• No results found

Engineering School of Sustainable Infrastructure and Environment (ESSIE) Environmental Engineering Sciences at University of Florida

N/A
N/A
Protected

Academic year: 2021

Share "Engineering School of Sustainable Infrastructure and Environment (ESSIE) Environmental Engineering Sciences at University of Florida"

Copied!
7
0
0

Loading.... (view fulltext now)

Full text

(1)

Engineering School of Sustainable Infrastructure and Environment (ESSIE) Environmental Engineering Sciences at University of Florida

ENV 4411/6932D

Stormwater Control Systems

(Unit Operations and Processes for Rainfall-Runoff Control and Reuse)

Time and Location: Tuesday and Thursday, 4th and 5th period, CSE E107

ENV4411 (Section 11A9: undergraduate section on-campus) ENV6932 (Section 6012: graduate section on-campus)

ENV6932 (Section 11E9: graduate section on EDGE) ENV6932 (Section 8026: graduate section on EDGE)

Faculty: Professor John J. Sansalone, P.E.

Office; 110 Black Hall Telephone: 352.846.0176

E-mail: [email protected]

Co-Instructors: Dr. G. Ying

114 Black Hall

[email protected]

Office Hours: I am available Tuesday and Thursday (1:00 to 2:30 pm) or by appointment.

Many times we are in lab, down the hall from our offices or working with students or at the field facility (across the walkway immediately on the west side of Chemical Engineering). During the semester, we work at a field site (Engineering surface parking facility) where we chase storms on campus. It is generally easier to catch me by email than by phone, but if you need to catch me by phone let me know. Dr. Ying’s hours TBA.

Basic Course Objectives: This course will develop the chemical, physical, biological and hydrologic aspects of rainfall-runoff; and control through unit operations and processes (UOP);

commonly called BMPs. This course introduces knowledge of interactions between hydrologic processes; water chemistry, sediment transport, infrastructure materials and UOPs for treatment/reuse. A primary objective of the course is to provide an understanding of constituent physical properties, chemistry and loads; as such understanding can be used to design UOPs for control, treatment and/or reuse. UOP concepts will be evaluated for a spectrum of control conditions ranging from regional, in-situ, source control to low impact development (LID) and infrastructure material modification concepts. Ecological and economic issues for rainfall-runoff control will be presented. Rainfall-runoff, as unique water compared to wastewater or drinking water, will be examined. This course has a design facet and a major component of the course is a student design treatment/reuse project.

(2)

Student Outcome Objectives:

1. The student will develop an understanding of basic hydrologic processes since quantity drives quality, including basic hydrograph concepts and empirical techniques, the rainfall-runoff process and the use of a design storm concept from differing water chemistry and water quantity perspectives. The student will develop an understanding of hydrologic measurements, the quantitative design components of storm sewers and combined storm sewers. The student will be exposed to controls for storm water peak flow, volume and timing attenuation.

2. The student will develop an understanding of physical and chemical aspects of rainfall-runoff including disturbed area runoff. Such understanding will include sources of constituents, temporal distribution, mass loading, dissolved vs. particulate-bound phases and speciation and the importance of Eh-pH diagrams. The student will evaluate the concept of a “water quality volume” in terms of concentration, toxicity and mass.

3. The student will develop an understanding of basic unit operation and process that may be feasible for centralized and in-situ rainfall-runoff treatment. This objective includes introduction (or review) of sedimentation, coagulation/flocculation, adsorption/precipitation, filtration, disinfection, combined processes, and how these UOPs are combined in treatment trains. Issues of operation and maintenance have important implications for treatment and control; therefore such topics will be discussed in the context of physical, biological, chemical and hydrologic phenomena.

4. The student will develop an understanding of issues related to centralized rainfall-runoff treatment/control in contrast to in-situ treatment, LID, or source control, for treatment and reuse.

Actual project experience will be brought into the classroom.

Assessment Methods/Student Outcomes:

1. Homework will be assigned as design/analysis modules that become part of the final design submission. This homework will assist students to develop the skill and confidence to solve technical and conceptual problems involving course topics, objectives and design. Homework will be graded for all sections.

2. A test or tests can be used to determine the level of understanding of the basic definitions, concepts and quantitative methodology and calculations presented in the text, handouts and lectures.

3. Interaction between students and instructor during class will assess the ability of the student to synthesize related concepts from course topics and be of benefit to our EDGE students. To motivate students to develop design concepts and creative problem solving dealing with real and complex rainfall-runoff issues that combine aspects of chemistry, saturated/unsaturated soil mechanics, infrastructure, transportation, water resources and environmental science/engineering as well as societal and economic impacts.

4. A student design project will give the student the opportunity to synthesize design concepts and quantitative analysis and to promote and defend design projects on paper.

(3)

Textbook and Notes:

No one book covers this topic adequately; the physical, chemical and UOP topics are still young and knowledge is changing too rapidly; although hydrologic understanding is a good foundation.

We will provide selected documents and papers electronically. We will place files on the Sakai (E-Learning) website and try to organize these as pdf documents to maximize portability and minimize file size. We will review and utilize many journal and reference papers for this course.

We will put these in the course EDGE (Sakai) site; https://elearning2.courses.ufl.edu/portal.

If you have a technical question it is best to see me or call me. Email is very imprecise and is good for simple questions. I will respond to email, but the discussion log is for you as students so if you need me, see me, call me or email me.

Grading System: Course involvement, projects and tests with credit allocation are as follows:

(this is a design class, so while I retain the option of a test, a test is by no means certain)

Class Involvement (in-class students only) 100 0 Homework (Modules used for Design) 400 500 Possible test (reduce HW points by 100) 100 100 Projects: Design Paper/Presentations 500 500

TOTAL 1000 1000 (EDGE)

Class Participation:

This is an interesting and important class no matter what your background or what will be your eventual career direction(s). Despite the fact that you will have to work in this class, we hope to make this a useful and enjoyable experience. We encourage all questions - there is no such thing as an embarrassing question as long as one is interested in learning the material and puts in a conscientious effort towards that goal. It is important that on-campus students provide classroom interaction with the faculty member. The questions or ideas that are interactively provided in a classroom lecture are important to the class and the faculty member. In addition, such interaction is valuable to the off-campus EDGE students. Therefore, class attendance and preparation will be a consideration in the grading assessment. During each class, I will solicit class participation, input and questions. I will assess individual class participation in terms of attendance, participation, and preparation. On-campus students are required to attend class. On- campus attendance will be graded from sign-in for each class. On-campus students can have two un-excused; and with prior-written notification, two excused absences; for example documented academic field trip or family emergency; with no impact to your grade. Field trips to sports events are not excused absences.

Homework (HW) and Graduate Assignment Guidelines:

All on-line students must submit assignments via https://elearning2.courses.ufl.edu/portal.

1. The assignment due date and time will be listed on the class website.

2. HW is due at the beginning of class, submitted in person by each in-class

student, before the lecture is started so EDGE technicians are not disrupted in recording the class.

3. For assignments requiring handwritten or electronic submissions:

a. Engineering computational or grid paper must be used with neat and legible

(4)

handwriting or typed. Neatness and legibility will impact the HW grade.

b. Page headings should include HW number, date, course, your name, UFID, and

page number.

c. A brief problem statement should be provided for each question.

d. Assumptions, data and formulae utilized must be shown.

e. Unit conversions must be shown (i.e. between English and SI), conversions throughout the problem, and the final answers shown with units to receive full credit.

f. Sketches should be neat, clear and drawn with a straight edge, scale as required.

g. Final answers must be boxed. Important intermediate answers leading to final results must be underlined.

h. All numerical computations/answers should incorporate the appropriate number of significant figures. Final answers with an inappropriate number of significant figures will be assessed in the grading. While this may seem trite, in practice this is critical.

i. Handwritten work must be legible when turned in as a paper document or legibly scanned and submitted as a single PDF file with the filename formatting:

lastname_HW1.pdf (where lastname is your last name and HW1 represents in this case the first HW assignment).

j. As examples of class assignments and tests, we will keep a select number of assignments and tests for ABET; to create course binders which are required by EES and the College of Engineering (COE).

4. For assignments requiring MS Word or another word processor, graphical or statistical analysis software; for example with respect to the graduate assignment, follow the comments above as necessary (submit as PDF) and additional guidance will be provided.

5. For assignments requiring MS Excel:

a. Spreadsheets must be well organized and of professional quality and aesthetics.

b. The first sheet in the workbook must be a summary table with the required answers to all of the problems and HW number, date, course, your name, and UFID.

c. Each problem should have its own worksheet within the workbook.

d. A brief problem statement should be provided for each question.

e. Assumptions, data and formulae utilized must be shown. (Microsoft Equation is an excellent tool for showing formulae and is included in Excel).

f. Unit conversions must be shown (i.e. between English and SI)

g. A clear path from initial inputs to final solutions must be apparent when grading, without the need for guidance by the student. All columns and rows must be labeled and units must be clearly shown.

h. Final answers should be boxed or highlighted. Important intermediate answers

(5)

leading to final results should be underlined or otherwise signified.

i. Graphs must be appropriately labeled and scaled; with the appropriate use of significant figures.

j. The spreadsheet should be submitted as a single .xls (or .xlsx) file with the filename formatting: lastname_HW1.xls (where lastname is your last name and HW1 represents in this case the first HW assignment).

6. Assess if your solution is reasonable – comment as required. Develop a sense for what answer to expect. Comment on the uncertainties involved in your answers.

7. You are encouraged to work together on homework to understand concepts and solve the problems, but each of you is responsible for understanding the material. Copying of work, i.e. from old HW or subcontracting of work between class members is not permitted. This is not a design class; each of you needs to individually learn and demonstrate the course material.

8. In addition to the method and solution, adherence to these requirements will be graded.

9. Submissions developed electronically, must have no less than a 10 point New Times Roman font, and each page must be formatted to fit on 8.5 x 11 inch paper with 1 inch margins.

14. While this is an engineering class, written communication is important and is

considered in grading each homework assignment so that you think about how you are stating your assumptions, results and conclusions.

15. Organization, legibility will be considered when grading.

16. Is to your advantage to show all your calculation steps and all logic from the start of the problem through to the solution. If we cannot assess your steps and logic by inspection, it will be much harder to spend time to try and provide you the benefit of doubt.

Test and Exam Guidelines:

1. In fairness to the entire class, tests cannot be missed/re-scheduled except for actual

documented emergency or scheduled conflict (i.e. you play on a UF sports team and will be out of town). Notification must be given in writing before test.

2. Tests may be take-home tests. You are expected to work individually on a test/exam - no group efforts. This course falls under the academic honesty policies of the College of Engineering, EDGE Program and University of Florida.

Course grades will be assigned on the following basis:

Grade Points

A 900 - 1000

B 800 - 899

C 700-799

D 600-699

E < 599

Since there are half-grades at University of Florida; a linear interpolation between traditional

“whole” letter grades will be used for half-grades. We do not grade on a curve.

Graduate Students:

(6)

This course is designed for seniors and graduate students. Graduate students, who are further along in their academic career, are expected to demonstrate additional analysis and understanding in their coursework and design. For example, a graduate student would be expected to provide additional statistical and mathematical analysis beyond a senior in their course project.

Prerequisite Expectations:

 Undergraduate water chemistry or equivalent background, hydrology/hydraulics, calculus and differential equations

 Knowledge and ability to fully utilize spreadsheets, or write a program in lieu of a spreadsheet solution

 Ability to plot and present data and results in a professional format

 Utilize and apply basic concepts of general water treatment

 Proficiency in the use of Word, PowerPoint, .graphical packages, ACAD, pdf converters

Tentative List of Topics:

1. Introduction to rainfall-runoff quantity and chemistry issues as influenced by anthropogenic activities, the constructed environment and infrastructure materials

2. Basic review of unit operations and processes

3. Rainfall-runoff processes, hydrograph models, design storms, hydrologic measurements 4. Design components of, and processes in, storm sewer and combined sewer systems 5. History of urban water pollution, toxicity and treatment; Urban water of Rome: SPQR 6. Engineered controls for rainfall-runoff peak flow, volume and timing attenuation

7. Regulatory developments that influence control, treatment and water chemistry standards, TMDLs (Important current topic!!)

8. The quantification of urban rainfall-runoff chemistry parameters and loadings (concentration vs. mass)

9. Water chemistry measurements for rainfall-runoff, basic rainfall-runoff and sheet flow transport processes including concepts such as a “water quality volume”

10. Metals, phosphorus, inorganic constituent speciation (Eh-pH space), pathogens

11. Treatment unit operations and processes for LID, in-situ treatment, combined sewer treatment, source control vs. centralized treatment

12. Passive infiltration treatment of rainfall-runoff (introduction to variably-saturated flow/transport)

13. Concepts of rainfall-runoff reuse, recycling and banking 14. Possible field trip and/or guest speakers as time permits

(there is no possible way to cover all of these topics in depth, but we will try and introduce as many of these topics as possible)

Class: Tuesday: 4th and 5th class periods, CSE E107 Thursday: 4th and 5th class periods, CSE E107

When we make up missed classes we will try and do so during the 5th period on Thursday. In an attempt to cover all of the topics may provide a few additional lectures for the class.

(7)

When I have to be out of town Dr. Ying will co-instruct the class OR more than likely, I have already provided the lecture material.

Dates of note:

22 August, first class

29 August, end of drop/add

 25 November, last day to withdraw with a W

 03 December, last day of class

 07-13 December, Exam period; check exam schedule for class exam date/time/location

 Other dates such as research travel or outside lectures are TBA

 Despite my travel schedule I will be able to provide all the lectures, by either having class four periods a week (instead of three) which makes sense since the class periods are 2nd and 3rd, or by creating lectures ahead of the scheduled class that will be available on-line.

References

Related documents

Using a regression model that tabulated results based on housing survey characteristics in a Houston suburb, Groves and Helland (2000) found that zoning negatively affects the

The artificial stock market shows standard statistical facts, e.g.: volatility clustering, the excess kurtosis of the distribution of return, and the scaling properties with

59 Epidemiology Laboratory Capacity Grant (ELC) CDC Federal Annually May Progress updates on grant metrics Hard copy 60 Exempt Lease Report Department of Administration -

By analysing a multi- sector R&amp;D-based endogenous growth model with exhaustible natural resources, labour, knowledge, and physical capital as inputs, the present paper

For the purpose of winning men’s Division III basketball games, the Division III head coaches believed that the game- related items of strong work ethic and

The purpose of this project was to develop an evidence-based staff development program on medication reconciliation to improve staff confidence in medication reconciliation

The cDNA encoding RRM2 of SF2 yASF was amplified from pAcG2T-SF2 yASF using the upstream primer F3 (CCCCACCTAGGCGGTCTGAAAC), which anneals to the region corresponding to SF2 yASF

Each Check Point Appliance supports the Check Point 3D security vision of combining policies, people and enforcement for unbeatable protection and is optimized for enabling