more than 5-fold
An important biological function of some miRNAs is (Figure 1A, compare lanes 1 and 2 with lane 3), and the culture began to express the long isoform of the ␣ 6-integrin mRNA, consistent with differentiation (Figure *Correspondence: [email protected]
Figure 1. Molecular Markers of Undifferenti-ated and DifferentiUndifferenti-ated ES Cell Cultures (A) Northern analyses of the expression of Oct4 (top) and the-actin mRNA (middle) and 18S rRNA (bottom) loading controls in undif-ferentiated ES cells grown with (lane 1) and without (lane 2) a feeder layer and in ES cells differentiated with RA in monolayer for 4 days (lane 3) or 14 days as embryoid bodies with-out (lane 4) and with RA (lane 5).
(B) Expression of␣6-integrin mRNA isoforms analyzed by RT-PCR. Bands corresponding to the alternatively spliced variants are indi-cated by arrows. Lanes 1–5 correspond to lanes 1–5 in (A). Lanes 6 and 7 correspond to samples prepared from NIH/3T3 cells and the MEF feeders, respectively.
1B, lane 3). Moreover, both markers had similar expres- with flanking sequences are listed in Table 1. These constitute 30% of the nonredundant clones in the 20–24 sion patterns in the RA-induced monolayer culture and
in embryoid bodies after 14 days of differentiation (Fig- nt range.
We do not know whether any of the remaining 20–24 ure 1, lanes 3–5). Thus, both undifferentiated ES cell
cultures contained a significant proportion of totipotent nt sequences are siRNAs. Database searches did not reveal clones derived from annotated mRNAs. None of ES cells, and most cells underwent differentiation in
monolayer upon treatment with RA. the sequences match the mouse centromeric minor sat-ellite, whoseS. pombecounterpart has been implicated in siRNA-mediated heterochromatin silencing (Reinhart Data Analysis and Identification of miRNAs
A total of 681 short RNA clones were isolated and se- and Bartel, 2002; Volpe et al., 2002). Similarly, none of the clones could be mapped to repetitive elements. quenced, of which 192 were from L1, 219 were from L2,
and 270 were from L3. The data from the three libraries were pooled, and multiple instances of the same
se-quence were assigned to the longest clone. This resulted Novel miRNAs from ES Cells
Of the 53 potential miRNA clones for which hairpin pre-in a nonredundant dataset comprised of 388 short RNAs.
Most sequences (73%) were observed only once. Thus, cursors could be proposed, 32 were identical to pre-viously identified miRNAs, 5 additional clones were clear the dataset probably does not represent the complete
pool of short RNAs present in undifferentiated and differ- homologs of known miRNAs (34a, 34b, miR-106a, miR-106b, and miR-130b), and one (let-7d-as) was entiated ES cells. In the final nonredundant dataset, a
total of 179 clones (46%) were between 20 and 24 nt excised from the opposite side of a known miRNA hair-pin precursor (Table 1). The remaining 15 sequences long, as expected for Dicer cleavage products (Elbashir
et al., 2001b; Zamore et al., 2000). Of these 37 matched are unrelated to any previously described miRNAs in the RFAM database (Ambros et al., 2003) (Table 1; miR-known rRNA and tRNA sequences.
To distinguish miRNAs from degradation products 290–miR-302). Interestingly, these miRNAs are relatively poorly conserved (Table 1). While hairpin folds corre-and potential siRNAs, we evaluated the ability of RNA
corresponding to the genomic sequences surrounding sponding to most of them could be found in other mam-malian genomes, i.e., human and rat, only one (miR-301) the above 179 nonredundant clones to fold into potential
hairpin miRNA precursors. This criterion, together with had a conserved hairpin in the fishFugu rubripes, and none had homologs in invertebrates.
phylogenetic conservation of the hairpin fold, is now
generally accepted as good evidence for the existence One of the above clones, miR-297, was identical to 20 genomic segments and varied by one position from of an miRNA (Ambros et al., 2003; Lim et al., 2003a,
Table 1. miRNAs from Undifferentiated and Differentiated ES Cells
Observa-
Conserva-tionsc Lengthd tiong
IDa Sequenceb L1 L2 L3 Average Maximum Minimum Rmsd Hitse Expressionf Hs Rn Fr
let-7d-as CUAUACGACCUGCUGCCUUUCU 1 0 0 22 22 22 0.0 1 S00S0 miR-34a AGGCAGUGUAGUUAGCUGAUUGC 1 0 0 23 23 23 0.0 1 miR-34b UAGGCAGUGUAAUUAGCUGAUUG 0 0 1 23 23 23 0.0 1 00000 miR-106a CAAAGUGCUAACAGUGCAGGUA 0 1 0 22 22 22 0.0 1 miR-106b UAAAGUGCUGACAGUGCAGAU 1 0 0 21 21 21 0.0 1 miR-130b CAGUGCAAUGAUGAAAGGGCAU 1 0 0 22 22 22 0.0 1 22221 miR-290 CUCAAACUAUGGGGGCACUUUUU 2 2 1 22 23 22 0.4 1 01110 Hs Rn miR-291-s CAUCAAAGUGGAGGCCCUCUCU 1 1 0 23 24 22 1.0 1 Rn miR-291-as AAAGUGCUUCCACUUUGUGUGCC 6 1 0 22 23 22 0.3 1 01110 Rn miR-292-s ACUCAAACUGGGGGCUCUUUUG 1 1 1 22 23 21 0.8 1 01110 Hs miR-292-as AAGUGCCGCCAGGUUUUGAGUGU 2 0 0 22 23 22 0.5 1 01220 Hs Rn miR-293 AGUGCCGCAGAGUUUGUAGUGU 4 1 1 22 22 21 0.4 1 01110 miR-294 AAAGUGCUUCCCUUUUGUGUGU 4 0 2 22 23 22 0.4 1 01120 miR-295 AAAGUGCUACUACUUUUGAGUCU 3 0 0 22 23 22 0.5 1 01120 Rn miR-296 AGGGCCCCCCCUCAAUCCUGU 0 0 1 21 21 21 0.0 1 01110 Hs miR-297 AUGUAUGUGUGCAUGUGCAUG 0 0 1 21 21 21 0.0 20 00010 Hs Rn miR-298 GGCAGAGGAGGGCUGUUCUUCC 0 0 1 22 22 22 0.0 1 SSSS0 miR-299 UGGUUUACCGUCCCACAUACAU 0 0 1 22 22 22 0.0 1 00000 Hs Rn miR-300 UAUGCAAGGGCAAGCUCUCUUC 0 2 0 22 23 22 0.5 1 00000 Rn miR-301 CAGUGCAAUAGUAUUGUCAAAGC 0 0 1 23 23 23 0.0 1 00021 Hs Rn Fr miR-302 UAAGUGCUUCCAUGUUUUGGUGA 0 0 1 23 23 23 0.0 1 00110 Hs let-7c UGAGGUAGUAGGUUGUAUGGUUA 3 0 0 22 23 21 0.8 1 200S1 miR-15a UAGCAGCACAUAAUGGUUUGUG 2 0 2 23 23 22 0.4 1 11121 miR-15b UAGCAGCACAUCAUGGUUUAC 1 0 0 21 21 21 0.0 1 miR-16 UAGCAGCACGUAAAUAUUGGCG 5 0 2 21 22 20 0.7 2 11121 miR-18 UAAGGUGCAUCUAGUGCAGAUA 1 1 0 21 22 21 0.5 1 miR-19b UGUGCAAAUCCAUGCAAAACUGA 3 1 1 22 23 22 0.5 1 05551 miR-20 UAAAGUGCUUAUAGUGCAGGUAG 2 1 0 22 23 22 0.5 1 miR-21 UAGCUUAUCAGACUGAUGUUGAC 11 1 10 22 23 18 1.1 1 91153 miR-22 AAGCUGCCAGUUGAAGAACUGU 1 0 1 22 22 22 0.0 1 91185 miR-24 UGGCUCAGUUCAGCAGGAACAG 0 0 1 22 22 22 0.0 2 20021 miR-27a UUCACAGUGGCUAAGUUCCGC 1 0 1 21 21 21 0.0 1 10011 miR-29a UAGCACCAUCUGAAAUCGGUUA 2 0 0 22 22 22 0.0 1 10001 miR-29b UAGCACCAUUUGAAAUCAGUGUU 5 0 0 23 23 22 0.5 2 10001 miR-30e UGUAAACAUCCUUGACUGGAAGC 1 0 0 23 23 23 0.0 1 miR-31 AGGCAAGAUGCUGGCAUAGCUG 2 0 0 22 22 22 0.0 1 miR-92 UAUUGCACUUGUCCCGGCCUG 2 0 4 21 22 17 1.8 1 01120 miR-93 CAAAGUGCUGUUCGUGCAGGUAG 2 1 1 22 23 22 0.5 1 01110 miR-94 UAAAGUGCUGACAGUGCAGAU 1 0 0 21 21 21 0.0 1 miR-96 UUUGGCACUAGCACAUUUUUGCU 0 0 1 23 23 23 0.0 1 01110 miR-99b CACCCGUAGAACCGACCUUGCG 0 0 1 22 22 22 0.0 1 S00S0 miR-124-a UAAGGCACGCGGUGAAUGCCA 2 1 0 20 21 20 0.5 3 miR-127 UCGGAUCCGUCUGAGCUUGGCUA 1 0 0 23 23 23 0.0 1 miR-130 CAGUGCAAUGUUAAAAGGGCAU 5 3 4 22 25 22 0.8 1 11111 miR-141a UAACACUGUCUGGUAAAGAUGGCC 0 0 2 23 24 23 0.5 1 000S0 miR-142s CCCAUAAAGUAGAAAGCACUA 1 0 0 21 21 21 0.0 1 00000 miR-142-as UGUAGUGUUUCCUACUUUAUGGA 1 1 0 22 23 22 0.5 1 miR-143a UGAGAUGAAGCACUGUAGCUCUUA 1 0 0 24 24 24 0.0 1 miR-172 UGGCAGUGUCUUAGCUGGUUGUU 3 2 2 21 23 16 2.2 1 10010 miR-183 UAUGGCACUGGUAGAAUUCAC 0 0 1 21 21 21 0.0 1 SSSS0 miR-193 AACUGGCCUACAAAGUCCCAGU 1 0 0 22 22 22 0.0 1 S00S1 miR-199-s CCCAGUGUUCAGACUACCUGUUC 3 0 0 22 23 22 0.5 2 10001 miR-199-as ACAGUAGUCUGCACAUUGGUUA 2 0 0 22 22 22 0.0 3 20001
amiRNAs experimentally determined for the first time in this study are listed first. The letters “s” and “as” designate miRNAs excised from
the 5⬘’ and 3⬘strands of the same hairpin stem respectively, according to Lagos-Quintana et al. (2002).
bThe longest clone that matches perfectly the mouse genomic sequence is given. cNumber of observations in libraries L1, L2, and L3
dAverage, maximum and minimum lengths. Rmsd, root-mean-square deviation from the average. eNumber of genomic hits.
fExpression patterns by Northern analysis. Single digit numbers indicate the approximate relative band intensities as shown in Figure 2 and
give no information about the relative levels of different miRNAs. S indicates the presence of a smear that precluded detection of the miRNA.
gFor miR-290–miR-302, which do not have previously reported homologs, the presence of conserved stem loops in the human (Hs), rat (Rn),
(TG)n, SINE, B3, and B4 repeats in the ENSEMBL data- BLAST searches identified only a single human homo-log (miR-hes1, located on chromosome 19) of the six base. Hairpin miRNA precursors could be derived from
hairpins in the mouse cluster. However, systematic three of these locations. While it could be argued that
scanning of the genomic region adjacent to miR-hes1 stem loop structures would occur by chance in (CA)n,
for sequences that can fold into hairpins identified two (TG)n-rich sequences, expression data support the
exis-additional potential human pre-miRNAs (miR-hes2 and tence of miR-297 (discussed below).
miR-hes3) related to the members of the mouse cluster The remaining 14 potential miRNAs map to 12 distinct
(Figures 2A and 2C). Within the corresponding human stem loop precursors. Two of these hairpins (miR-291
and mouse genomic segments, the pre-miRNA hairpins and miR-292) yield cloned RNAs corresponding to both
are the only regions with obvious sequence homology. strands of the stem (Table 1).
Multiple sequence alignment revealed that six
pre-miRNA Expression Patterns during ES miRNA precursors (290, 291, 292,
miR-Cell Differentiation 293, miR-294, and miR-295) have related sequences
To confirm expression of miRNAs, we performed North-(Figure 2A). Mature miRNAs were processed from both
ern analyses on samples from undifferentiated and dif-the 5⬘ and the 3⬘ sides of these hairpins (Figure 2A;
ferentiated ES cell cultures (Figure 3A, lanes 2–4 in all miRNA consensus sequences 5⬘-ACUCAAANUGGGG
panels) as well as from the MEF feeder layer and NIH/ GCNCUCUUUU-3⬘ and 5⬘-AAAGUGCGC(N)2–4UUUUGA
3T3 cells (Figure 3A, lanes 1 and 5, respectively). A total GUGU-3⬘, respectively), and clones corresponding to
of 39 (74%) of the miRNAs shown in Table 1 were ana-the 3⬘sides were more frequently observed (Table 1).
lyzed. Of these, 30 gave robust bands migrating as RNA When two miRNAs are processed from the opposing
of approximately 20–24 nt in at least one lane (Figure strands of the same hairpin stem, it is thought that the
3A and Table 1). The rest either showed no detectable more abundant miRNA has a biological function,
signal or a smear that made it difficult to determine whereas the less abundant species is a nonfunctional
whether a discrete band was present. Of the 15 clones byproduct of the reaction catalyzed by Dicer
(Lagos-unrelated to previously described miRNAs, we con-Quintana et al., 2002; Lau et al., 2001).
firmed the expression of 11 by Northern analysis, includ-Interestingly, the above six related pre-miRNAs map
ing at least 1 mature miRNA from each of the 6 clustered in the same relative orientation within a 2.2 kb region of
hairpins (Figure 3A and Table 1). Three of the remaining genomic sequence that has not been assigned a specific
four clones could not be detected (miR-298, miR-299, chromosomal location in the mouse genome assembly
and miR-300), and one other clone (miR-291-s) was not (Figure 2B). Thus, adjacent hairpins in the cluster may
tested. be initially synthesized as common primary transcripts
Northern analyses showed that miR-29a, miR-29b, (pri-miRNA) (Lee et al., 2002). miR-193, miR-199-s, and miR-199-as were detectable Over 200 miRNAs have been cloned from mammalian only in the MEFs and NIH/3T3 cells, but not in undifferen-cell lines and mouse organs, but none have been derived tiated or differentiated ES cell cultures (Table 1 and from early embryos. Therefore, the fact that miRNAs data not shown). Thus, library L1 did contain some MEF expressed from the hairpin cluster have not been ob- sequence contamination.
served previously strongly suggests that they are indeed miRNAs processed from the hairpin cluster (miR-290, ES cell specific. To obtain additional support for this 291-as, 292-as, 293, 294, and miR-conclusion, we searched the expressed sequence tag 295) were expressed in ES cells grown with feeders, ES (EST) database for entries homologous to the 2.2 kb cells grown without feeders, and ES cells differentiated segment containing the cluster of six pre-miRNAs. Con- for 4 days in monolayer in the presence of RA, but not sistent with the miRNA cloning data, the top seven- in MEFs or NIH/3T3 cells (Figure 3A and Table 1). More scoring ESTs (score, ⱖ315, and identity, ⱖ98%) that importantly, these miRNAs were repressed in embryoid map within this genomic segment correspond to cDNAs bodies prepared by culturing ES cells for 14 days in prepared from preimplantation embryos or ES cells (Fig- either the presence or absence of RA (Figure 3B, com-ure 2B). ESTs derived from preimplantation embryos or pare lanes 1 and 2 with lanes 3 and 4). Furthermore, ES cells constitute approximately 5% of the total mouse Northern analyses failed to detect miRNAs from the clus-EST data in GenBank. clus-ESTs from the remainder of the ter in adult mouse organs (Figure 3B, lanes 5–12). In database aligned better elsewhere in the mouse genome contrast, consistent with previous reports, let-7c and and/or were homologous to multiple genomic locations miR-16 were readily detectable in many of the organs (data not shown). Thus, the EST data strongly suggests (Lagos-Quintana et al., 2002, 2003). The above results that expression of the miRNA cluster is restricted to strongly suggest that expression of the pre-miRNA clus-preimplantation embryos and ES cells and supports the ter is specific for pluripotent ES cells and is either si-existence of a large primary transcript encompassing lenced or downregulated upon differentiation. This con-clusion does not conflict with the expression of the several hairpins (Figure 2B).
Figure 2. Genomic Organization of the ES Cell-Specific miRNA Clusters
(A) Multiple sequence alignment of the genomic DNA segments corresponding to the cluster of mouse ES cell-specific pre-miRNAs (miR-290, 291, 292, 293, 294, and 295) and their human homologs (miR-hes1, 2, and 3). The positions of mature miRNAs that were cloned are highlighted in yellow. Conserved residues are shown in red. The mouse and human clusters are illustrated in (B) and (C), respectively, together with the secondary structures of proposed precursor RNAs. The experimentally determined (B) and hypothetical (C) positions of the mature miRNAs are shown in red. Genomic coordinates are given as chromosome:start-end (Un, unmapped sequence space). ESTs that map to the mouse cluster are shown with their GenBank accession numbers in (B).
Figure 3. Northern Analyses of the miRNA Expression Patterns
In (A) the arrangement of samples is identical in all panels and is as follows: lane 1, feeder layer; lane 2, ES cells grown on feeders; lane 3, ES cells grown without feeders; lane 4, ES cells differentiated in monolayer with RA; lane 5, NIH/3T3 cells. The names of the miRNAs analyzed are given above each panel. tRNA-Ile-ATT serves as a loading control. Because of different exposures, comparisons of the signals between panels are not meaningful.
(B) Expression of miRNAs in ES cells (lane 1), ES cells differentiated in monolayer in the presence of RA (lane 2), embryoid bodies cultured for 14 days without (lane 3) and with (lane 4) RA, and mouse organs (lanes 5–12). The names of the organs are given on top, and the names of the miRNAs are given on the right.
above cluster in ES cells differentiated in monolayer. consists of the miRNAs processed from the hairpin clus-ter and, potentially, miR-296. (2) miRNAs that are ex-The half-life of these miRNAs may be sufficiently long
that 4 days of culture might not be adequate for their pressed in ES cell cultures as in (1) but were found in adult tissues by previous cloning. These are likely to clearance.
Four other miRNAs, unrelated to previously described regulate general aspects of cell physiology. This set consists of miR-15a, miR-16, miR-19b, miR-92, miR-93, sequences, were detected by Northern analyses
(miR-296, miR-297, miR-301, and miR-302). Their expression miR-96, miR-130 and miR-130b. (3) The set of miRNAs cloned from undifferentiated ES cells, the expression of patterns suggest that only miR-296 could potentially be
ES cell specific (Figure 3A and Table 1). which increases dramatically upon differentiation. Such miRNAs are almost certainly contributed by the subpop-It is difficult, with the results to date, to conclude that
an miRNA is expressed in undifferentiated ES cells if ulation of spontaneously differentiated cells in the cul-ture. Among this set are miR-21 and miR-22.
this same miRNA is induced upon differentiation. This
difficulty arises because all ES cell cultures contain a The cluster of ES cell-specific pre-miRNAs could have important roles in maintaining the pluripotent cell state. small proportion of spontaneously differentiated cells.
In spite of this, it is tempting to group the miRNA expres- Short, 20–24 nt RNAs, either miRNAs or siRNAs, are known to regulate gene expression by three different sion data into the following three patterns. (1) The set
of miRNAs, the levels of which remain relatively constant mechanisms. The first is the silencing of a gene by di-recting mRNA degradation. This requires extensive in undifferentiated ES cells and in monolayer cultures
differentiated with RA and which were not found in adult complementarity between the short RNA and a target site in the mRNA (Doench et al., 2003; Hutvagner and tissues by either Northern analyses or previous cloning.
Acknowledgments
Pertinent to this, none of the miRNAs processed from the hairpin cluster are exactly complementary to known
We would like to thank N. Lau and D. Bartel for sharing their miRNA mRNAs. The second mechanism involves directing
inhi-cloning protocols and D. Bartel, A. Grishok, D. Tantin, D. Dimova, bition of transcription due to either chromatin modifica- C. Novina, J. Doench, C. Petersen, D. Dykxhoorn, C. Cheng, and V. tion or DNA methylation (Hall et al., 2002; Jones et al., Wang for discussions and critical review of the manuscript. This research was supported by fellowship 61-1154 from the Jane Coffin 2001; Mette et al., 2000; Volpe et al., 2002). While the
Childs Fund for Medical Research to H.B.H., genetics training grant extent of complementarity required for transcriptional
T32-GM07748 from the National Institutes of Health to M.F.M., silencing by short RNAs has not been investigated, we
United States Public Health Service MERIT Award R37-GM34277 note that no loci within the mouse genome, other than
from the National Institutes of Health, National Science Foundation the actual hairpin precursors, are exactly complemen- Grant 021850, and PO1 grant CA42063 from the National Cancer tary to clones originating from the pre-miRNA cluster. Institute to P.A.S., and, partially, by Cancer Center Support (core)
grant P30-CA14051 from the National Cancer Institute. The third mechanism is the traditional role of inhibiting
translation by miRNAs pairing with partial
complemen-Received: May 9, 2003 tarity to 3⬘untranslated regions of mRNAs (Olsen and
Revised: June 3, 2003 Ambros, 1999; Slack et al., 2000). We believe that this
Accepted: June 18, 2003 is the probable role of the ES cell-specific miRNAs. As Published online: July 3, 2003 yet, their targets have not been identified. Given that
miRNAs in this family have conserved consensus se- References
quences at their 5⬘and 3⬘ends (Figure 2A), it is possible
Ambros, V., Bartel, B., Bartel, D.P., Burge, C.B., Carrington, J.C., that they pair to the same set of mRNA targets.
Chen, X., Dreyfuss, G., Eddy, S.R., Griffiths-Jones, S., Marshall, M., Since ES cells are derived from the ICM of blastocysts,
et al. (2003). A uniform system for microRNA annotation. RNA9, the cluster of ES cell-specific miRNAs is likely to be
277–279. involved in the regulation of early embryonic
develop-Brennecke, J., Hipfner, D.R., Stark, A., Russell, R.B., and Cohen, ment. Because the sequence of events that takes place S.M. (2003). Bantam encodes a developmentally regulated mi-prior to implantation is unique to mammals, our failure croRNA that controls cell proliferation and regulates the proapo-to identify homologs of the ES cell-specific miRNAs in ptotic gene hid in Drosophila. Cell113, 25–36.
the fishD. rerioandF. rubripesmay suggest a role in Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform ex-developmental transitions that only occur in mammals,
traction. Anal. Biochem.162, 156–159. such as the differentiation of the epiblast and
tropho-Cooper, H.M., Tamura, R.N., and Quaranta, V. (1991). The major blast lineages in the blastocyst. Alternatively, these ES
laminin receptor of mouse embryonic stem cells is a novel isoform cell-specific miRNAs could be related to the pluripotent
of the alpha 6 beta 1 integrin. J. Cell Biol.115, 843–850. status of the ES cell. In this case, the same miRNAs
Doench, J.G., Petersen, C.P., and Sharp, P.A. (2003). siRNAs can might be expressed in adult stem cells, and homologs
function as miRNAs. Genes Dev.17, 438–442. would be present in all vertebrates.
Dostie, J., Mourelatos, Z., Yang, M., Sharma, A., and Dreyfuss, G. (2003). Numerous microRNPs in neuronal cells containing novel
mi-Experimental Procedures croRNAs. RNA9, 631–632.
Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K.,
ES Cell Growth and Differentiation
and Tuschl, T. (2001a). Duplexes of 21-nucleotide RNAs mediate J1 ES cells were grown under standard conditions. Differentiation
RNA interference in cultured mammalian cells. Nature411, 494–498. in monolayer and embryoid bodies was as described (Guan et al.,
Elbashir, S.M., Lendeckel, W., and Tuschl, T. (2001b). RNA interfer-2001; Wutz and Jaenisch, 2000).
ence is mediated by 21- and 22-nucleotide RNAs. Genes Dev.15, 188–200.
miRNA Preparation, Cloning, and Northern Analyses
Grishok, A., Pasquinelli, A.E., Conte, D., Li, N., Parrish, S., Ha, I., Oct4 was detected with a mixture of radiolabeled RT-PCR products
Baillie, D.L., Fire, A., Ruvkun, G., and Mello, C.C. (2001). Genes and from ES cell total RNA amplified with primer pairs 5⬘-GTGAACAT
mechanisms related to RNA interference regulate expression of the CAGGTGCCCACT-3⬘/5⬘-GTATCGGGGAATGCTGTCAT-3⬘and 5⬘-ACC
small temporal RNAs that control C. elegans developmental timing. AGGCTCAGAGGTATTGG-3⬘/5⬘-TTCATGTCCTGGGACTCCTC-3⬘. The
Cell106, 23–34. -actin and 18S rRNA probes were synthesized by random priming
Guan, K., Chang, H., Rolletschek, A., and Wobus, A.M. (2001). Em-of DECAtemplates (Ambion).
bryonic stem cell-derived neurogenesis. Retinoic acid induction and miRNAs were extracted via the acid guanidinium method
(Chom-lineage selection of neuronal cells. Cell Tissue Res.305, 171–176. czynski and Sacchi, 1987), except that all precipitations were done
with 3 volumes of ethanol, instead of isopropanol, in order to ensure Hall, I.M., Shankaranarayana, G.D., Noma, K., Ayoub, N., Cohen, the recovery of short oligonucleotides. Northern analysis and clon- A., and Grewal, S.I. (2002). Establishment and maintenance of a ing of short RNAs were performed essentially as previously de- heterochromatin domain. Science297, 2232–2237.
scribed (Hamilton and Baulcombe, 1999; Lau et al., 2001). Hamilton, A.J., and Baulcombe, D.C. (1999). A species of small anti-sense RNA in posttranscriptional gene silencing in plants. Science
Bioinformatics 286, 950–952.
Database searches were performed at the ENSEMBL server (http:// Hammond, S.M., Bernstein, E., Beach, D., and Hannon, G.J. (2000). www.ensembl.org). PERL scripts for the automatic submission of An RNA-directed nuclease mediates post-transcriptional gene si-blast jobs and for the retrieval of the search results were based on lencing in Drosophila cells. Nature404, 293–296.
the standard LWP, HTML, and HTTP PERL modules. Scripts for the
Higgins, D.G., and Sharp, P.M. (1988). CLUSTAL: a package for analysis of miRNAs against the ENSEMBL genomic annotations
performing multiple sequence alignment on a microcomputer. Gene interacted directly with the relational database and relied extensively
73, 237–244. on the ENSEMBL PERL API. miRNA sequence comparisons were
Hutvagner, G., and Zamore, P.D. (2002). A microRNA in a multiple-performed by multiple sequence alignment with CLUSTALW
(Hig-turnover RNAi enzyme complex. Science297, 2056–2060. gins and Sharp, 1988). Folding of miRNA precursors was performed
and Zamore, P.D. (2001). A cellular function for the RNA-interference Tang, G., Reinhart, B.J., Bartel, D.P., and Zamore, P.D. (2003). A biochemical framework for RNA silencing in plants. Genes Dev.17, enzyme Dicer in the maturation of the let-7 small temporal RNA.
Science293, 834–838. 49–63.
Volpe, T.A., Kidner, C., Hall, I.M., Teng, G., Grewal, S.I., and Martiens-Jones, L., Ratcliff, F., and Baulcombe, D.C. (2001). RNA-directed
transcriptional gene silencing in plants can be inherited indepen- sen, R.A. (2002). Regulation of heterochromatic silencing and his-tone H3 lysine-9 methylation by RNAi. Science297, 1833–1837. dently of the RNA trigger and requires Met1 for maintenance. Curr.
Biol.11, 747–757. Wutz, A., and Jaenisch, R. (2000). A shift from reversible to irrevers-ible X inactivation is triggered during ES cell differentiation. Mol. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., and Tuschl, T.
(2001). Identification of novel genes coding for small expressed Cell5, 695–705.
RNAs. Science294, 853–858. Xie, Z., Kasschau, K.D., and Carrington, J.C. (2003). Negative Feed-back Regulation of Dicer-Like1 in Arabidopsis by microRNA-Guided Lagos-Quintana, M., Rauhut, R., Yalcin, A., Meyer, J., Lendeckel,
W., and Tuschl, T. (2002). Identification of tissue-specific microRNAs mRNA Degradation. Curr. Biol.13, 784–789.
from mouse. Curr. Biol.12, 735–739. Zamore, P.D., Tuschl, T., Sharp, P.A., and Bartel, D.P. (2000). RNAi: double-stranded RNA directs the ATP-dependent cleavage of Lagos-Quintana, M., Rauhut, R., Meyer, J., Borkhardt, A., and
Tuschl, T. (2003). New microRNAs from mouse and human. RNA9, mRNA at 21 to 23 nucleotide intervals. Cell101, 25–33.
175–179. Zuker, M., Mathews, D.H., and Turner, D.H. (1999). Algorithms and thermodynamics for RNA secondary structure prediction: a practical Lau, N.C., Lim, L.P., Weinstein, E.G., and Bartel, D.P. (2001). An
abundant class of tiny RNAs with probable regulatory roles in guide. In RNA Biochemistry and Biotechnology, J. Barciszewski, and B.F.C. Clark, eds. (Dordrecht, The Netherlands: Kluwer Academic Caenorhabditis elegans. Science294, 858–862.
Publishers). Lee, R.C., Feinbaum, R.L., and Ambros, V. (1993). The C. elegans
heterochronic gene lin-4 encodes small RNAs with antisense com-plementarity to lin-14. Cell75, 843–854.
Lee, Y., Jeon, K., Lee, J.T., Kim, S., and Kim, V.N. (2002). MicroRNA maturation: stepwise processing and subcellular localization. EMBO J.21, 4663–4670.
Lim, L.P., Glasner, M.E., Yekta, S., Burge, C.B., and Bartel, D.P. (2003a). Vertebrate microRNA Genes. Science299, 1540. Lim, L.P., Lau, N.C., Weinstein, E.G., Abdelhakim, A., Yekta, S., Rhoades, M.W., Burge, C.B., and Bartel, D.P. (2003b). The micro-RNAs of Caenorhabditis elegans. Genes Dev.17, 991–1008. Llave, C., Kasschau, K.D., Rector, M.A., and Carrington, J.C. (2002a). Endogenous and silencing-associated small RNAs in plants. Plant Cell14, 1605–1619.
Llave, C., Xie, Z., Kasschau, K.D., and Carrington, J.C. (2002b). Cleavage of Scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA. Science297, 2053–2056.
Mette, M.F., Aufsatz, W., van der Winden, J., Matzke, M.A., and Matzke, A.J. (2000). Transcriptional silencing and promoter methyla-tion triggered by double-stranded RNA. EMBO J.19, 5194–5201. Mourelatos, Z., Dostie, J., Paushkin, S., Sharma, A., Charroux, B., Abel, L., Rappsilber, J., Mann, M., and Dreyfuss, G. (2002). miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. Genes Dev.16, 720–728.
Olsen, P.H., and Ambros, V. (1999). The lin-4 regulatory RNA controls developmental timing in Caenorhabditis elegans by blocking LIN-14 protein synthesis after the initiation of translation. Dev. Biol.216, 671–680.
Reinhart, B.J., and Bartel, D.P. (2002). Small RNAs correspond to centromere heterochromatic repeats. Science297, 1831. Reinhart, B.J., Slack, F.J., Basson, M., Pasquinelli, A.E., Bettinger, J.C., Rougvie, A.E., Horvitz, H.R., and Ruvkun, G. (2000). The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhab-ditis elegans. Nature403, 901–906.
Reinhart, B.J., Weinstein, E.G., Rhoades, M.W., Bartel, B., and Bar-tel, D.P. (2002). MicroRNAs in plants. Genes Dev.16, 1616–1626. Rhoades, M.W., Reinhart, B.J., Lim, L.P., Burge, C.B., Bartel, B., and Bartel, D.P. (2002). Prediction of plant microRNA targets. Cell 110, 513–520.
Rosner, M.H., Vigano, M.A., Ozato, K., Timmons, P.M., Poirier, F., Rigby, P.W., and Staudt, L.M. (1990). A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature345, 686–692.
Slack, F.J., Basson, M., Liu, Z., Ambros, V., Horvitz, H.R., and Ruv-kun, G. (2000). The lin-41 RBCC gene acts in the C. elegans hetero-chronic pathway between the let-7 regulatory RNA and the LIN-29 transcription factor. Mol. Cell5, 659–669.
