Characterization of an Antisense Inr Element in the eif-2a Gene*

(1)

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 269, No. 46, Issue of November 18, pp. 29161-29167, 1994 Printed in U.S.A.

Characterization of an Antisense Inr Element in the eIF-2a Gene*

(Received for publication, July 15, 1994, and in revised form, August 29, 1994) Masayuki NoguchiS, Suzanne Miyamoto, Toby A. Silverman§, and Brian Safer

From the Molecular Hematology Branch, Section on Protein and RNA Biosynthesis, NHLBI, National Institutes of Health, Bethesda, Maryland 20892

We recently discovered an opposing initiator pro- moter (Inr) downstream of the sense promoter region of the eIF-2a gene (Silverman, T., Noguchi, M., and Safer, B.

(1992) J. BioZ. Chem. 267, 9738-9742). By reverse transcriptase/polymerase chain reaction analysis of Go and activated (GI) T-lymphocyte RNAs, overlapping sense and antisense transcripts are now identified.

Sense transcription of the eIF-2a gene proceeds from left to right to generate a-mRN& antisense transcrip- tion proceeds from right to left to generate RNA, having a sequence complementary to eIF-2a mRNA. Upstream indicates a position 5’ relative to the transcription start site. Using DNase I footprint analysis and EMSA, we have found a potential cis-regulatory sequence immedi- ately upstream of the Inr which binds a 43-kDa protein.

In addition to conferring protection against DNase I (+457 to +474), the factor also generates hypersensitive sites directly over the Inr (+447 to +457).

Insertion of the Inr footprint region into a luciferase reporter gene construct increases expression 150-fold.

While mutation of the Inr conserved sequence decreases luciferase activity by 50%, mutation of the 43-kDa factor binding site inhibits luciferase activity by 20%. Sense orientation of the Inr footprint region decreases activity by 80%. The 43-kDa Inr-associated binding protein may be involved in allowing access of RNA polymerase I1 transcription complexes to the initiation site of this TATA-less gene. A model for the regulation of eIF-Pa ex- pression involving the rapid degradation of dsRNA gen- erated by the relative activities of the two overlapping and opposing promoters is proposed.

By in vivo DNase

I

hypersensitivity analysis and deletional mutation of an eIF-2a promoter-driven

CAT’

expression vector, a regulatory element downstream of the cap-site cluster was recently identified (1). Sequence analysis of this region (+260/

+479) disclosed an Inr consensus element analogous to those of the

IVA2, ML,

and TdT promoters (2, 3, 331, but oriented to generate a potential antisense transcript. Deletion of this region or mutation of the Inr consensus sequence increased tran-

*

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked

“aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

to the GenBankTMIEMBL The nucleotide sequence(s) reported in this paper Data Bank with accession number(s) has been submitted X12421.

MD 20892. ^$Current address: PMI, OD, NHLBI, Bldg. 10, Rm. 7N244, Bethesda, Rockville Pike, Rockville, MD 20852. 8 Current address: FDA, Woodmont Bldg., Rm. 200 North, 1401 The abbreviations used are: CAT, chloramphenicol acetyltrans- ferase; eIF-2, eukaryotic initiation factor; Inr, initiator; EMSA, electrophoretic mobility shift assay; IBP, Inr-associated binding protein; PCR, polymerase chain reaction; HSS, hypersensitive site; bp, base paifis);

PAGE, polyacrylamide gel electrophoresis; ds, double-stranded.

scriptional activity of the eIF-2a gene 5-7-fold. By runoff in vitro transcription assays and primer extension analysis, a cluster of 6 transcription start sites was mapped to and downstream (3‘) of the Inr element.

The

data therefore suggested a mechanism for the regulation of eIF-2a gene expression

that

involved modulation by an overlapping antisense transcript.

Such antisense

RNA

regulation is well-documented in pro- karyotes, but has not been rigorously proved in higher eukaryotes (4). To examine this possibility, we used reverse transcriptasePCR to identify directly an antisense eIF-2a transcript in uiuo. Activity of the

eIF-2a

^antisense

Inr

^promoter in vivo was directly examined using a luciferase reporter gene.

In

addition, this region was analyzed by

DNase I

footprinting and electrophoretic mobility shift assay (EMSA) to detect

potential cis-regulatory elements.

EXPERIMENTAL PROCEDURES

Electrophoretic Gel Mobility Shift Assay (EMSA)-Uniformly labeled probes of the eIF-2a Inr promoter region (+422 to +479, Fig. 1B, wt) were generated by PCR as described previously (9) using the following primers:

was performed as described previously, with poly(dA-dT) as nonspecific DNA (5, 6). Binding reactions contained 2 4 fmol of probe (20-40 x

lo4

cpm) and 0.1 to 10 pg of protein.

DNase I Footprinting-The SfNaVEcoRI (+298 to +479) fragment of the eIF-2a promoter was uniquely end-labeled and purified on 6% TBE acrylamide gels as described previously (7). Binding reactions contained 1-10 ng of probe (20-40 kcpdincubation) and were conducted as described previously

(%lo).

To determine whether a single or multiple fadors generate the Inr HSS and adjacent footprint, oligonucleotide competitor for the Inr region (5‘-AAGTGCTCAGCGTCCA-3‘) and for the IBP binding domain (5’-CTGGAAAAAGCAAAG3’) were constructed. A double- stranded fragment 5’-TGTAGGCCACGTGACCGGGTG’IT was used as a nonspecific oligonucleotide competitor.

Construction of Luciferase Expression Vectors and Dansfection into 293 Cells-A 46-bp oligonucleotide extending from +440 to +480 con- taining the Inr promoter region and sites for XhoI and Hind111 was cloned by Dr. K. Yoshimura into a luciferase cassette (36, 40) kindly provided by Dr. T. Shimada (NHLBI, NIH) in either the sense or antisense orientation (Fig. 1C). To compare promoter activity conferred by the Inr oligonucleotide cassette to that obtained with the native sequence, a SstVEcoRI fragment (-1057 to +479) was linked to the luciferase vector in both the sense and antisense orientations. An oligonucleotide 5’-AGCTTATCGATACCGTCGACC-3’ from the multicloning site of P-Bluescript SK(+) (Stratagene) linked to the luciferase cassette served as a promoter-less negative control. CMV promoter-driven CAT constructs were cotransfected to normalize for variations in the transfection efficiency. The sequence of mutant oligonucleotides used in oth- erwise identical constructs are presented in Fig. 1B.

293 cells, a transformed human embryonic kidney cell line that expresses Adenovirus 5 E1A protein were grown under 5% Co, in Dulbecco’s modified Eagle’s medium (Biofluids) containing 10% new- born calf serum (Hyclone Laboratories), 100 unitdml penicillin and 100 pg/ml streptomycin. DNA-mediated gene transfer was performed by the calcium phosphate co-precipitation method (11, 12). Cells were seeded at 5 x

lo5

celldplate. 3 h prior to transfection, new media were added.

Cells were transfected with 10 pg of salmon sperm DNA as carrier, 200 ng of pCMV CAT plasmid as an internal control to normalize luciferase activities, and equal amounts of the test plasmids (5 pg). 40 h post- transfection, cells were harvested and lysed by successive cycles of freezing and thawing. Luciferase and CAT activities were analyzed as 5”ACCGTAACTC”l’ACCC and 5”CTCAAGCCTGGAAAAAGC. EMSA

29161

This is an Open Access article under the CC BY license.

(2)

29162 Antisense Regulation

of

eIF-2a Expression

A

Inr I

4‘ ¹

R l H3

+

1093 -74 -10

B

FIG. 1. Restriction map of the eIF-2a promoter region (-1057 to +1093). A, the 3’ transcription start site of the e1F-h gene is identified by the ar- row at +I. The opposing Inr promoter element extends from +447 to +457. The two binding sites (-10 to -74) of the transcription factor _a-PALare indicated as open squares (8). The Inr element is identified by the solid square. The sense transcription start site of the eIF-2a promoter and the antisense orientation of the Inr element are indicated as opposing arrows.

Digestion with Sfnu1 (+298) and EcoRI (+479) generates the 181-bp fragment HindIII ( H 3 ) sites define the boundaries used in DNase I footprinting. SstI ( S ) and of the eIF-2a promoter region used in the

luciferase expression vector. AuaI (A) and

C

SflVaI (Sf) sites are also indicated. B, eIF-2a sequences between +440 to +480 are shown for wild type (wt), mutant IBP (IBP mt), and mutant Inr (Inr mt) do- mains. The Inr mutation changes four bases in the core sequence of the Inr, from CTCA to GAAT on the noncoding strand.

TTT to CCC on the coding strand. For the The IBP binding domain is changed from purpose of subcloning into the luciferase cassette, XhoI and HindIII ends were added to each oligonucleotide. C, the luciferase expression vector used to evalu- tor was kindly provided by Dr. T. Shimada ate in vivo Inr promoter activity. This vec- (NHLBI, NIH). D, sequence of the downstream regulatory region identifymg the Inr element (.) and the reverse

D

transcriptaseiPCR primers used to identify the in vivo antisense transcripts.

G C T C A G G A C G C T G A G C A C T T T G C T T T T T C C A G G C T T G A G A C G A G T C C T G C G A C T C G T G A A A C G A A A A A G G T C C G A A C T C T

I

.

. e . .

.

^I

+440 +480

c c c

IBPrnt G C T C A G G A C G C T G A G C A C T T T G C T T T T T C C A G G C T T G A G A

I l l

coding

.

^{0 0 . 0}

.

Inr rnt C G A G T C C T G C G A C T C G T G A A A C G A A A A A G G T C C G A A C T C T non-coding T A A G

I l l /

Hindlll (Ndel+)Xhol

HinclVBlunt-Ended Hindlll Eco RI

L-AAS

pUC8-Luciferase (Luciferase cDNA)

Small t Intron Polyadenylation

I

4 5 1 GTACAGCCTC TACAATATGC CGAAAGTGAG AATGCCATGA CGA- CATGTCGGAG ACGTATACG GCmCACTC TAGGGTACT GCTACCCCGC 4 0 1 GTCTCAGGAG AACGCTGTGA CACCGTAACT CTMCCCCG GCTCAGGACQ

CAGGTGCTC TTGCGACACT GTGGCATGA GAAlTGGGGC CG4GTCCTGC

II

4 1 CTGAGCACll TGC‘ITmCC AGGClTGAGA A T C G.?$?$GT$A4 ACGAAAAAGG TCCGAACTCT TAAG

I l l

described previously (34,351. Data are presented as percent of wild type activity from six independent experiments.

Purification of the Inr-associated Binding Protein (IBP)-IBP was purified from K562 nuclear extract prepared as described previously (8, 13). Briefly, K562 nuclear extract was chromatographed on phosphocellulose equilibrated with Buffer A (20 mM Tris, pH 7.5, 0.1 m EDTA, 1 mM dithiothreitol, 0.1% Nonidet P-40 (Pierce), and 20% glyc- erol) containing 0.1 M KCl. IBP binding activity was eluted with a lin- ear KC1 gradient between 0.3 and 0.5 M KCl. After dialysis against 0.1

M KC1 Buffer A, IBP was concentrated on a nonspecific herring DNA column. For the final purification step, an IBP-specific DNA affinity column was prepared and used according to the method of Kadonaga and Tjian (141, using a multimeric oligomer of the Inr-FP region (+430 to +480). In the final DNA-affinity purification step, herring sperm DNA was used as the mobile competitor. IBP was step-eluted between

0.4 and 0.5 M KCl. IBP binding activity during the purification was monitored by EMSA.

Reverse ZFanscriptaseIPCR Amplification of eIF-2a Sense and Anti- sense l).anscripts-Total RNA isolated by the RNAzol (Tel-Test Inc.) procedure was analyzed by the rTth reverse transcriptase RNA PCR procedure (Perkin/Elmer Gene Amp Kit) exactly as described by the manufacturers. Reaction mixtures contained 10-200 ng of RNA. The sequences of the primers utilized were: primer I, 5’-GTA CAG CCT CTA CAA TAT GC; primer 11,5’-CGT CCT GAG CCG GGG TTAAG primer

To analyze eIF-2a sense RNA, reverse transcriptase was performed using primer 2 followed by PCR using primer I.

To analyze eIF-2a antisense RNA, reverse transcriptase was performed using primer I followed by PCR using primer 11. Primer I11 is used as a negative control since it would hybridize to sequences 111, 5”CAA GCC TGG AAA AAG CAA AG.

(3)

Antisense Regulation

of

e l F - 2 ~ ~ Expression 29163

"

2 4 6 t 3 a p g

- - +

Competitor

" "

1 2 3 4 5

FIG. 2. Detection of IBP binding by EMSA. A standard mobility shift was performed using a probe specific for the Inr and IBP region (Fig. 1B, wt). 2,4, 6, and 8 pg of partially purified protein from 0.3-0.5

M KC1 phosphocellulose fraction of K562 nuclear extracts was used as indicated. A 25-fold molar excess of unlabeled oligonucleotide competitor over probe was added to lane 5. F , NS, and IBP indicate the positions of free probe, nonspecific complex, and the probe-IBP complex, respectively.

upstream2 of the antisense promoter.

Briefly, the reverse transcriptase primer was annealed to RNA and extended at 70 "C for 10 min. Mn2+ was then chelated from the reaction mixture, and Mg2' was added to inactivate the reverse transcriptase reaction and to activate the PCR reaction. PCR was conducted by a two-temperature procedure for 35 cycles: melting was performed by ramping from 60 to 95 "C (10 s) while extension was performed at 60 "C for 15 s. PCR products were analyzed by native TBE PAGE on 6% gels and ethidium bromide staining.

Purification of RNA from Go and G, T-lymphocytes-Human periph- eral T-lymphocytes were purified and activated as described previously (18). Briefly, Go T-cells were purified from a fraction enriched in T-cells, B-cells, and macrophages obtained by elutriation by passage through a nylon wool column followed by overnight incubation in 250-ml plastic T-flasks. Activated T-cells were prepared by treatment of half of the Go T-cell population with phorbol 12-myristate 13-acetate/ionomycin. Total Go and activated T-cell (GI) RNAs were prepared from 10* cells and were stored in diethyl pyrocarbonate-treated water at -30 "C at a concentration of 250 pg/ml.

RESULTS

Mobility Shifc Analysis

of

the Inr Region-We have recently identified and characterized activity of

a

downstream regula- tory element in the eIF-212 promoter. This sequence modulates the level of expression of the eIF-2a sense transcript as meas- ured by an in vivo reporter gene assay

(1).

By

in vitro run-off

transcription, primer extension mapping, and sequence analy- sis of this region, we identified an antisense promoter that contained an initiator (Inr) element

(1).

To detect potential cis-acting regulatory elements in the re- gion, an electrophoretic mobility shift assay (EMSA) was per- formed. Using a radiolabeled oligonucleotide spanning the Inr region (Fig.

1B,

wt), incubation with increasing amounts of the 0.3-0.5

M

KC1 phosphocellulose fraction of K562 nuclear extract generated two DNA-protein complexes (Fig. 2, lanes

1-41.

The addition of 50-fold molar excess of the unlabeled oligonucleotide eliminated the lower mobility specific DNA-

Sense transcription of the eIF-2a gene proceeds from left to right to generate a-mRNA, antisense transcription proceeds from right to left to generate RNA, having a sequence complementary to eIF-2a mRNA.

Upstream indicates a position 5' relative to the transcription start site.

"IBP

- NS

2 4 6 8 10 12 14 16 18 GEL SLICE

FIG. 3. Identification of a 43-kDa Inr-associated binding pro- tein. Afhity-purified IBP was electrophoresed on a denaturing SDS- polyacrylamide gel. The gel was cut into slices corresponding to proteins of known Mr. Proteins in each slice were eluted and subjected to the denaturization-renaturation protocol of Hager and Burgess described in Ref. 8. Eluted fractions were assayed for binding activity in a gel shift assay using an Inr/IBP specific probe. Free probe ( F ) , nonspecific complex ( N S ) , and the specific IBP complex (IBP) are indicated. The left control lane is an aliquot of the affinity-purified IBP that was fractionated by SDS-PAGE. IBP actively elutes from gel slices corresponding to a M, ⁼40,000-45,000.

protein complex (Fig. 2, lane 5).

^An

oligonucleotide competitor specific for binding of the major late transcription factor (15) had no effect at the same concentration. Specific binding of a trans-acting factor to the Inr promoter region was therefore indicated.

To identify the protein responsible for the mobility shift band, a Hager-Burgess analysis was performed. DNA-affinity- purified protein binding to the Inr region was fractionated by SDS-PAGE along with M, calibration standards. Proteins were then eluted from individual gel slices containing proteins of known molecular weight, renatured, and analyzed for binding activity by the mobility shift assay. Specific binding activity was detected in fractions 12 and

13, corresponding to

a M,

= 40,000-45,000

(Fig. 3).

DNase I Footprint Analysis Identifies

a

Novel cis-Regulatory Sequence Adjacent to the Inr-To further characterize the fea- tures of this downstream regulatory region responsible for the in vitro expression of an eIFda antisense transcript, DNase I footprint analysis was performed. A 181-bp SfRraYEcoRI frag- ment, extending from

+298

to

+479

that included the Inr ele- ment, was used (Fig. 1A). K562 nuclear extract fractions eluted with a KC1 concentration step gradient

off

phosphocellulose were used for DNase I footprint analysis. The fraction eluting between

0.3

and

0.5 M

KC1 was found to confer strong protection against DNase I digestion on the noncoding strand in the re- gion immediately adjacent

(5')

to the Inr element (Fig.

4A).

Designating the

3'

cap-site of the eIF-2a gene as

+1,

the Inr element extends from

+447

to

+457

(Fig.

4C).

On the noncoding strand, protection against DNase I digestion extends from

+457

to

+474

(Fig. 4A 1. On the coding strand, protection is observed in the region

+451

to

+476

(Fig. 4B). In addition, DNase I hypersensitive sites (HSS) are observed on both strands di- rectly over the adjacent Inr element. In Fig.

4C,

the Inr se- quence is identified by dots in region I. The DNase I footprint (region 11) extends from

+457

to

+474.

Addition of a n oligonucleotide containing both the Inr con-

sensus and footprint sequence eliminated the footprint as well

as the HSS site (Fig.

4A,

lanes

4-6).

Addition of 50-, 125, and

(4)

29164

FIG. 4. In uitro DNase I footprinting of the antisense Inr promoter region.

A, an end-labeled DNA fragment (+298 to +479) was digested with DNase I in the absence (lunes 1 and 2 ) and presence (lunes 3-10) of partially purified K562 nuclear extract proteins from the 0.3-0.5 M

KC1 phosphocellulose fraction. A 50, 125, and 250 molar excess of the specific competitor which contains the Inr and IBP binding region sequence or nonspecific competitor were added as follows: lune 3, no competitor; lunes 4-6, titration of un- labeled specific competitors; lunes 7-9, titration of unlabeled random sequence as cold competitor; lunes 1 and 2 are no pro- tein controls; lune IO is a G

+

A ladder. B, on the coding strand, a similar pattern of protection and HSS is observed in the region +451 to +476. The boundaries of the DNA region protected from digestion are indicated as region I1 (lower panel). Hy- persensitive sites are present in region I.

C, sequence of the InrlIBP region. The conserved bases of the Inr element are identified by solid dots. The region pro- tected against DNase I digestion is indi- cated by the solid bur (11). The flunking thin line identifies the HSS regions ( I ) . Note that the orientation of the Inr element directs transcription in an antisense direction relative to the e1F-2~~ transcript.

Antisense Regulation

of

eIF-Za Expression

NON-CODING

A. c c

G+A

" " 1

I 2 3 4 5 6 7 8 9 1 0

C.

B.

^CODING

C

-+ 449

1 E

^HSS

250-fold molar excess of nonspecific competitor was without effect and did not alter the pattern of DNase I digestion (Fig.

4A,

lanes

7-9).

To determine if two distinct proteins were involved in the protection of these regions, DNA competitor fragments specific for either the Inr region or the IBP binding site were added to the binding reaction (Fig.

5).

In the absence of oligonucleotide competitors, protection of the IBP binding site and HSS over the Inr element was seen (Fig.

5,

lane

4 ) .

Addition of the Inr specific oligonucleotide competitor was without effect (Fig.

5,

lanes

5-7).

Addition of the IBP binding site oligonucleotide competitor, however, eliminated both the footprint and the HSS over the Inr element (Fig.

5,

lanes 8-10). It appears, therefore, that binding of IBP

is

responsible for both the footprint and the HSS over the Inr. In agreement with other studies (2, 3, 33), the Inr sequence does not appear to be directly recognized by trans-acting factors (see discussion) (Fig.

5).

Promoter Activity

^of

the eIF-2a

Znr

Element-To compare the relative promoter activities of the eIF-2cr and Inr promoters, a SstYEcoRI fragment extending from -1057 to +479 was in- serted into the luciferase cassette in both orientations (Fig.

6B ). Luciferase activity was then measured in transfected cells.

Transcriptional activity of the Inr promoter was 67% that of the eIF-2a promoter (Fig.

6A).

However, because of the overlapping and opposing orientation of the two promoters, these results should be regarded as qualitative. The data suggest that changes in the

rates

of sense eIF-2a and antisense Inr tran- scription could modulate the rate of eIF-2a gene expression.

Insertion of the Inr-footprint region

(+440

to

+480)

into

a

luciferase expression vector stimulates luciferase activity in 293 cellular extracts 150-fold, when oriented in

its

native configuration (Fig.

7,

columns 1 and

^{2 ) .}

Insertion of the Inr- footprint region in the opposite orientation gave &fold less

t6

I

-+ 474 - HSS

11 12 13

G ^- ^Inr ^IBP Competitor

A C C

+

"

1 2 3 4 5 6 7 8 9 1 0

GCTCAGGACGCTGAGCACTTTGCTTTTTCCAGGCTTGAGA CGAGTCCTGCGACTCGTGAAACGAAAAAGGTCCGAACTCT ""

Inr- " - -

_IBP

FIG. 5. Inr and IBP oligonucleotide competition of the DNase I-IBP footprint. Oligonucleotide competitors for the Inr or IBP region of the antisense promoter are underlined in the lower panel. Lune 1, G

+

Aladder; lunes 2 and 3, control (probe only) DNase I digestion pattern;

lune 4, DNase I footprint in the absence of oligonucleotide competitors;

lunes 5-7,50-, 125-, and 250-fold molar excess of the Inr oligonucleotide competitor; lunes 8-10, 50-, 125-, and 250-fold excess of the IBP oligonucleotide competitor. Conserved bases of the Inr promoter element are indicated by dots.

(5)

A.

I-

z

0 w

100 a 2 %

0 Antisense Regulation

of

eIF-2a Expression

A.

Sense Anti-Sense

B.

Sst I

- 1057 ^Eco^RI

I Luciferase

]

I

-

Luciferase

1

+479 4

-

EcoRl Sstl

FIG. 6. Comparison of sense and antisense transcription activ- ity from the eIF-2a and Inr promoter elements. To compare the sense and antisense transcriptional activity, the SstI (-1057)-EcoRI (+479) fragment was linked to the luciferase cassette in both the sense and antisense orientations (Fig. 5B). Antisense activity was 67% of the sense transcriptional activity in six independent experiments (Fig. 5 A ) .

activation (Fig. 7, column 3). Mutation of the Inr sequence inhibits luciferase activity by 50% (Fig. 7, column 5). Mutation of the IBP footprint region, however, only inhibited luciferase activity by 20% (Fig. 7, column 4 ) . While the data suggest a potential regulatory role for the binding of IBP to the region immediately upstream of the antisense-oriented Inr promoter, more extensive evaluation of this and upstream regions is required.

Reverse D-anscriptase IPCR Identifies the eZF-2a Antisense D-anscript in Vivo-Although its existence was implied by the primer extension analysis (l), Northern and ribonuclease protection assay analyses were unable to confirm directly an antisense eIF-2a transcript in vivo. Since such antisense transcripts might not accumulate because of rapid degradation (421, the more sensitive reverse transcriptasePCR assay was utilized.

Total

RNA prepared from Go and activated

(GI)

T-lymphocytes was analyzed. Using the primer pair I/II shown in Fig. 8 A , an antisense product of the predicted size (100 bp) was generated. When the primer pair MI1 was used, however, no specific PCR product was produced. This is the expected result since the antisense transcript is initiated at a downstream’ site. When either the I1 or I11 primer was used to generate the cDNA copy of the eIF-Sa sense transcript, PCR products of the correct size were generated (100 bp and 127 bp, respectively, data not shown). In addition, titration of the amount of RNA used for the reverse transcriptase component of this assay showed that the amount of PCR product produced was directly proportional, and that no PCR product was produced in the absence of RNA (Fig. 8B). RNA prepared from Go and G, T-cells was then analyzed. A strong PCR band is generated using the primer pair specific for detection of anti- sense RNA in Go cells (Fig. 9A, lanes 1 4 ) . When T-cells are activated, antisense RNA is almost completely abolished (Fig.

9A, lanes 6-10). In Go T-cells, however, the level of sense eIF-2a transcripts is very low (Fig. 9B, lanes 16), while after activation the sense transcript is easily detected (Fig. 9B, lanes 6-10).

Luciferase wt

29165

T

wt mt mt Casette Inr/lBP Inr/lBP IBP Inr

Antisense Sense

1

2

3 4 ⁵

B.

1. Promoterless Luciferase cDNA

Construct 2. wt Inr/lBP

Antisense

Luciferase cDNA

?I

3. wt Inr/lBP Inr IBP Luciferase cDNA Sense

4. rnt IBP IBP mt Inr Luciferase cDNA

5. rnt Inr Luciferase cDNA

FIG. 7. Luciferase assay of wild type and mutant Inr promoter elements. A promoterless luciferase construct was used as a negative control (column I ) ; wild type oligonucleotide promoter in the native antisense orientation (column ^2);wild type promoter in the sense orientation (column 3); mutation of the IBP binding domain _(column4 ) ; and mutation of Inr consensus sequence (column 5) (see Fig. 1B) were linked to the luciferase cassettes as shown in Fig. 1C to detect the changes of Inr promoter activity. Transient transfections were performed, as described under “Experimental Procedures.” Data from three independent experiments are expressed as percent activity of the wild type (lane 2 ) .

DISCUSSION

The eukaryotic translation initiation factor eIF-2 catalyzes binding of Met-RNA, to 43

S

ribosomal subunits, the first regulated step of protein synthesis initiation (16). Regulation of eIF-2 activity occurs at the transcriptional, post-transcriptional, and translational levels (17, 18, 51). Typical of many housekeeping genes, the eIF-2a promoter is GC-rich, contains no TATA box, and initiates transcription at multiple sites (19).

We have shown that the large increase in eIF-2a mRNA following mitogenic activation of T-lymphocytes is neither the result of increased eIF-2a transcription nor increased half-life of eIF-2a mRNA. Rather, changes in processing andor stabiliza- tion of the primary transcript within the nucleus appear to be responsible (17). To identify and characterize features of the eIF-2a gene that might mediate such regulation, 5’ and 3‘

deletion analysis was performed. 5’ deletion analysis did not result in transcriptional inhibition until the binding site for a-PAL (-74 to -10) was removed (1). In contrast, deletion of the downstream

HSS

domain (8) stimulated activity of a CAT ex-

(6)

29166 Antisense Regulation

TI

-

_II

_.J

₁₁₁

A. B.

Primer Pair 1/11 l/llI

nm

Antisense

-

I Antisense

elF-2a - elF-2a

-Primer Dimer -Primer

i

^. ^...^.

2 4 8 2 4 8 0 10 25 50100

Mmutes ng RNA

transcriptaselPCR.A, antisense eIF-2a RNAis detected in FIG. 8. Specificity of the primer pairs utilized for reverse G, RNAby first extending primer I1 followed by PCR amplification with primers I1 and I. No PCR product is produced using primer 111 since this primer does not hybridize to the antisense transcript initiated from the downstream antisense-oriented promoter. Reverse transcriptase was performed for 2, 4, or 8 min prior to the coupled PCR reaction. Details are provided under “Experimental Procedures.”B, eIF-2a antisense RNAis detected by the reverse transcriptasePCR procedure over a range of RNA from 10 to 100 ng RNA. No PCR product is seen in the control (0 ng RNA) lane. The positions of free primers and primer dimers are indicated.

GA G.

B. -

Sense elF-2a

1 2 3 4 5 6 7 a 9 1 0

FIG. 9. Reverse transcriptasePCR of Go and G, T-lymphocyte RNA. RNA prepared from G , T-lymphocytes and phorbol 12-myristate 13-acetate/ionomycin-activated ( G , ) T-cells was analyzed for eIF-2a specific sense and antisense transcripts as described under “Experimental Procedures.” As shown in lunes I d , antisense eIF-2a transcripts are detected in G,, but not G , T-lymphocytes. Conversely, sense eIF-2a transcripts are absent from G, RNA, but are detected following T-cell activation. Lunes I and 6,200 ng of RNA 2 and 7,150 ng of RNA; 3 and 8, 100 ng of RNA, 4 and 9,50 ng of RNA; 5 and ^10,25 ng of RNA.

pression vector 5-8-fold (1). By primer extension mapping of an in vitro transcript, a promoter was identified which initiated transcription in an antisense orientation from an Inr consensus element (41, 43). The data suggested, therefore, a potential mechanism for the regulation of eIF-2a gene expression involving antisense RNA (1).

In this report we have characterized the downstream antisense Inr. By EMSA and in vitro DNase I footprint analysis, a potential cis-regulatory sequence immediately upstream of the Inr promoter element was identified. Binding of a 43-kDa protein to this site not only conferred protection against DNase

I

digestion in a region immediately 5‘ to the Inr, but also induced the formation of hypersensitive bands directly over the Inr element. This has been associated with the formation of open

of

eIF-2a Expression

transcription complexes, which allow access of RNA I1 polymerase. It is speculated that formation of such open complexes may be particularly important for TATA-less genes, for which transcription complexes are believed to assemble prior to binding to the initiator region (37,41,43). The function of IBP may therefore be not only to directly modulate transcriptional activity, but to allow transcription initiation complexes access to the Inr site.

Mutation of the Inr element which inhibits its antisense transcriptional activity stimulates sense transcription from the eIF-2a promoter 5- to 8-fold (1). In addition, we have demon- strated directly by reverse transcriptasePCR that an eIF-2a antisense transcript exists in uiuo. Until recently, antisense transcripts could not be detected even though a biological effect could be observed (21, 22). This may be due to the intrinsic liability of RNA duplexes (20-22). Although containing several short open reading frames, the antisense Inr transcript does not appear

to

encode any known protein. A model for the regulation of eIF-2a gene expression in T-cells is suggested. In the resting

Go

T-cell which contains very low levels of eIF-2a mRNA, a low rate of constitutive eIF-2a transcription is matched by the synthesis of antisense eIF-2a RNA originating from the downstream Inr element leading to generation of double-stranded (ds) RNA. Duplex RNAs thus formed are highly susceptible to nuclease attack (44-48). Nuclease degradation of the double-stranded RNA could be regulated by the activity by the unwinding-modification enzyme first described by Bass and Weintraub (20), other RNA helicases (e.g. eIF-4A) (49), and/or by modulation of dsRNase activity itself (42). Since the duplex RNA spans the first intron-exon junction, interference with splicing could also occur, leading indirectly to increased degradation of the primary transcript (42). Upon mitogenic activation, sense transcription increases (2-3-fold) and antisense transcription is inhibited. Only

a

small part of the sense eIF-2a primary transcript now forms a sense-antisense RNA duplex, and the major part of the sense transcript can now be efficiently processed and exported to the cytoplasm as mature mRNA.

Regulation of gene expression by such an antisense RNA mechanism has been well documented in prokaryotic systems (4, 23). In eukaryotes, however, such reports are rare and re- main only partly confirmed. In addition, although there are now numerous examples of divergent promoters, very few of these promoters also overlap (24). Regulated expression of eukaryotic genes by a natural antisense RNA mechanism has now been reported for L-dopamine: decarboxylase in Drosophila (25), human ERCC-1(26), human bovine fibroblast growth fac- tor (50), human thrombospondin (27), and murine N-myc (24).

In addition, the tissue distribution of an essential element of proposed antisense mechanisms, the unwinding-modification enzyme, appears to be widespread, if not global (28). It is not clear, however,

at

which step in the pathway leading to accu- mulation of mature cytosolic mRNA, antisense RNA might act.

Premature transcription termination (29,52), translational ar- rest (30,531, and interference with nuclear transport (31) have all been proposed, in addition to increased degradation of dsRNA (32). It is also possible that formation of intramolecular dsRNA regions (e.g. cruciform structures) could directly target enzymatic modification of both sense and antisense RNA (24).

The Inr element identified in the eIF-2a promoter region has a consensus sequence identical with that utilized by the Ad2 ML, Ad2 IVa2, and Tdt promoters (33). Similar to this class of initiator elements, the eIF-2a Inr is not directly recognized by trans-acting factors (33, 38, 39). It differs, however, in two respects. First it is positioned downstream in an antisense orientation. Second, binding of a trans-acting factor to a site immediately upstream of the Inr confers DNase I hypersensi-

(7)

Antisense Regulation of eIF-2a Expression 29167

tivity directly over the Inr element. Binding of a trans-acting factor to this site may stabilize the weak binding of RNA po- lymerase I1

to

the Inr which has been recently reported (33).

REFERENCES

1. Silverman, T., Noguchi, M., and Safer, B. (1992) J. Biol. Chem. 267,9738-9742 2. Smale, S. T., and Baltimore, D. (1989) Cell 57, 103-113

3. Carcamo, J., Maldonado, E., Cortes, P., Alin, M. H., and Reinberg, D. (1990) 4. Green, P. J., Pines, O., and Inouye, M. (1986)Annu. Reu. Biochem. 55,569-597 5. Freid, M., and Crothers, D. M. (1981) Nucleic Acids Res. 9, 65054525 6. Garner, M. M., and Kevzin, A. (1981) Nucleic Acids Res. 9,3047-3060 7. Galas, D. J., and Schmitz, A. (1978) Nucleic Acids Res. 5, 3157-3170 8. Jacob, W. F., Silverman, T. A,, Cohen, R. B., and Safer, B. (1989) J. Biol. Chem.

9. Safer, B., Reinberg, D., Jacob, W. F., Maldonado, E., Carcamo, J., Garfinkel, S., 10. Garfinkel, S., Thompson, J. A,, Jacob, W. F., Cohen, R., and Safer, B. (1990) 11. Graham, F. L., and Van der Eb, A. J. (1973) Virology 52, 456-467

12. Wigler, M., Pellicer, A., Silverstein, S., and Axel, R. (1978) Cell 14, 725-731 13. Dignam, J. D., Lebowitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11, 14. Kadonaga, J. T., and Qian, R. (1986) Proc. Natl. Acad. Sci. U. S. A. 83,5889- 15. Safer, B., Cohen, R. B., Garfinkel, S., and Thompson, J. A. (1988) Mol. Cell.

16. Pain, V. M. (1986) Biochem. J. 235, 625437

18. Boal, T. R., Chiorini, J. A,, Cohen, R. B., Miyamoto, 17. Cohen, R. B., Boal, T. R., and Safer, B. (1990) EMBO J. 9,3831-3837 S., Frederickson, R. M., Sonenberg, N., and Safer, B. (1993) Biochim. Biophys. Acta 1176,257-264 19. Humbelin, M., Safer, B., Chiorini, J. A., Hershey, J. W. B., and Cohen, R. B.

20. Bass, B. L., and Weintraub, H. (1988) Cell 55, 1089-1098 (1989) Gene (Amst.) 81,315-324

21. Kasid, U., Pfeifer, A., Brennan, T., Beckett, M., Weichselbaum, R. R., 22. Crowley, T. E., Nellen, W., Gomer, R. H., and Firtel, R. A. (1985) Cell 43, 23. Helene, C., and Toulme, J. J. (1990) Biochim. Biophys. Acta 1049, 99-125 24. Krystal, G. W., Armstrong, B. C., and Battey, J. F. (1990) Mol. Cell. Biol. 10, 25. Spencer, C. A,, Geitz, R. D., and Hodgetts, R. B. (1986) Nature 322, 279-281 26. Duin, M., Tol, J., Haeijmarkers, J. H. J., Bootsma, D., Rupp, I. P., Reynolds, P.,

Genes & Deu. 4, 1611-1622

264,20372-20384

and Cohen, R. (1991) J. Biol. Chem. 266, 10989-10994 J. Biol. Chem. 265, 10309-10319

1475-1489 5893

Biol. 8, 105-113

Dritschilo, A,, and Mark, G. E. (1989) Science 243, 1354-1356 633441

4180-4191

27.

28.

29.

30.

31. 32.

33.

34.

35.

36.

38. 37.

39.

40.

41.

42. 43.

44. 45.

46. 47.

48.

49. 50.

51.

52.

53.

Castle, V., Varani, Prakash, L., and Prakash, S. (1989) J., Fligiel, S., Prochownik, E. V., and Dixit, Mol. Cell. Biol. 9, 1794-1798 V. (1991) J. Clin.

Wagner, R. W., Yoo, C., Wrabetz, L., Kamholz, Inuest. 87, 1883-1888 J., Buchalter, J., Hassan, N. E, Khalili, K., Kim, S. U., Perussia, B., McMoms, F. A,, and Nishikura, K.

(1990) Mol. Cell. Biol. 10, 55865590

Okamoto, K., and Frendlich, M. (1986) Proc. Natl. Acad. Sei. U. S. A. 83, 5000-5004

Kozak, M. (1991) J. Biol. Chem. 266, 19867-19870 Skeiky, Y., and Iatrou, K. (1990) J. Mol. Biol. 213, 5 3 4 6 Krinke, L., and Wolft, D. G. (1978) Genes & Deu. 1, 1005-1013

Carcamo, J., Buckbinder, L., and Reinberg, D. (1991) Proc. Natl. Acad. Sci.

de Wet, J. R., Wood, K. V., DeLuca, M., Helinski, D. R., and Subramani, S.

Gorman, C. M., Moffat, L. F., and Howard, B. H. (1982) Mol. Cell. Biol. 2, Liu, J. M., Green, S. W., Yu-Shu, H., McDonagh, K. T., Young, N. S., and Sawadogo, M., and Roeder, R. G. (1985) Cell 43, 165-175

Means, A. L., and Farnham, P. J. (1990) Mol. Cell. Biol. 10, 653461 Beaupain, D., Eleovet, J. F., and Romeo, P. H. (1990) Nucleic Acids Res. 18, de Wet, J. R., Wood, K. V., DeLuca, M., Helinski, D. R., and Subramani, S.

Weiss, L., and Reinberg, D. (1992) FASEB J. 6, 3300-3309

Nellen, W., and Lichtenstein, C. (1993) Dends Biochem. Sci. 18, 419-423 Zawel, L., and Reinberg, D. (1993) Nucleic Acids Res. 44, 67-108 Iino, Y., Sugimoto, A., and Yamamoto, M. (1991) EMBO J. 10, 221-226 Xu, H.-P., Riggs, M., Rogers, L., and Wigler, M. (1990) Nucleic Acids Res. 18, Meegan, J. M., and Marcus, P. I. (1989) Science 244, 1089-1091

Meurs, E. F., Galibm, J., Barber, G. N., Katze, M. G., and Hovanessian, A. G.

Hovanessian, A. G . (1993) in Danslational Regulation of Gene Expression 2 Rhoads, R. E. (1991) Curr. Opin. Cell Biol. 3, 1019-1024

Volk, R., Poeting, M., Hartmann, R., and Knoechel, W. (1989) EMBO J. 8, U. S. A. 88, 8052-8056

(1987) Mol. Cell. Biol. 7, 725-737 1044-1051

Shimada, T. (1991) Virology 185, 39-47

6509-6515

(1987) Mol. Cell. Biol. 7, 725-737

5304

(1993) Proc. Natl. Acad. Sei. U. S. A. 90, 232-236

(Ilan, J., ed) pp. 163-177, Plenum Publishing Co., New York

29U3-29RU

Chiorini, J. A,, Boal, T. ^-.^{- - -}- - - E., Miyamoto, S., and Safer, B. (1993) J. Biol. Chem.

268. 13748-13755

Lazar,". A,, Hodin, R. A., Darling, D. S., and Chin, W. W. (1989) Mol. Cell.

Melton, D. Biol. 9, 1128-1136 A. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 144-148