Copyright2000 by the Genetics Society of America
Sequence and Structural Diversity of the
S
Locus Genes From Different Lines
With the Same Self-Recognition Specificities in
Brassica oleracea
Makoto Kusaba,* Masanori Matsushita,*
,1Keiichi Okazaki,*
,2Yoko Satta
†and Takeshi Nishio
‡*Institute of Radiation Breeding, National Institute of Agrobiological Resources, Ministry of Agriculture, Forestry and Fisheries, Ohmiya-machi,
Naka-gun, Ibaraki, 319-2293, Japan,†Graduate University of Advanced Studies, Hayama, Kanagawa, 240-01, Japan and
‡Graduate School of Agricultural Science, Tohoku University Aoba-ku, Sendai, 981-8555, Japan
Manuscript received May 24, 1999 Accepted for publication September 10, 1999
ABSTRACT
Self-incompatibility (SI) is a mechanism for preventing self-fertilization in flowering plants. In Brassica, it is controlled by a single multi-allelic locus, S, and it is believed that two highly polymorphic genes in the S locus, SLG and SRK, play central roles in self-recognition in stigmas. SRK is a putative receptor protein kinase, whose extracellular domain exhibits high similarity to SLG. We analyzed two pairs of lines showing cross-incompatibility (S2and S2-b; S13and S13-b). In S2and S2-b, SRKs were more highly conserved than SLGs. This was also the case with S13and S13-b. This suggests that the SRKs of different lines must be conserved for the lines to have the same self-recognition specificity. In particular, SLG2-b showed only 88.5% identity to SLG2, which is comparable to that between the SLGs of different S haplotypes, while SRK2-bshowed 97.3% identity to SRK2in the S domain. These findings suggest that the SLGs in these S haplotypes are not important for self-recognition in SI.
M
ANY flowering plants show self-incompatibility of the specificity. Similarly, the hypervariable regions of SLG and SRK may be determinants of self-recognition (SI), which prevents self-fertilization. InBrassica-ceae, pollen tube development from self-pollen is spe- in Brassica. An unknown pollen gene in the S locus, encoding a ligand for SLG and SRK, is thought to func-cifically inhibited on the stigma (Nasrallahand
Nas-tion in the recogniNas-tion event. A physiological
experi-rallah1993). This inhibition is controlled by a single
ment has suggested that the pollen product is a small multi-allelic locus, S. The S locus in fact comprises a
molecule in the pollen coating (Stephenson et al.
number of genes, including SLG (the S-glycoprotein
1997). In this context, the hypervariable regions of SLG gene) and SRK (the S-locus receptor kinase gene). SRK
and SRK may be ligand binding sites. is a highly polymorphic gene that encodes a putative
SLG and SRK alleles are assigned, on the basis of
transmembrane receptor protein kinase. SLG shows
sequence similarity, to class I and class II. Class I SLGs high similarity to the putative ligand-binding domain
and SRKs exhibit z65% similarity in amino acid se-of SRK (the S domain). SLG and the S domain se-of SRK
quence to class II SLGs and SRKs (Nasrallah et al.
have basically the same structure, including 12
con-1991), compared to the z80% similarity typical of served cysteine residues and three regions that are
hy-within-class comparisons. Class I S haplotypes, which pervariable between different S haplotypes (Kusabaet
comprise a class I SLG and a class I SRK, constitute most
al. 1997).
of the known Brassica S haplotypes (Hatakeyamaet al.
It is believed that SLG and SRK play central roles in
1998;Okazakiet al. 1999). All class II S haplotypes are
the recognition event in stigmas. Both SLG and SRK
recessive in pollen to all class I S haplotypes and are are expressed predominantly in stigmas just before
thought to express weak SI. These characteristics of flowering, the stage of expression of SI.Mattonet al.
class II S haplotypes are considered to be related to a (1997) suggested that the hypervariable regions of
structural feature unique to a class II SLG, the trans-S-RNase, a determinant of the self-recognition
specific-membrane domain (Tantikanjanaet al. 1993).
ity in the style of the Solanaceae (Leeet al. 1994;
Mur-Several observations are consistent with the view that
fettet al. 1994), are responsible for the determination
both SLG and SRK function in SI. Transgenic experi-ments showed that transformation with anti-sense SLG (Shiba et al. 1995) or sense-cosuppression of SLG or
Corresponding author: Makoto Kusaba, Institute of Radiation
Breed-SRK (Conner et al. 1997; Stahlet al. 1998) reduced
ing, National Institute of Agrobiological Resources, P.O. Box 3,
Oh-miya-machi, Naka-gun, Ibaraki-ken, 319-2293, Japan. expression of SLG and SRK and caused conversion to
E-mail: [email protected] the self-compatible phenotype.Nasrallahet al. (1992)
1Present address: Takii Plant Breeding & Experiment Station, Kohsei,
demonstrated that the expression of SLG, but not SRK,
Kohka-gun, Shiga 520-3231, Japan.
is reduced in a self-compatible mutant, while another 2Present address: Faculty of Agriculture, Niigata University, Niigata,
950-2181, Japan. self-compatible line was found to have a nonfunctional
genomic and cDNA clones of SLG2-band SRK2-bwere isolated
SRK and a normal SLG (Nasrallahet al. 1994a).
How-by a hybridization-based method using a Dig-labeled PCR
ever, some contradictory observations also have been
product amplified from the S2-bhaplotype with the PS3 and
reported.Kusabaet al. (1997) andKusabaandNishio PS21 primer set (Nishioet al. 1996). This PCR product
corre-(1999) showed that some S haplotypes with very similar sponds to SLG2-b(see text). SLA, an anther-expressed S-locus gene, was amplified, using primers CAAGCGCCCGCAAAG
SLG alleles do not have the same self-recognition
speci-CAGGAAAA and CAGTACATGACCAAATCGACATC, from
ficity.Gaude et al. (1995) showed that the strength of
genomic DNA of the S2homozygote S tester line and cloned
SI is not related to the expression level of SLG in the
into the pCR2 vector using a TA cloning kit (Invitrogen,
Carls-class II haplotypes. Furthermore, the S24 haplotype of
bad, CA).
B. oleracea shows normal SI even though it seems to be DNA and protein gel blot analysis:DNA gel blot analyses
were carried out as described byKusabaandNishio(1999),
lacking SLG (Okazakiet al. 1999). These observations
using the Dig labeling and detection system (Boehringer
challenge the view that SLG is one of the key molecules
Mannheim, Indianapolis) using CSPD as a substrate or the
in self-recognition (Nasrallahet al. 1994b).
ECL system (Amersham Pharmacia Biotech, Piscataway, NJ).
We identified a broccoli line that is incompatible with Protein gel blot analysis was performed as described by Oka-the S2 line in the B. oleracea S tester lines, a standard
zakiet al. (1999). Protein was extracted from 30 stigmas with
0.15 ml of 0.02mphosphate buffer, pH 7.0, and, after
centrifu-collection for S haplotypes (Brace et al. 1994). The
gation, glycerol was added to the supernatant to a final
concen-DNA banding pattern of this line using a class II SLG
tration of 5%. An aliquot of the supernatant (15 ml) was
probe clearly differed from the S2 line and was
desig-subjected to nonequilibrium pH gradient electrophoresis.
nated S2-b(Okazakiet al. 1999). S2-bis found to be widely
After transfer to a PVDF membrane, SLG and SLG-like
pro-distributed in commercial cultivars of broccoli and cab- teins were detected with anti-SLG22antiserum.
DNA sequencing and sequence analysis:Sequencing was
bage (Sakamotoet al. 1999). Furthermore, an S13
haplo-carried out by the dye-terminator method using PRISM 377
type, which showed a banding pattern different from
(Perkin-Elmer, Norwalk, CT) as described by Kusaba and
the S13haplotype of the S tester lines, was also found in
Nishio(1999). SLG13and SLG13-bwere amplified with the class
broccoli cultivars and designated S13-b (Okazaki et al.
I-SLG-specific primer set, PS22 and PS15 (Sakamoto et al.
1999). S2and S2-bhave different PCR-restriction fragment
1998). The PCR products were purified with a QIAquick PCR purification kit (QIAGEN) and their DNA sequences were
length polymorphisms (RFLPs) in the SLG alleles (
Saka-directly determined. Sequence analyses were performed using
moto et al. 1999), suggesting sequence differences in
Genetyx v. 10.0 (Software Kaihatsu, Tokyo). Sequences
re-SLG; S13, and S13-b also have different SLG PCR-RFLPs.
ported in this article correspond to DDBJ accession nos.
In this article, we describe sequence differences of SLG AB024415–AB024422. and SRK between S2 and S2-band between S13 and S13-b
and report that among S haplotypes with the same
self-recognition specificity, SLG has accumulated more RESULTS amino acid substitutions than the S domain of SRK.
Characterization of theS2-bandS13-bhaplotypes by test
The implications of these results for the recognition
crossing: Class I S haplotype S13is dominant in pollen
mechanism of Brassica SI are discussed.
and codominant in stigmas to a class II S haplotype S2
(ThompsonandTaylor 1966). S13-b was incompatible
with S13 in reciprocal pollinations, dominant to S2 in MATERIALS AND METHODS
pollen, and codominant with S2in stigmas (Figure 1, A
Plant materials and pollination analysis: The S2 and S13
and B), suggesting that S13-bhas the same
dominance-S tester lines of B. oleracea were kindly provided by Dr. D.
recessiveness relationship as S13of the S tester lines. Like Ockendon. The S2-b and S13-blines were derived from selfed
S2 of the S tester lines, S2-bwas incompatible with S2 in progeny of cv. “Marimidori.” Pollen tube development in
stig-mas after pollination was observed as described inNakanishi reciprocal pollinations and was found to be recessive to
andHinata(1973). To examine the ability to set selfed seeds, S13-bin pollen and codominant with S13-bin stigmas (Fig-seven open flowers from one individual were selfed and the ure 1, C and D). To compare the strength of SI of the resulting seeds were counted 1 month after pollination. In
S2-bhaplotype to that of the S2haplotype, the ability of this experiment, the S2 S tester line and an S2-bline of kale
the plants to set selfed seeds was examined. S2 homozy-were used (Okazakiet al. 1999).
Isolation of genomic and cDNA clones:Genomic DNA was gotes set 0.71 seeds/pod by selfing and S2-bhomozygotes
isolated from young leaves according toRogersandBendich set 1.0 seeds/pod, suggesting that the strengths of their (1985). Genomic libraries for S13, S13-b, and S2-bwere constructed
SIs are comparable.
onlDash II (Stratagene, La Jolla, CA) according toKusaba
Isolation ofSLGandSRKclones from the S13andS13-b
andNishio(1999). The genomic clones for SRK13and SRK13-b
haplotypes:An SRK13genomic clone was isolated from
were isolated by a PCR-based method (Kusaba andNishio
1999). All PCR experiments were conducted under the condi- a genomic library constructed from the leaves of S13 tions described byNishioet al. (1996). An SRK-specific primer homozygotes derived from the S tester lines (Figure 2A).
set, PK1 and PK4 (Nishioet al. 1997), was used for the screen- An SRK13-bgenomic clone was isolated from a genomic ing. Poly(A)1RNA was isolated from stigmas 1 or 2 days before
library constructed from the leaves of S13-bhomozygotes flowering using a Fast-track kit (Promega, Madison, WI), and
derived from selfed progeny of the broccoli F1 hybrid a stigma cDNA library of S2-bwas constructed onlZAP
brane-kinase domains showed lower amino acid identi-ties (96.8 and 97.6%, respectively). The much higher similarity in the S domain suggests that maintenance of the same self-recognition specificity requires conserva-tion of the S domain.
SLG13and SLG13-balso showed high similarity to class
I SLGs that have been reported so far, including the 12 cysteine residues (Figure 2C). Protein gel blot analysis of soluble stigma proteins using an anti-SLG22antibody
revealed that the positions of S-haplotype-specific bands for S13-bare the same as those for S13(Figure 4).
Consis-tent with this observation, the pIs estimated from the deduced amino acid sequences in the mature protein region (pI 8.12) and potential N-linked glycosylation sites are identical in SLG13and SLG13-b. However, direct
sequencing of SLG13and SLG13-brevealed a number of
nonsynonymous differences (98.3% identity in amino
Figure1.—Dominance-recessiveness relationship between
acid sequence in the mature protein region),
particu-S2, S2-b, and S13-b. Test crossing between (A) the S13and S13-b, (B) the S13-band S2, (C) the S2and S2-b, and (D) the S2-band
larly in hypervariable region I, which is thought to be
S13-bhaplotypes. In experiments A and C, the S25(class I)
haplo-involved in the determination of self-recognition
speci-type was used as a control.2, incompatible;1, compatible.
ficity: 6 of 11 amino acid residues in hypervariable re-gion I are substituted.
The base substitutions observed between SLG13and
the entire coding region of SRK gene and showed simi- SLG13-b were clustered in hypervariable region I (data
lar restriction maps. SLG13and SLG13-b were amplified
not shown). Interestingly, on the nucleotide sequence by genomic PCR using a class I SLG-specific primer set, level, SLG13-bin this region is identical to SRK13-band very
PS22 and PS15 (Sakamotoet al. 1998). Both SLGs have similar to SRK13(data not shown), suggesting that the
the 12 conserved cysteine residues (Figure 2C). Our evolution of S13and S13-b has involved gene conversion
SLG13sequence is slightly different from the published
between SLG and SRK or recombination between
differ-SLG13sequence (Dwyeret al. 1991): there is one amino
ent SLG alleles. This is consistent with previous evidence acid substitution in the signal sequence and one in that gene conversion between and recombination in hypervariable region I. These differences probably re- SLG and SRK alleles has occurred in the evolution of flect genetic differences in the lines studied. A DNA gel S haplotypes (Goringet al. 1993; Kusaba et al. 1997; blot analysis using the SLG13probe of an F
2population Suzukiet al. 1997;KusabaandNishio1999).
segregating for S13-b and S2-b revealed two HindIII
frag-Isolation ofSLGandSRKclones of theS2-bhaplotype:
ments, which were determined by test crossing to be A genomic library was constructed from leaves of S2-b
perfectly linked to the S13-bgenotype (Figure 3A). The
homozygotes derived from the selfed progeny of broc-two bands were thought to correspond to SLG13-b and
coli cv. Marimidori. The PCR product amplified from
SRK13-b. The PCR-amplified product of SLG13-b was also
S2-b with class II-specific primer set PS3 and PS21 was
perfectly linked to the S13-bgenotype in 18 segregating
used as a probe to screen the library. Three classes of plants (Figure 3B), confirming that the PCR products clones with sequences highly similar to the class II SLG were derived from SLG13-b. In a previous study (Okazaki
alleles were isolated. On the basis of nucleotide
se-et al. 1999), a DNA gel blot analysis of S13showed only
quence similarity (97.8%; data not shown), the first class two bands detected after HindIII digestion; those bands is thought to be SLR2, an SLG-like gene unlinked to apparently correspond to SLG13and SRK13.
the S locus (Boyeset al. 1991). However, clones within
Sequence comparison of SLG and SRK of the S13
this class presumably encode only a truncated protein,
andS13-bhaplotype:Both SRK13and SRK13-bshowed high
due to a frame-shifting 14-bp deletion in the coding similarity to the class I SRKs reported so far, including region. These observations suggest that the clones rep-the 12 conserved cysteine residues in rep-the S domain resent a nonfunctional allele of SLR2. The second class and the conserved amino acid residues in their kinase is identical in nucleotide sequence to the PCR product domain, which are important for kinase activity (Figure amplified with PS3 and PS21 (data not shown) and was 2B). These characteristics suggest that both SRK13and
designated as GS2b-1. The third class was designated as
SRK13-b are functional alleles. The S domains of SRK13 GS2b-2.
and SRK13-b exhibited a very high similarity in their A DNA gel blot analysis of the selfed progeny of
transmem-the S2-bgenotype (Figure 3C). The GS2b-1 clones contain
a 5.8-kb HindIII fragment and GS2b-2 clones contain a 6.8-kb HindIII fragment, both of which hybridized to the class II SLG probe (Figure 5A). This result indicates
Figure3.—Linkage analysis of the SLG and SRK alleles of the S2-band S13-bhaplotypes. (A) DNA gel blot analysis of selfed progeny of cv. Marimidori segregating for S2-band S13-busing the SLG13-bPCR product as a probe. Genomic DNA (5 mg/ lane) was digested by HindIII and separated on a 0.8% agarose gel. The DNA was detected by the Dig detection system. The hybridization and wash were carried out at 688. The S genotype determined by pollination analysis is shown above each lane. (B) PCR analysis of the same plants using the class I-SLG-specific primer set, PS22 and PS15. (C) The same blot used in A was reprobed with the SLG2-b PCR product under the same conditions as in A. (D) PCR analysis of the same plants using the class II-specific primer set, PS3 and PS21.
that the two bands in the DNA gel blot correspond to GS2b-1 and GS2b-2. The PCR product amplified by the primer set of PS3 and PS21, corresponding to GS2b-1, was also perfectly linked to the S2-b genotype (Figure
3D). The 8.5-kb band, which is common to all segregat-ing plants, was thought to correspond to SLR2. cDNA clones corresponding to the GS2b-1 and GS2b-2 geno-mic clones were isolated from an S2-bstigma library using
the GS2b-1 probe. Sequence analysis of the clone corre-sponding to GS2b-2 revealed that it has a kinase domain, suggesting that GS2b-2 is SRK. This gene was designated as SRK2-b. The cDNA clone corresponding to GS2b-1 did
not have a kinase domain, suggesting that it encodes SLG of the S2-bhaplotype (SLG2-b).
Sequence and structural diversity of SLG and SRK in
S2andS2-b:While class I SLG alleles have no intron and
produce only soluble proteins, SLG2has an intron and a
Figure 2.—Sequence diversity of SLG and SRK between the S13and S13-bhaplotypes. (A) Restriction maps of the SRK13 and SRK13-b genomic clones. Thick lines indicate exons. H,
HindIII; X, XhoI. (B) Comparison of the amino acid sequences
a similarity slightly lower (96.1%) than that in the S domain. The much higher similarity in the SRKs than in the SLGs indicates that SI recognition specificity is less sensitive to amino acid substitutions in SLG than in SRK. This suggests that SLG is not as important as SRK for the determination of self-recognition speci-ficity.
Absence ofSLAin theS2-bhaplotype: SLA is an
anther-expressed S-locus gene specific to the S2 haplotype
(Boyes and Nasrallah1995) that was once thought to be a candidate for the pollen ligand gene. A DNA gel blot analysis was performed using SLA as a probe (Figure 6). No signal was detected in the class I haplo-types (S12, S13-b, S18) or the S5(class II) haplotype.
Unex-pectedly, no band was detected in the S2-b haplotype.
It is considered that S2-b haplotype does not harbor a Figure4.—Protein gel blot analysis of water-soluble stigma
proteins from the S2, S2-b, S13, and S13-bhaplotypes. Stigma
pro-sequence that is highly similar to that of SLA. The
ab-teins were separated by nonequilibrium pH gradient electro- sence of SLA and the transmembrane-anchored SLG in phoresis and detected with an anti-SLG22antibody. The
non-the S2-b haplotype indicates that the S2-b haplotype has
S-haplotype specific bands are thought to be derived from
features that are quite different from the S2haplotype
SLG-like genes unlinked to the S locus, such as SLR1 (Lalonde
in the S tester lines.
et al. 1989).1, anode;2, cathode.
DISCUSSION
second exon, which encodes a transmembrane domain
(Tantikanjanaet al. 1993). SLG2produces alternative Uniqueness of theS2haplotype ofB. oleraceaamong
the class IIShaplotypes:Among Brassica S haplotypes,
mRNA molecules: the spliced mRNA produces a
mem-brane-anchored protein and the unspliced mRNA a sol- the S2haplotype of B. oleracea has been intensively
inves-tigated and has been regarded as an exemplar of the uble protein. Sequence analyses of the genomic and
cDNA clones of SLG2-b revealed that like SLG2, the SLG2-b class II S haplotypes. It has an SLG allele with a second
exon encoding a transmembrane domain and SLA, an gene also contains an intron and a second exon;
how-ever, the second exon cannot encode a transmembrane anther-expressed S locus gene (Tantikanjana et al.
1993;BoyesandNasrallah1995). Certain genetic and domain as it encodes only four amino acid residues
(Figure 5, A and B). physiological features of the S2haplotype, including its
recessiveness and relative weakness of SI, have been In addition to these structural differences, SLG2and
SLG2-b showed significant sequence differences in the attributed to the existence of the membrane-anchored
SLG. In this study, we have shown that the S2-bhaplotype,
first exon. Amino acid sequence identity between SLG2-b
and SLG2was only 88.5% in the mature protein region which is incompatible in reciprocal crosses with the S2
haplotype, does not encode an SLG having a transmem-and a number of differences were observed in the
hyper-variable regions (Figure 5B). The divergence between brane domain, although its genetic and physiological properties are similar to those of the S2haplotype: both
SLG2and SLG2-bis comparable to that between SLGs of
different S haplotypes. For example, SLG2 and SLG2-b are recessive to the class I haplotype S13-bin pollen and
codominant with it in stigmas, and the difference be-exhibit 88.7 and 92.9% identity to SLG5 (Scutt and
Croy 1992), respectively. Protein gel blot analysis re- tween S2-b
and S2
in the rate of seed set by selfing in homozygotes was not significant. These results suggest vealed multiple S-haplotype-specific bands in the S2-b
haplotype, unlike S2, which shows a single band (Figure that the membrane-anchored SLG neither influences
the dominance/recessiveness relationship nor has a re-4). All of these bands are thought to be SLG. SLG2-bwas
produced at a level much higher than that of SLG2. Low markable effect on the strength of SI. This is consistent
with a recent report that S5, which is recessive and shows
production of SLG by the S2haplotype was also reported
byGaudeet al. (1995). relatively weak SI, also lacks a membrane-anchored SLG
(Gaudeet al. 1995;Cabrillacet al. 1999).
SRK2-bhas retained the 12 conserved cysteine residues
in the S domain and the conserved amino acid residues Because S2and S2-bhave the same self-recognition
spec-ificity, their self-recognition genes in pollen would be important for protein kinase activity in the kinase
do-main (Figure 5C). In the S dodo-main, SRK2 and SRK2-b expected to show high similarity to each other. DNA
gel blot analysis using SLA as a probe revealed that the showed 97.3% identity. Hypervariable regions I and II
were identical and hypervariable region III had one S2-bhaplotype does not possess any gene showing high
homology to SLA, suggesting that SLA is not involved amino acid substitution at the end of the region. In the
self-incompatible lines of B. oleracea var. botrytis as well tional SLA allele (interrupted by a retrotransposon) and claimed that SLA is not involved in SI. Our observation as the self-compatible p57Sc (a pollen-part mutant of
the S15haplotype;Cabrillacet al. 1999) have a nonfunc- supports their claim.
With respect to structural features, SLG2-bis less
simi-lar to SLG2than it is to SLG5of B. oleracea (Scuttand
Croy1992) and SLG40and SLG44of B. rapa (
Hatake-yamaet al. 1998): those genes also lack a transmembrane
domain, and their C-terminal amino acid sequences encoded in the second exons are identical. Other than
S2, only the S15 haplotype and its pollen-part mutant
P57Sc possibly produce a membrane-anchored SLG, which was designated SLGA15(Pastuglia et al. 1997;
Cabrillacet al. 1999). However, the very high sequence
similarity of SLGA15to SLG2 (99.0% in nucleic acid
se-quence) and the existence of an SLA-like sequence may indicate that SLGA15 and the SLA-like sequence were
recently transmitted from the S2haplotype as a segment.
Furthermore, the S15haplotype has another SLG gene
(SLGB15) (Cabrillacet al. 1999), suggesting that SLGB15
could represent the original SLG. Interestingly, SLGB15
also has the same four amino acid residues as SLG2-bin
its C-terminal end. The unique features of S2,
particu-larly the existence of a transmembrane domain and
SLA, indicate that the S2haplotype is not a typical class
II S haplotype.
Is SLG important for self-recognition specificity? It
has generally been believed that SLG and SRK play central roles in self-recognition in stigmas. However, accumulating data question the role of SLG in SI.
Gaude et al. (1995) showed that the amount of SLG
was not correlated with seed set by self-pollination of class II homozygotes, a measure of the strength of SI. On the basis of protein and DNA gel blot analyses,
Okazaki et al. (1999) suggested that SLG was deleted
in the S24haplotype of B. oleracea in spite of its normal
expression of SI. Furthermore, some different S haplo-types have very similar SLGs while their SRKs show much lower similarity (Kusabaet al. 1997;KusabaandNishio
1999). For example, SLG23and SLG29of B. oleracea show
99.5% identity and have identical hypervariable regions, but the S domains of SRK23and SRK29exhibit only 87.9%
identity in amino acid sequence. In this article, we dem-onstrated that SLG varies much more than SRK between different lines that share the same self-recognition speci-ficity. While the amino acid sequences responsible for self-recognition specificity are expected to be conserved among such lines, the SLGs of S2/S2-band S13/S13-bhave
accumulated a number of amino acid substitutions in
Figure 5.—Sequence diversity of SLG and SRK between the S2 and S2-b haplotypes. (A) Restriction maps of GS2b-1 (SLG2-b) and GS2b-2 (SRK2-b). Thick lines indicate exons. H,
HindIII; B, BamHI. (B) Comparison of the amino acid
unpublished results), unlike the case for SLG alleles or the kinase domains of SRK alleles (KusabaandNishio
1999).
In the present investigation, it was suggested that the S domain of SRK, but not SLG, is important for recogni-tion in SI. From the observarecogni-tion that the S15haplotype
has two distinct SLG genes, Cabrillac et al. (1999)
suggested that the two SLG genes are redundant or that they are not required for recognition in SI. Our observation favors the latter interpretation.Luu et al.
(1999) recently suggested that SLG and SLR1 are in-volved in pollen adhesion to the surface of the stigma. This means that SLG might have a function more
gen-Figure6.—Absence of SLA in the S2-bhaplotype. DNA gel
eral than determination of self-recognition specificity.
blot analysis using SLA as a probe. Genomic DNA (5mg/lane)
In any case, further evidence is required to demonstrate
was digested by HindIII and separated on a 0.8% agarose
gel. The blot was detected by the ECL detection system. The that SLG is not essential to SI.
hybridization and wash were carried out at 428in hybridization
We thank D. Ockendon and D. Astley for providing plant materials,
buffer containing 6murea.
M. E. Nasrallah and J. B. Nasrallah for providing anti-SLG antiserum, and M. Uyenoyama for her suggestions for improvement of our manu-script. This work was supported by a grant from the Science and Technology Agency of Japan and in part by a Grant-in-Aid (Bio Design
the hypervariable regions. In particular, SLG2-bshowed
Program) from the Ministry of Agriculture, Forestry and Fisheries.
only 88.5% amino acid identity to SLG2, which is
compa-rable to that between SLGs of different S haplotypes. These results suggest that SLG is not important for
rec-LITERATURE CITED
ognition of SI specificity.
Boyes, D. C., C.-H. Chen, T. Tantikanjana, J. J. EschandJ. B.
On the other hand,Nasrallahet al. (1992)
demon-Nasrallah,1991 Isolation of a second S locus related cDNA
strated that the trans-acting scf mutation, which causes from B. oleracea: genetic relationship between the S locus and
two related loci. Genetics 127: 221–228.
self-compatibility, reduces the expression of SLG, but
Boyes, D. C.,andJ. B. Nasrallah,1995 An anther-specific gene
not SRK. However, expression of SLR1 and SLR2 was
encoded by an S locus haplotype of Brassica produces
comple-also reduced in the scf mutant. This suggests that the mentary and differentially regulated transcripts. Plant Cell 7:
1283–1294.
self-compatible phenotype could have been caused by
Brace, J., G. J. KingandD. J. Ockendon,1994 A molecular
ap-the reduced expression of oap-ther genes regulated by SCF.
proach to the identification of S-alleles in Brassica oleracea. Sex.
Other evidence for the function of SLG in SI is given Plant Reprod. 7: 201–208.
Cabrillac, D., V. Delorme, J. Garin, V. Ruffio-Chable, J.-L.
Giran-by transgenic experiments. A sense cosuppression
ex-tonet al., 1999 The S15self-incompatibility haplotype in Brassica
periment (Conneret al. 1997) and an anti-sense
trans-oleracea includes three S gene family members expressed in
stig-genic experiment (Shibaet al. 1995) using SLG seemed mas. Plant Cell 11: 971–986.
Conner, J. A., T. Tantikanjana, J. C. Stein, M. K. Kandasamy, J. B.
to indicate that reduced expression of SLG causes the
Nasrallah et al., 1997 Transgene-induced silencing of S-locus
self-compatible phenotype. However, the expression of genes and related genes in Brassica. Plant J. 11: 809–823.
SRK might also have been reduced in the transgenic Dwyer, K. G., M. A. Balent, J. B. NasrallahandM. E. Nasrallah,
1991 DNA sequences of self-incompatiblility genes from Brassica
plants because of the high homology between SLG and
campestris and B. oleracea: polymorphism predating speciation.
SRK. Thus, while these transgenic experiments do not Plant Mol. Biol. 16: 481–486.
unequivocally demonstrate that SLG is essential for SI, Gaude, T., M. Rougier, P. Heizmann, D. J. OckendonandC. Dumas,
1995 Expression level of the SLG gene is not correlated with
they do demonstrate that one or more genes highly
the self-incompatibility phenotype in the class II S haplotypes of
similar to SLG are involved in SI. Involvement of SRK Brassica oleracea. Plant Mol. Biol. 27: 1003–1014.
in SI is consistent with other observations as well: a self- Goring, D. R., T. L. Glavin, U. SchaferandS. J. Rothstein,1993 An S receptor kinase gene in self-compatible Brassica napus has
compatible mutant was shown to have a nonfunctional
a 1-bp deletion. Plant Cell 5: 531–539.
SRK (Nasrallah et al. 1994a), and introduction of a Hatakeyama, K., T. Takasaki, M. WatanabeandK. Hinata,1998
nonfunctional SRK transgene caused partial self-com- Molecular characterization of S locus genes, SLG and SRK, in a pollen-recessive self-incompatibility haplotype of Brassica rapa L.
patibility without reducing SLG or SRK expression
Genetics 149: 1587–1597.
(Stahl et al. 1998). Our observations that the amino Kusaba, M.,andT. Nishio,1999 Comparative analysis of S
haplo-acid sequence of the S domain of SRK is highly con- types with very similar SLG alleles in Brassica rapa and B. oleracea. Plant J. 17: 83–92.
served between S haplotypes with the same recognition
Kusaba, M., T. Nishio, Y. Satta, K. HinataandD. Ockendon,1997
specificity suggest that the S domain is important for Striking sequence similarity in inter- and intra-specific compari-recognition. Consistent with this view, we have not sons of class I SLG alleles from Brassica oleracea and Brassica
cam-pestris: implications for the evolution and recognition mechanism.
found within the same species any distinct SRK alleles
Proc. Natl. Acad. Sci. USA 94: 7673–7678.
that show high similarity in the S domain (24 S haplo- Lalonde, B. A., M. E. Nasrallah, K. G. Dwyer, C.-H. Chen, B.
Barlowet al., 1989 A highly conserved Brassica gene with
mology to the S-locus-specific glycoprotein structural gene. Plant acterization of S tester lines in Brassica oleracea: polymorphism of restriction fragment length of SLG homologues and isoelectric Cell 1: 249–258.
points of S-locus glycoproteins. Theor. Appl. Genet. 98: 1329– Lee, H.-S., S. HuangandT.-H. Kao,1994 S proteins control
rejec-1334. tion of incompatible pollen in Petunia inflata. Nature 367: 560–
Pastuglia, M., V. Ruffio-Chable, V. Delorme, T. Gaude, C. Dumas 563.
et al., 1997 A functional S locus anther gene is not required for Luu, D.-T., D. Marty-Mazars, M. Trick, C. DumasandP. Heizmann,
the self-incompatibility response in Brassica oleracea. Plant Cell 9:
1999 Pollen-stigma adhesion in Brassica spp involves SLG and
2065–2076. SLR1 glycoproteins. Plant Cell 11: 251–262.
Rogers, S. O.,andA. J. Bendich,1985 Extraction of DNA from Matton, D. P., O. Maes, G. Laublin, Q. Xike, C. Bertrandet al.,
milligram amounts of fresh, herbarium and mummified plant
1997 Hypervariable domains of self-incompatibility RNases
me-tissues. Plant Mol. Biol. 5: 69–76. diate allele-specific pollen recognition. Plant Cell 9: 1757–1766.
Sakamoto, K., M. KusabaandT. Nishio,1998 Polymorphism of Murfett, J., T. L. Atherton, B. Mou, C. S. Grasser and B. A.
the S-locus glycoprotein gene (SLG) and the S-locus related gene McClure, 1994 S-RNase expressed in transgenic Nicotiana
(SLR1) in Raphanus sativus L. and self-incompatible ornamental
causes S-allele-specific pollen rejection. Nature 367: 563–566. plants in the Brassicaceae. Mol. Gen. Genet. 258: 397–403.
Nakanishi, T.,andK. Hinata,1973 An efficient time for CO2gas Sakamoto, K., M. KusabaandT. Nishio,1999 Single seed
PCR-treatment for overcoming self-incompatibility in Brassica. Plant RFLP analysis for identification of S haplotypes in commercial
Cell Physiol. 14: 873–879. F
1hybrid cultivars of broccoli and cabbage. Plant Cell Rep. (in
Nasrallah, J. B.,andM. E. Nasrallah,1993 Pollen-stigma signal- press).
ing in the sporophytic self-incompatibility response. Plant Cell Scutt, C. P., andR. R. D. Croy,1992 An S
5 self-incompatibility
10:1325–1335. allele-specific cDNA sequence from Brassica oleracea shows high
Nasrallah, J. B., T. NishioandM. E. Nasrallah,1991 The self- homology to the SLR2 gene. Mol. Gen. Genet. 232: 240–246.
incompatibility genes of Brassica: expression and use in genetic Shiba H., K. Hinata, A. SuzukiandA. Isogai,1995 Breakdown of
ablation of floral tissues. Annu. Rev. Plant Physiol. Plant Mol. self-incompatibility in Brassica by the antisense RNA of the SLG
Biol. 42: 393–422. gene. Proc. Jpn. Acad. Ser. B 71: 81–83.
Stephenson, A. G., J. Doughty, S. Dixon, C. Elleman, S. Hiscock Nasrallah, J. B., S. J. RundleandM. E. Nasrallah,1994a Genetic
et al., 1997 The male determinant of self-incompatibility in Bras-evidence for the requirement of the Brassica S-locus receptor
sica oleracea is located in the pollen coating. Plant J. 12: 1351–1359.
kinase gene in the self-incompatibility response. Plant J. 5: 373–
Stahl, R. J., M. Arnoldo, T. L. Glavin, D. R. GoringandS. J. 384.
Rothstein,1998 The self-incompatibility phenotype in Bras-Nasrallah, J. B., J. C. Stein, M. K. KandasamyandM. E. Nasrallah,
sica is altered by the transformation of a mutant S locus receptor 1994b Signaling the arrest of pollen tube development in
self-kinase. Plant Cell 10: 209–218. incompatible plants. Science 266: 1505–1508.
Suzuki, G., M. Watanabe, A. IsogaiandK. Hinata,1997 Highly Nasrallah, M. E., M. K. Kandasamy andJ. B. Nasrallah,1992
conserved 59-flanking regions of two self-incompatibility genes, A genetically defined trans-acting locus regulates S-locus function
SLG9and SRK9. Gene 191: 123–126.
in Brassica. Plant J. 2: 497–506.
Tantikanjana, T., M. E. Nasrallah, J. C. Stein, C.-H. Chenand Nishio, T., M. Kusaba, M. WatanabeandK. Hinata,1996
Registra-J. B. Nasrallah,1993 An alternative transcript of the S locus tion of S-alleles in Brassica campestris L by the restriction fragment glycoprotein gene in a class II pollen-recessive self-incompatibility
sizes of SLGs. Theor. Appl. Genet. 92: 388–394. haplotype of Brassica oleracea encodes a membrane-anchored
pro-Nishio, T., M. Kusaba, K. Sakamotoand D. J. Ockendon,1997 tein. Plant Cell 5: 657–666.
Polymorphism of the kinase domain of the S-locus receptor kinase Thompson, K. F.,andJ. P. Taylor, 1966 Non-linear dominance
gene (SRK ) in Brassica oleracea L. Theor. Appl. Genet. 95: 335– relationships between S alleles. Heredity 21: 345–362.
342.
