Age of the Earth & Fossil Record
Geographic Distribution of Living
Species
Anatomy & Physiology
Embryology
Biochemistry
More Evidence for
Evolution
The age of the Earth
How old is the universe?
How old is the universe?
Its been about 14 to 15
Its been about 14 to 15
billion years since the
billion years since the
Big Bang
How old is the Earth?
about 4.6 billion years old
How long ago did the earth cool enough for water vapor to condense and form oceans?
about 3.8 - 3.9 billion years ago
How long has there been life on the Earth?
about 3.5 – 3.9 billion years (when liquid water was around!)
When did the first primates appear on earth?
~ 60 - 85 million years ago (fossil & genetic data)
When did the first hominins develop?
5-8 million yrs ago
When did the separation of man and ape from a
common unnamed ancestor occur?
dinosaurs humans bacteria
origins
http://en.wikipedia.org/wiki/Geologic_time_scale
en.wikipedia.org/wiki/Image:Eopraptor_sketch5.png © World Health Org.
© NASA
complex cells
The fossil record shows a sequence from simple bacteria to more complicated organisms through time and provides the most
1. Fossil record: Fossils show that
species have changed a great deal
over the history of earth.
Relative dating:
By examining
fossils from
sequential layers of
rock, it is clear that
species have
become more
complex over the
history of the Earth.
evolution.berkeley.edu/evosite/lines/IVCexperiments.shtml en.wikipedia.org/wiki/Image:Kangaroo_and_joey03.jpg
Marsupials • organisms also tells of Geographic spread of their past evolution.
• Marsupials occur in two populations today in the Americas and Australia.
• This shows the group evolved before the
Closely related, but different
Some species are absent from areas
Species that are closer
geographically tend to be more
closely related than species that
inhabit the same habitats.
Although vertebrate body parts may be
used for many different things (flying,
running, walking, swimming, etc), many of
them have the same basic bone structure.
en.wikipedia.org/wiki/Image:Primatenskelett-drawing.jpg
Human and Gorilla
• Similar comparisons can be made based on anatomical evidence.
• The skeleton of humans and
gorillas are very similar suggesting they shared a recent common
ancestor, but very different from the more distantly related
woodlouse…
yet all have a common shared characteristic:
Many organisms have vestiges, or
traces, of body parts that serve no
function now, but may have once
served some purpose in the organism’s
evolutionary history.
Selective breeding of plants and
animals to promote the occurrence of
desirable traits.
Similarities in Embryology
In their early
stages of
development, chickens,
turtles and rats look similar,
providing
evidence that they shared a common
All organisms use the same genetic
Organisms that scientists predicted
had common ancestors have been
shown to have similar DNA.
HUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA CHIMPANZEE CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA GORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
• Evolution suggests we would expect that DNA in closely
related organisms to be more similar to one another than more distantly related organisms.
• Comparison of the human genetic code with that of other
organisms show that chimpanzees are nearly genetically identical (differ by less than 2-4%) whereas the mouse differs by 15%.
http://en.wikipedia.org/wiki/Image:Antibiotic_resistance.svg
en.wikipedia.org/wiki/Image:Staphylococcus_aureus%2C_50%2C000x%2C_USDA%2C_ARS%2C_EMU.jpg
Staphylococcus
• We are all familiar with the way that certain
bacteria can become resistant to antibiotics
• This is an example of natural selection in action. The antibiotic acts as an
environmental pressure. It weeds out those bacteria with low resistance and only those with high resistance survive to reproduce.
Evolution within
a species that
we can see
http://en.wikipedia.org/wiki/Image:Biston.betularia.7200.jpg en.wikipedia.org/wiki/Image:Biston.betularia.f.carbonaria.7209.jpg en.wikipedia.org/wiki/J._B._S._Haldane
• The Peppered Moth is an example of Natural Selection in action
discovered by Haldane
• During the Industrial Revolution the trees on which the moth rested became soot-covered.
Haldane and the peppered moth
• This selected against the allele for pale color in the population (which were poorly camouflaged from predators) and selected for the dark color allele.
Evolution is a
well supported
explanation for
an observable
set of facts
Remember……. A theory in science is a well
tested hypothesis, not just a guess!
Read pg 1-4 in Handout: Answer these
questions in your journal (Be prepared to
share with the class)
1.
What are some things we can learn from looking atskulls?
2. What are some major differences between human and ape skulls?
3. What are indices and why are we using them? 4. How do you calculate the cephalic index?
