0095-1137/11/$12.00 doi:10.1128/JCM.00354-11
Copyright © 2011, American Society for Microbiology. All Rights Reserved.
MassARRAY Spectrometry Is More Sensitive than PreTect HPV-Proofer
and Consensus PCR for Type-Specific Detection of High-Risk
Oncogenic Human Papillomavirus Genotypes
in Cervical Cancer
䌤
Partha Basu,
1Puneet Chandna,
2R. N. K. Bamezai,
3Maqsood Siddiqi,
4Dhananjaya Saranath,
5Adrian Lear,
6and Sam Ratnam
7*
Chittaranjan National Cancer Institute, Kolkata, India1; AceProbe Technologies (India) Pvt. Ltd., New Delhi, India2; School of
Life Sciences, Jawaharlal Nehru University, New Delhi, India3; Cancer Foundation of India, Kolkata, India4;
Reliance Life Sciences, Mumbai, India5; Dr. H. Bliss Murphy Cancer Centre, St. John’s, Newfoundland and Labrador,
Canada6; and Public Health Laboratory, St. John’s, Newfoundland and Labrador, Canada7
Received 18 February 2011/Returned for modification 14 April 2011/Accepted 22 July 2011
Type-specific detection of human papillomavirus (HPV) is indicated for better risk stratification and clinical management of women testing positive for HPV and for epidemiologic surveillance. MassARRAY spectrometry (MassARRAY; Sequenom) is a novel method for type-specific detection of 15 high-risk oncogenic HPV types: HPV-16, -18, -31, -33, -35, -39, -45, -51, -52, -56, -58, -59, -66, -68, and -73. PreTect HPV-Proofer (Proofer; Norchip) is a type-specific assay that detects E6/E7 mRNA from five high-risk oncogenic HPV types: HPV-16, -18, -31, -33, and -45. The performance of these tests for type-specific identification of HPV was assessed with cervical specimens from 192 cases of cervical cancer in comparison with consensus MY09/MY11 PCR followed by nucleotide sequencing (consensus PCR). The overall HPV detection rates were 94.8% (95% confidence interval [CI], 91.7, 97.9), 83.3% (95% CI, 78.1, 88.5), and 86.5% (95% CI, 81.7, 91.3) for MassARRAY, Proofer, and consensus PCR, respectively. All tests were negative in six (3.1%) of the 192 cases. Considering only the specimens that contained at least one of the five types targeted by Proofer, the detection rates were 96.6%, 91.4%, and 86.9% for MassARRAY, Proofer, and consensus PCR, respectively. MassARRAY detected multiple infections in 14.1%, Proofer detected multiple infections in 3.6%, and consensus PCR failed to detect any
multiple infections. The agreement was highest at 86.0% (kappaⴝ0.76) between MassARRAY and Proofer and
lowest at 81.8% (kappaⴝ0.69) between Proofer and consensus PCR. In conclusion, MassARRAY is a highly
sensitive and accurate method for type-specific detection of oncogenic HPV in cervical cancer, with Proofer showing impressive performance.
Based on cervical cancer case-control studies, 15 human papillomavirus (HPV) types, HPV-16, -18, -31, -33, -35, -39, -45, -51, -52, -56, -58, -59, -68, -73, and -82, are classified as high-risk oncogenic types, and an additional three types, HPV-26, -53, and -66, are classified as probable oncogenic types associated with cervical cancer (6, 18). A recent report from the International Agency for Cancer Research lists 12 of these types, HPV-16, -18, -31, -33, -35, -39, -45, -51, -52, -56, -58, and -59, as having sufficient evidence for causing cervical cancer (3). Regardless, just eight of these types, HPV-16, -18, -31, -33, -35, -45, -52, and -58, account for 95% of HPV-positive cervical cancers worldwide with HPV-16 and -18 accounting for about 70% of cervical cancers (2, 18). In recent years, evidence has mounted for the type-specific identification of HPV-16 and -18 to aid risk stratification and better clinical management of women testing positive for HPV, as these two types are asso-ciated with persistent infection and lesion progression, thus conferring a significantly higher risk for cervical cancer than other oncogenic types even in the absence of cytological ab-normalities (8, 14). Further, type-specific detection of HPV
could increase the overall specificity in routine screening and posttreatment follow-up (13). However, the currently available HPV tests generally do not provide information on individual genotypes (9, 11, 12).
MassARRAY spectrometry (MassARRAY, Sequenom Inc.) is a novel method for type specific detection of 15 high-risk onco-genic types, HPV-16, -18, -31, -33, -35, -39, -45, -51, -52, -56, -58, -59, -66, -68, and -73. The test utilizes a three-step process com-posed of competitive PCR, primer extension, and matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) separation of products on a matrix-loaded silicon chip array. MassARRAY is a fully automated high-throughput method which can process up to 2,000 samples in about 11 h. In addition, this test incorporates an internal oligomer standard for quality assurance which also allows for viral load quantitation (24). The latter option has not been previously avail-able in commercial kits and may have useful clinical application. While these features are appealing, the efficacy and clinical utili-zation of MassARRAY have not been fully assessed.
PreTect HPV-Proofer (Proofer; Norchip) is a unique type-specific test in that it is the only test of its kind which detects E6/E7 mRNA from the five most common oncogenic types, HPV-16, -18, -31, -33, and -45, individually. Several studies have shown this test to be significantly more specific than other
* Corresponding author. Mailing address: Public Health Laboratory, 100 Forest Road, St. John’s, NL A1A 3Z9, Canada. Phone: (709) 777-7230. Fax: (709) 777-7070. E-mail: [email protected].
䌤Published ahead of print on 3 August 2011.
3537
on May 16, 2020 by guest
http://jcm.asm.org/
HPV tests for detecting high-grade cervical intraepithelial neo-plasia or worse (CIN 2⫹) (15, 16, 22, 25). This assay is also highly specific for identifying the five types targeted by the test (16, 22). The performance of this test for the detection of HPV in cervical cancer was recently determined, in comparison with the consensus MY09/MY11 PCR followed by nucleotide se-quencing of PCR products (consensus PCR), in a study we carried out to ascertain the prevalent genotypes in cervical cancer in the Indian subcontinent (1).
The aim of the present study was to compare the perfor-mance of MassARRAY with that of Proofer and consensus PCR for type-specific identification of HPV in cervical cancer. This study utilized cervical specimens that had been character-ized by the Proofer and the consensus PCR methods in our previous study (1).
MATERIALS AND METHODS
Study population and sample collection.This study utilized archived cervical specimens obtained from a total of 193 histologically proven cervical cancer cases. These were enrolled from four tertiary care cancer centers in India for a study which ascertained the prevalent genotypes in cervical cancer in the Indian subcontinent by using consensus PCR and the Proofer assay (1). The histology slides were reviewed to confirm the diagnosis. Each patient signed a written informed consent. The study was approved by the institutional ethics review boards of all participating centers.
Cervical scraping was obtained with a Cervex brush (Rovers Medical Devices, Netherlands) in a PreservCyt vial (ThinPrep, Hologic) containing a methanol-based fixative solution. All samples from the study sites were couriered in ice packs to Reliance Life Sciences Pvt. Ltd., Mumbai, India, where the initial tests were carried out. Three aliquots were made from each sample and stored at
⫺80°C until testing. The consensus PCR was performed within a month of obtaining the samples by using one of the aliquots. The Proofer assay was carried out after all samples were accumulated and within 12 months of the collection of the first sample by using the second aliquot. MassARRAY was performed nearly 2 years later using the third aliquot at the School of Life Sciences, Jawaharlal Nehru University, New Delhi, India. MassARRAY testing was carried out under code and blinded to the results of both the consensus PCR and Proofer assays. The test procedures of the three methods are described below.
MassARRAY.For MassARRAY (Sequenom Inc., San Diego, CA), PCR and mass spectrometer primer pairs were used for 15 high-risk HPV genotypes (HPV-16, -18, -31, -33, -35, -39, -45, -51, -52, -56, -58, -59, -66, -68, and -73). Following DNA extraction and PCR amplification, iPLEX single-base extension was performed per the manufacturer’s instructions. The iPLEX assay is based on multiplex PCR followed by a single-base primer extension reaction. After the PCR, remaining nucleotides were deactivated by shrimp alkaline phosphatase (SAP) treatment, the single-base primer extension step was performed, and the primer extension products were analyzed using MALDI-TOF MS. Individual competitors for 15 HPV types were designed and mixed with extension primers of each HPV type targeted. As each HPV type had its own respective competitor into one multiplexed reaction, analysis confirmed that there were only the peaks of competitors for each type that was not present in the sample and thus excluded any possibility of contamination across the group of types targeted in the mul-tiplexed reactions performed. The scheme of a single iPLEX assay is shown in Fig. 1 and information about the regions and the sequences selected in the design is shown in Table 1.
The HPV genotyping reagents obtained from the manufacturer were prestan-dardized to determine HPV DNA levels by real-competitive PCR (rc-PCR) technique as previously described (20). Briefly, rc-PCR involved incorporation of an oligomer within the PCRs at a final concentration of 250 attomolar, corre-lating to 500 copies per final reaction. This oligonucleotide was identical in sequence to the sample-amplified 53- to 97-bp product, except for the substitu-tion of one centrally located C or G nucleotide with its complementary base. The competitor provides semiquantitation of the target HPV DNA load into 3 cat-egories: HPV DNA greater than 1,250 aM or 2,500 copies per final reaction (target DNA product observed and no competitor product observed), HPV DNA between 50 aM and 1,250 aM or 100 to 2,500 copies (both target DNA and competitor products observed with varied frequencies relative to input copy number), and HPV DNA less than 50 aM or 100 copies (no target and only competitor product observed). Inclusion of the competitor also provides an
internal quality control to ensure reaction efficiency in the absence of target HPV DNA as well as suppressing low-level environmental contamination, if present. The assay design was achieved using Sequenom assay design software as de-scribed previously (19). The primer extension products were analyzed using MALDI-TOF MS and the genotypes differentiated on the basis of the mass of each allele. Figure 2 shows an example of the assay positive for HPV type 18. A 384-well format was utilized with four 96-well plates to test in quadruplicate up to 93 patient samples per plate. Each plate consisted of three controls, compris-ing a positive HeLa cell line control, a negative control, and a blank. All reactions were performed in the same plate from start to finish.
[image:2.585.299.539.62.570.2]Proofer assay.Proofer is a real-time multiplex nucleic acid sequence-based amplification assay (NASBA) for isothermal detection, amplification, and detec-tion of E6/E7 mRNA from oncogenic HPV types 16, 18, 31, 33, and 45, by using FIG. 1. Scheme of a single iPLEX assay. SNP, single-nucleotide polymorphism.
3538 BASU ET AL. J. CLIN. MICROBIOL.
on May 16, 2020 by guest
http://jcm.asm.org/
multiplex reaction
HPV type Forward primera
/competitora,c
Reverse primera
Extension primera No. of basesb;
or Dad
16 ACGTTGGATGAACAGTTACTGCGACGTGAG/ ACGTTGGATGAGCATATG GATTCCCATCTC
TTGCTTTTCGGGATTTATG 73; 5,831 AGCATATGGATTCCCATCTCTATATACTA
TCCATAAATCCCGAAAAGCAAAGTCATA TACCTCACGTCGCAGTAACTGTT
18 ACGTTGGATGATAGCTGGGCACTATAGAGG/ ACGTTGGATGTGTGTTTC TCTGCGTCGTTG
GCCATTCGTGCTGCAAC 83; 5,146
TGTGTTTCTCTGCGTCGTTGGAGTCGTTC CTGTCGTGCTCCGTTGCAGCACGAATG GCACTGGCCTCTATAGTGCCCAGCTAT
31 ACGTTGGATGTGGTGAACCGAAAACGGTTG/ ACGTTGGATGCAGGATTT TTGAACATGGCG
ATGGCGTCTGTAGGTTT 78; 5,247
CAGGATTTTTGAACATGGCGTCTGTAGG TTTCCACAAAATACTATGTGCTTTATA TACCAACCGTTTTCGGTTCACCA
33 ACGTTGGATGCGATTTCATAATATTTCGGG/ ACGTTGGATGCACAGTGC AGTTTCTCTACG
ACACGCCGCACAGCGCCCT 81; 5,704 TCACAGTGCAGTTTCTCTACGTCGGGAC
CTCCAACACGCCGCACAGCGCCCTCCCC AACGACCCGAAATATTATGAAATCG
35 ACGTTGGATGCGCTGTGTCCAGTTGAAAAG/ ACGTTGGATGTTCCAACA GGACATACACCG
ACCTGTCCACCGTCCAC 97; 5,051
TTCCAACAGGACATACACCGACCTGTCC ACCGTCCACGGATGTTATGGAATCGTTT TTTTTCTTCTAAATGTCTTTGCTTTTCA ACTGGACACAGCG
39 ACGTTGGATGGCCATACAAATTGCCAGACC/ ACGTTGGATGTCGTCTGC AATAGACACAGG
TTGCCAGACCTGTGCACAAC 82; 6,062 TCGTCTGCAATAGACACAGGCTATTGTA
ATGTCCTGCAAGGTGGTGTCCAGGGTTG TGCACAGGTCTGGCAATTTGTATGGC
45 ACGTTGGATGAAGTGCATTACAGGATGGCG/ ACGTTGGATGCTGTGCAC AAATCTGGTAGC
AAATCTGGTAGCTTGTAGGGTCGTT 72; 7,743 CTGTGCACAAATCTGGTAGCTTGTAGGG
TCGTTCCTTTGGATCGTCAAAGCGCGCC ATCCTGTAATGCACTT
51 ACGTTGGATGGGTTATGACCGAAAACGGTG/ ACGTTGGATGGTCTTTCC CTCTTGTCTTCG
CGGTGCATATAAAAGTGCAGTG 83; 6,824 GTCTTTCCCTCTTGTCTTCGAACATGGTG
TTCTTCTATACTTTTAGCACTGCACTTTT ATATGCACCGTTTTCGGTCATAACC
52 ACGTTGGATGATTGTGTGAGGTGCTGGAAG/ ACGTTGGATGACCTCTCT TCGTTGTAGCTC
GTGCTGGAAGAATCGGTG 84; 5,620
ACCTCTCTTCGTTGTAGCTCTTTTTTGCAC TGCACACACTGCAGCCTTATTTCATCCAC CGATTCTTCCAGCACCTCACACAAT
56 ACGTTGGATGGTTAACTCCGGAGGAAAAGC/ ACGTTGGATGCAAACATG ACCCGGTCCAAC
CAACCATGTGCTATTAGATGAAAT 85; 7,360 CAAACATGACCCGGTCCAACCATGTGCT
ATTAGATGAAATGGTCTTTTTCTGTCACA ATGCAATTGCTTTTCCTCCGGAGTTAAC
58 ACGTTGGATGTGATTTGTGTCAGGCGTTGG/ ACGTTGGATGTACCTCAG ATCGCTGCAAAG
GTGTCAGGCGTTGGAGACAT 88; 6,213 TACCTCAGATCGCTGCAAAGTCTTTTTGC
ATTCAACGCATTTCAATTCGATTTCATG CACACATGTCTCCAACGCCTGACACAA ATCA
59 ACGTTGGATGCTGCCTGATTTGAGCACAAC/ ACGTTGGATGGCAGTTCC CCTTTGCAAAAC
TTGCAAAACACACAATTGATG 79; 6,422 GCAGTTCCCCTTTGCAAAACACACAATT
GATGGGAATATCATGCAGAGGAATATT CAATGTTGTGCTCAAATCAGGCAG
66 ACGTTGGATGCGGAGGAAAAACAATTGCAC/ ACGTTGGATGCCGGTCCA TGCATATGCTAT
AGGAAAAACAATTGCACTGTGAA 87; 7,113.7 CCGGTCCATGCATATGCTATATAATGAAA
TCGTCTTTTATATTCACAGTGCAATTGTTT TTCCTCCG
68 ACGTTGGATGTGCAGAAGGCAACTACAACG/ ACGTTGGATGACCCCGTC CCTATATACTAC
CCCTATATACTACATTTAAGTCA 77; 6,942 ACCCCGTCCCTATATACTACATTTAAGTC
AGCAAAGGCAAATTCATATACCTCTGTC CGTTGTAGTTGCCTTCTGCA
73 ACGTTGGATGTGTACAGCGTCCGGTCCAC/ ACGTTGGATGTCCACTGG AAAAGCAAAAGC
GTCCGGTCCACTGTTCT 99; 5,128.3
TGTACAGCGTCCGGTCCACTGTTCTCC TATTTGATGAAACCGTTTTTTTTCATC TACATGCTTTTGCTTTTCCAGTGGA
aAll primers are listed 5⬘- 3⬘. The sequence of the competitor primer for each HPV type is shown in a separate row immediately below the corresponding set of
forward, reverse, and extension primers.
bLength of HPV type-specific PCR products amplified with forward and reverse primers.
cBold and underlined C, G, or A indicates the base of the competitor sequence that is the complement to the wild-type HPV type-specific sequence. dMass in Da of extension primers.
3539
on May 16, 2020 by guest
http://jcm.asm.org/
[image:3.585.47.538.72.676.2]molecular beacon probes. Five milliliters of cervical specimen in PreservCyt was processed for the extraction of HPV RNA by using RNeasy columns (Qiagen) following the manufacturer’s instructions, and type-specific E6/E7 mRNA was detected as previously described (16). FLx800I fluorescence reader (Bio-Tek) was used for real-time detection of the accumulated mRNA product. PreTect analysis software (Norchip) was used to analyze the fluorescence profiles. To verify the integrity of RNA in the sample, the test includes a primer set and probe directed against the human U1 small nuclear ribonucleoprotein (snRNP)-specific mRNA. Standardized artificial oligonucleotides corresponding to the respective viral sequences were included as positive controls for each HPV type. Water was used as the negative control.
Consensus PCR.DNA amplification of the HPV L1 region was performed with the consensus MY09 and MY11 PCR primers. The process involved 30 cycles of denaturation, amplification, and extension to yield a final product of 451 bp that was visualized by agarose gel electrophoresis. Molecular weight markers were used to size the specific fragment. Positive and negative controls were included, and the specimen adequacy was assessed by verifying the presence of human genomic DNA by PCR amplification of the human-globin gene. All HPV DNA-negative samples were rechecked for conclusive results. For HPV DNA genotyping, the PCR products were subjected to nucleotide sequencing. The PCR products were purified using the Millipore Montage SEQ96sequencing reaction cleanup kit. Nucleotide sequencing was performed by Sanger’s dideoxy nucleotide sequencing method with the help of a BigDye Terminator sequencing kit (Applied Biosystems) using 5 pmol of MY09/MY11 as the sequencing prim-ers. The sequence obtained was analyzedin silico on an ABI 3100 genetic analyzer (Applied Biosystems). For the determination of HPV type, the results were compared with documented virus sequences available in the GenBank database by using the National Center for Biotechnology Information (NCBI) BLAST (http://www.ncbi.nlm.nih.gov/BLAST/).
Statistical analysis.The descriptive statistics for the continuous variables were given as means with standard deviations while those for categorical data were given as frequency distributions. Fisher’s exact test was used to evaluate the significance of difference between proportions. Significance was defined atP⬍
0.05 andPwas two-tailed. The concordance between the test methods for the detection of HPV types was calculated by means of kappa statistics.
RESULTS
The mean age of the 193 patients enrolled in the study was 51.5 (⫾11.0) years. Information on the FIGO (Federation of International Gynecology and Obstetrics) clinical stage of cer-vical cancer was available for 186 patients. The stage distribu-tion was as follows: stage I, 20 patients (10.8%); stage II, 55 patients (29.6%); stage III, 108 patients (58.0%); and stage IV, 3 patients (1.6%). Of the 193 patients, 186 (96.4%) had inva-sive squamous cell carcinoma on histology. Adenocarcinoma was detected in 5 (2.6%) and undifferentiated carcinoma was diagnosed in the remaining 2 (1.0%) patients.
HPV typing by MassARRAY was invalid in one sample in quadruplicate runs. The mass peak was seen only for the un-extended PCR primer, thus confirming that the PCR had failed during the amplification step. This failure was attributed to the starting DNA material being of inferior quality, due to which a proper extension of the desired regions post-PCR was not achieved. This sample was excluded from further analysis, with the remaining 192 samples representing unique patients serv-ing as the study samples.
HPV was detected by one or the other method in 186 cases (96.9%), and 6 cases (3.1%) tested negative by all three meth-ods. MassARRAY showed the highest detection rate at 94.8% (182/192; 95% confidence interval [CI], 91.7, 97.9), followed by consensus PCR at 86.5% (166/192; 95% CI, 81.7, 91.3) and Proofer at 83.3% (160/192; 95% CI, 78.1, 88.5). The detection rate of MassARRAY was significantly different from that of either consensus PCR (P⫽ 0.005) or Proofer (P ⫽0.0004).
FIG. 2. Spectra of Single 15 Plex reaction confirming presence of HPV 18 type. The illustration shows wild-type (WT) calls for HPV 18 and -globin standard type and no WT calls for other HPV types, which have only competitor peaks. Footnotes:a, UEP, unextended primer peak for individual HPV type. Low intensity confirms extension specific for type present, and high intensity confirms that no HPV type-specific material is present in the reaction.b, Comp., competitor oligomer peak. High intensity confirms that no specific HPV type is present.c, WT call confirms the presence of specific HPV type in the sample.
3540 BASU ET AL. J. CLIN. MICROBIOL.
on May 16, 2020 by guest
http://jcm.asm.org/
Since the Proofer assay targets only five types, i.e., HPV-16, -18, -31, -33, and -45, the detection rates were separately de-termined based on samples containing at least one of these types. This yielded 175 specimens which tested positive for any one of the five types by any of the methods. Based on this, the detection rate of MassARRAY to identify any of the five types was 96.6% (169/175) compared with Proofer at 91.4% (160/ 175) and consensus PCR at 86.9% (152/175). There were 32 (16.7%) samples containing multiple genotypes as determined by any of the methods. MassARRAY detected 27 of these (84.4%) with Proofer detecting 7 (21.9%); consensus PCR failed to detect any multiple infections (Table 2). Throughout the MassARRAY testing, there were no calls either in the negative or blank controls which contained all reagents but the DNA template, with consistent calls on the positive control, and this ensured the validity of the results.
To calculate the agreement in genotyping results, the test results were considered to be concordant if at least one HPV type was common among the types identified by the tests in the same sample. Based on this, overall concordant results were obtained for 149 (77.6%) of the 192 samples. The observed agreement between MassARRAY and Proofer was 86.0%
(165/192) (kappa ⫽ 0.76; 95% CI, 0.67, 0.84), and that of MassARRAY and consensus PCR was 84.4% (162/192) (kappa⫽0.73; 95% CI, 0.64, 0.82). The lowest agreement was observed between Proofer and consensus PCR (157/192; 81.8%) (kappa⫽ 0.69; 95% CI, 0.60, 0.78). The three tech-niques compared in this study were fully concordant in 65.1% (125/192), in that all genotypes present in test samples were identified by all three methods or in instances of HPV-negative results, all methods were negative for HPV. A total of 43 samples were considered discordant, as the results were not the same, with at least one HPV type being common across the three methods (Table 3). Of these, the HPV type de-tected by MassARRAY was also dede-tected by one of the other two methods in 26 samples. MassARRAY also de-tected oncogenic HPV types in 9 samples that were HPV negative on both Proofer and PCR tests. Consensus PCR detected nononcogenic HPV types 53 and 69 in two samples that were negative on MassARRAY.
The high-risk oncogenic types detected in the 186 HPV-positive cases by at least one of the methods were limited to types 16, 18, 31, 33, 39, 45, 52, 56, 58, 59, and 68. Based on MassARRAY, type 16 alone was detected in 57.5% of cer-vical cancers, and in association with other oncogenic types in an additional 13.3%. Type 18 alone was detected in 10.4%, and in association with type 16 in 7.3% and with type 35 in 0.5%. The prevalence of HPV genotypes as deter-mined by the MassARRAY method is shown in Fig. 3.
DISCUSSION
The currently available HPV tests, including the widely used Hybrid Capture 2 assay (HC2; Qiagen), typically detect 13 or 14 high-risk oncogenic types collectively and do not provide information of individual HPV genotypes (9, 11, 12). While the sensitivity and negative predictive value of HPV tests for the detection of CIN 2⫹are higher than those of cervical cytology, the specificity is lower due to the high prevalence of transient infection with a variety of HPV types (8, 9). The lower speci-ficity could also be attributable to cross-reactivity of an HPV test with nononcogenic types (4, 22). Type-specific detection of oncogenic HPV will improve the specificity and positive pre-dictive value of HPV tests. High-throughput HPV genotyping will also be useful for monitoring the effectiveness of HPV vaccination programs by documenting decreasing prevalence of the vaccine-targeted HPV types or by identifying possible type replacement or cross-protection after vaccination (10).
[image:5.585.46.281.93.459.2]A number of different methods have been developed for HPV genotyping with some inherent differences in their per-formance (13). Target PCR amplification of a conserved re-gion of the HPV L1 gene with the consensus MY09/MY11 and GP5⫹/GP6⫹ primers, or their equivalent, and subsequent genotyping with direct DNA sequencing or type-specific PCR are generally accepted scientific tools in research. However, they are too labor-intensive for routine high-throughput appli-cations. Further, L1 gene-specific consensus PCR may fail to detect HPV in high-grade cervical lesions and cancers due to the loss of the L1 gene during the process of integration. In our study, consensus PCR failed to detect any HPV type in 26 cervical cancer samples. The presence of oncogenic HPV was confirmed by MassARRAY or Proofer in 19 of these samples,
TABLE 2. Comparison of multiple HPV genotypes obtained with MassARRAY, PreTect HPV-Proofer, and consensus PCR
Specimen serial no.
HPV genotype(s) or other result detected by:
MassARRAY PreTect
HPV-Proofer Consensus PCR
1 16, 58 33 Negative
2 16, 39 16 16
3 16, 18 18 18
4 16, 18 18 18
5 16, 56 16 16
6 16, 18 18 16
7 16, 18 16 16
8 16 16, 31 16
9 16, 35 Negative 16
10 16, 18 18 18
11 16, 31 16 Negative
12 16, 18 18 18
13 16, 33 16 16
14 16, 18 18 18
15 16, 52 Negative 52
16 16, 35 Negative 16
17 16, 18 16 16
18 16, 18 16 16
19 16, 73 Negative 73
20 16 16, 31 16
21 16, 33 16 16
22 16 16, 18 16
23 16, 18 18 18
24 16, 68 16 16
25 16, 52 Negative 52
26 16, 18 16, 18, 45 18
27 16, 18 18 18
28 16, 18 18 18
29 16 16, 18 16
30 16, 18 16 Positive; sequence
uninformative
31 16 16, 18 16
32 18, 35 16, 18 18
on May 16, 2020 by guest
http://jcm.asm.org/
indicating an overall false-negative rate of 9.9% (19/192) for consensus PCR. Several researchers have reported the ineffi-ciency of consensus PCR followed by sequencing to identify multiple infections in samples where viral sequences overlap and the difficulty of distinguishing the various types (5, 23, 26). There were 32 samples with multiple infections de-tected by either MassARRAY or Proofer assays, and con-sensus PCR failed to detect them in any of these samples. These data highlight the limitations of consensus PCR for HPV genotyping.
HPV E6/E7 oncoproteins are overexpressed in infected
cer-vical epithelium during oncogenic process and cercer-vical malig-nancy, and hence the detection of E6/E7 mRNA transcripts of high-risk HPV types may serve as a better risk identifier for disease progression than mere detection of DNA. We observed that the sensitivity of Proofer to detect HPV in invasive cervi-cal cancer was better than that of consensus PCR in spite of the fact that the assay targets only 5 of the 13 or so of high-risk oncogenic HPV types. This is attributable to the preponder-ance of the five genotypes, especially types 16 and 18, in the cervical cancers we studied.
Mass spectrometry has been previously indicated to have high sensitivity and accuracy for detecting oncogenic HPV types. In an initial validation study, this method was found to have a better clinical sensitivity to detect CIN 2⫹compared to reverse dot blot hybridization, with an overall concordance of 0.945 for detecting HPV genotypes (24). In another study, a prototype PCR- and mass spectrometry-based method to de-tect and quantitate 13 high-risk HPV types showed a sensitivity of 98.7% in cervical cancer tissue samples (20). A recent study which evaluated the performance of MALDI-TOF MS and surface plasmon resonance (SPR) methods reported HPV genotyping accuracy of 100% for MALDI-TOF MS and 94.8% for SPR and concluded that MALDI-TOF MS is a sensitive, specific, and feasible method for HPV detection (21). There are also indications that MassARRAY spectrometry can be successfully used to screen for oncogenic HPV types in speci-mens containing very low quantities of the virus, such as plasma or urine (27). Besides being a fully automated high-throughput method, this test incorporates an internal oligomer standard which allows for test validation and quality assurance. Further, MassARRAY can be used for viral load quantitation, but in the present study we did not assess this feature.
In our study, MassARRAY showed the highest HPV detec-tion rate at 94.8%. Meticulous efforts were made to avoid contamination; all samples were tested in quadruplicate to rule out any preanalytical contamination or experimental artifacts, and negative controls were satisfactory in all runs, thus ruling out false-positive reactions. PCR failures due to allelic drop-outs were excluded, as the DNA isolations were quantified and found to have a sufficient concentration of template DNA per the manufacturer’s instructions. Competitors were designed and mixed with extension primers of each HPV type, and this excluded any possibility of contamination across the group of the 15 types in the multiplexed reactions performed. However, some positive results in MassARRAY, especially for type 16, were not confirmed by either of the other tests, and we did not have recourse to any other method to verify these results in-dependently. While we attribute this to the higher sensitivity of MassARRAY, it is possible that these represent false-positive results. Although adequate safeguards and controls were used to minimize the chance of contamination as a source of false positives, we acknowledge that this risk can not be completely eliminated.
[image:6.585.45.281.103.565.2]The MassARRAY assay had a high concordance with Proofer in the type-specific identification of HPV. The slightly reduced sensitivity of Proofer could be explained by low tran-scriptional activity, the occurrence of mutations in the regions covered by the Proofer primers or probes, or the difference in targets between the two assays. It is also likely to depend on the Proofer test’s cutoff for detection as previously reported (22).
TABLE 3. Comparison of discordant HPV genotype results obtained with MassARRAY, PreTect HPV-Proofer, and
consensus PCR
Specimen serial no.
Discordant HPV genotype(s) or other result obtained with:
MassARRAY PreTect
HPV-Proofer Consensus PCR
1 16 16 18
2 18 18 Negative
3 16, 58a 33 Negative
4 16 16 Negative
5 58a Negative Negative
6 Negative 16 16
7 58a 33 58a
8 59a Negative Negative
9 16 16 Negative
10 39a Negative Negative
11 16 16 Negative
12 16 Negative Negative
13 56a Negative 56a
14 16 16 18
15 59a Negative Negative
16 Negative Negative 16
17 59a Negative 16
18 16 16 Negative
19 16 Negative Negative
20 16, 35a Negative 16
21 16 Negative 16
22 16 Negative Negative
23 16, 31 16 Negative
24 16, 52a Negative 52a
25 16, 35a Negative 16
26 33 33 62a
27 58a 33 58a
28 Negative Negative 69a
29 56a Negative 56a
30 16 Negative 16
31 59a Negative 16
32 16, 73a Negative 73a
33 16 Negative Negative
34 56a Negative 56a
35 52a Negative 52a
36 16 16 Negative
37 18 18 Negative
38 16, 52a Negative 52a
39 16 16 52a
40 52a Negative 52a
41 Negative Negative 53a
42 16 16 Negative
43 45 Negative Negative
a
HPV genotype not targeted by PreTect HPV-Proofer.
3542 BASU ET AL. J. CLIN. MICROBIOL.
on May 16, 2020 by guest
http://jcm.asm.org/
MassARRAY also identified the highest number of multiple infections that may have practical implications. While multiple oncogenic HPV infection does not necessarily constitute a higher risk for the development of cervical neoplasias com-pared with single oncogenic HPV infection (7), a recent study has indicated that treatment failure in cervical cancer was nearly 5-fold higher in multiple HPV infections (17). Our study data based on MassARRAY indicated that types 16 and 18 alone or in association with other oncogenic types accounted for 81.7% of cervical cancers assessed in the Indian subconti-nent (Fig. 3), and this has implications for HPV vaccination programs using vaccines that target HPV types 16 and 18.
In conclusion, the MassARRAY assay is a highly sensitive and accurate method for the type-specific detection of 15 high-risk oncogenic HPV in cervical cancer. Its potential capacity to detect HPV even in small quantities and to handle large num-ber of test samples needs to be further explored in the context of cervical cancer screening and posttreatment assessment.
ACKNOWLEDGMENTS
The study was supported by a research grant through the Public Health Laboratory, St. John’s, Newfoundland and Labrador, Canada, and Cancer Foundation of India, India.
We thank the following for their contributions to the study: Sutapa Biswas, Cancer Foundation of India, Kolkata, India; Uttam Das Bafna, Kidwai Memorial Institute of Cancer, Bangalore, India; Sarita Kothari, RST Regional Cancer Center, Nagpur, India; Rupinder Sek-hon, Rajiv Gandhi Institute of Cancer, New Delhi, India; and Darryl Irwin, Sequenom Inc., Herston, Australia. We also thank Laura Gil-bert, Public Health Laboratory, St. John’s, Canada, for assistance with the preparation of the manuscript.
REFERENCES
1.Basu, P., et al.2009. Human papillomavirus genotype distribution in cervical cancer in India: results from a multi-center study. Asian Pac. J. Cancer Prev.
10:27–34.
2.Bosch, F. X., et al.2008. Epidemiology and natural history of human papil-lomavirus infections and type-specific implications in cervical neoplasia. Vac-cine26S:K1–K16.
3.Bouvard, V., et al.2009. Special report: policy. A review of human carcino-gens – Part B: biological agents. Lancet10:321–322.
4.Castle, P. E., et al.2008. Human papillomavirus genotype specificity of Hybrid Capture 2. J. Clin. Microbiol.46:2595–2604.
5.Choi, Y. D., W. W. Jung, J. H. Nam, H. S. Choi, and C. S. Park.2005. Detection of HPV genotypes in cervical lesions by the HPV DNA chip and sequencing. Gynecol. Oncol.98:369–375.
6.Cogliano, V., et al.2005. Carcinogenicity of human papillomaviruses. Lancet Oncol.6:204.
7.Cuschieri, K. S., et al.2005. Persistent high risk HPV infection associated with development of cervical neoplasia in a prospective population study. J. Clin. Pathol.58:946–950.
8.Cuzick, J., et al.2008. Overview of human papillomavirus-based and other novel options for cervical cancer screening in developed and developing countries. Vaccine26S:K29–K41.
9.Cuzick, J., et al.2006. Overview of the European and North American studies on HPV testing in primary cervical cancer screening. Int. J. Cancer
119:1095–1101.
10.Dillner, J., M. Arbyn, and L. Dillner.2007. Translational mini review series on vaccines: monitoring of human papillomavirus vaccination. Clin. Exp. Immunol.148:199–207.
11.Dockter, J., et al.2009. Clinical performance of the APTIMA® HPV Assay for the detection of high-risk HPV and high-grade cervical lesions. J. Clin. Virol.45:S55–S61.
12.Ginocchio, C. C., D. Barth, and F. Zhang.2008. Comparison of the third wave invader human papillomavirus (HPV) assay and the Digene HPV Hybrid Capture 2 assay for detection of high-risk HPV DNA. J. Clin. Mi-crobiol.46:1641–1646.
13.Gravitt, P. E., et al.2008. New technologies in cervical cancer screening. Vaccine26:K42–K52.
14.Khan, M. J., et al.2005. The elevated 10-year risk of cervical precancer and cancer in women with human papillomavirus (HPV) type 16 or 18 and the possible utility of type-specific HPV testing in clinical practice. J. Natl. Cancer Inst.97:1072–1079.
15.Lie, A. K., et al.2005. DNA-versus RNA-based methods for human papil-lomavirus detection in cervical neoplasia. Gynecol. Oncol.97:908–915. 16.Molden, T., I. Kraus, H. Skomedal, T. Nordstrøm, and F. Karlsen.2007.
[image:7.585.86.505.76.310.2]PreTect™ HPV-Proofer: real-time detection and typing of E6/E7 mRNA from carcinogenic human papillomaviruses. J. Virol. Methods142:204–212. 17.Munagala, R., et al.2009. Significance of multiple HPV infection in cervical cancer patients and its impact on treatment response. Int. J. Oncol.34:263– 271.
FIG. 3. Cumulative percentages of 192 invasive cervical cancer cases attributed to the HPV types as detected by MassARRAY. The top bar indicates the attributable percentage of type 16. Subsequent to that, black bars indicate the attributable percentages of the HPV type(s) shown on theyaxis.
on May 16, 2020 by guest
http://jcm.asm.org/
18.Mun˜oz, N., et al.2003. Epidemiologic classification of human papillomavirus types associated with cervical cancer. N. Engl. J. Med.348:518–527. 19.Nygren, A. O., et al.2010. Quantification of fetal DNA by use of
methylation-based DNA discrimination. Clin. Chem.56:1627–1635.
20.Patel, D. A., et al.2009. Development and evaluation of a PCR and mass spectroscopy-based (PCR-MS) method for quantitative, type-specific detec-tion of human papillomavirus. J. Virol. Methods160:78–84.
21.Qu, S., et al.15 Jan 2011, posting date. A comparison of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and surface plasmon resonance for genotyping of high-risk human papillomaviruses. Intervirol-ogy. doi:10.1159/000322722.
22.Ratnam, S., et al.2010. Clinical performance of the PreTect HPV-Proofer E6/E7 mRNA assay in comparison with that of Hybrid Capture 2 test for identification of women at risk of cervical cancer. J. Clin. Microbiol.48:2779– 2785.
23.Serrano, M. L., M. Correa, O. Medina, D. Melgarejo, and M. M. Bravo.
2003. Tipificacio´n de vírus del papiloma humano mediante secuencia directa em mujeres com citologia normal. Rev. Colomb. Cancer7:18–24. 24.Soderlund-Strand, A., J. Dillner, and J. Carlson.2008. High-throughput
genotyping of oncogenic human papillomaviruses with MALDI-TOF mass spectrometry. Clin. Chem.54:86–92.
25.Szarewski, A., et al.2008. Comparison of predictors for high-grade cervical intraepithelial neoplasia in women with abnormal smears. Cancer Epide-miol. Biomarkers Prev.17:3033–3042.
26.Vernon, S. D., E. R. Unger, and D. Williams.2000. Comparison of human papillomavirus detection and typing by cycle sequencing, line blotting, and hybrid capture. J. Clin. Microbiol.38:651–655.
27.Yang, H., et al.2005. Sensitive detection of human papillomavirus in cervical, head/neck, and schistosomiasis-associated bladder malignancies. Proc. Natl. Acad. Sci. U. S. A.102:7683–7688.
3544 BASU ET AL. J. CLIN. MICROBIOL.