• No results found

In Vivo Differences in the Virulence, Pathogenicity, and Induced Protective Immunity of wboA Mutants from Genetically Different Parent Brucella spp.

N/A
N/A
Protected

Academic year: 2020

Share "In Vivo Differences in the Virulence, Pathogenicity, and Induced Protective Immunity of wboA Mutants from Genetically Different Parent Brucella spp."

Copied!
7
0
0

Loading.... (view fulltext now)

Full text

(1)

Protective Immunity of

wboA

Mutants from Genetically Different

Parent

Brucella

spp.

Zhen Wang, Jianrui Niu, Shuangshan Wang, Yanli Lv, Qingmin Wu

Key Laboratory of Animal Epidemiology and Zoonosis of Ministry of Agriculture, College of Veterinary Medicine, China Agricultural University, Beijing, China

To explore the effects of the genetic background on the characteristics of

wboA

gene deletion rough mutants generated from

dif-ferent parent

Brucella

sp. strains, we constructed the rough-mutant strains

Brucella melitensis

16 M-MB6,

B. abortus

2308-SB6,

B. abortus

S19-RB6, and

B. melitensis

NI-NB6 and evaluated their survival, pathogenicity, and induced protective immunity in

mice and sheep. In mice, the survival times of the four mutants were very different in the virulence assay, from less than 6 weeks

for

B. abortus

S19-RB6 to 11 weeks for

B. abortus

2308-SB6 and

B. melitensis

NI-NB6. However,

B. abortus

S19-RB6 and

B.

melitensis

16 M-MB6, with a shorter survival time in mice, offered better protection against challenges with

B. abortus

2308 in

protection tests than

B. abortus

2308-SB6 and

B. melitensis

NI-NB6. It seems that the induced protective immunity of each

mu-tant might not be associated with its survival time

in vivo

. In the cross-protection assay, both

B. melitensis

16 M-MB6 and

B.

abortus

S19-RB6 induced greater protection against homologous challenges than heterologous challenges. When pregnant sheep

were inoculated with

B. abortus

S19-RB6 and

B. melitensis

16 M-MB6,

B. abortus

S19-RB6 did not induce abortion, whereas

B.

melitensis

16 M-MB6 did. These results demonstrated the differences in virulence, pathogenicity, and protective immunity

in

vivo

in the

wboA

deletion mutants from genetically different parent

Brucella

spp. and also indicated that future rough vaccine

strain development could be promising if suitable parent

Brucella

strains and/or genes were selected.

B

rucella

spp. are Gram-negative, facultative, intracellular

bac-teria that cause brucellosis (

1

), which results in abortion and

decreased milk production in animals and often induces fatigue

and disabling sequelae in humans (

2

).

Successful control and eradication of brucellosis depends on

animal vaccinations, serological examinations, and the slaughter

of infected animals, followed by destruction of the carcasses (

3

).

Live

Brucella

vaccines (

B. abortus

S19 for cattle and

B. melitensis

Rev.1 and

B. suis

S2 for cattle, sheep, and goats) induce effective

immune protection against brucellosis for 4 years or more (

4

6

),

but vaccination with the three vaccines may cause abortion in

pregnant animals (

7

9

). Meanwhile, all three vaccines carry a

bac-terial surface antigen with an immunodominant region

(O-poly-saccharide [OPS]), which persistently induces antibodies that

in-terfere with the diagnosis of brucellosis. Thus, a novel, safe vaccine

without the immunodominant OPS antigens is urgently needed

for brucellosis eradication campaigns.

Many scientists have endeavored to improve current vaccine

strains or to design novel vaccines that are devoid of OPS (rough

lipopolysaccharide [LPS]) and with satisfactory immunogenic

properties (

3

). One of the best-known rough vaccine strains is

B.

abortus

RB51, a highly attenuated rough strain evaluated in mice,

cattle, and bison that does not interfere with diagnosis and retains

the capacity to induce protection (

10

12

). Another attenuated

rough strain,

B. melitensis

B115, also confers significant protective

immunity in mice against the challenge of

B. melitensis

16 M,

B.

ovis

, and

B. abortus

2308, equivalent to what is provided by

B.

melitensis

Rev.1 (

13

,

14

). A different attenuated live rough vaccine

strain,

B. abortus

45/20, confers protection in cattle, but the

vac-cine strain easily reverts to smooth pathogenic forms

in vivo

(

12

,

15

). However, it was reported that the protective immunity

in-duced by rough

Brucella

mutants was inferior to that induced by

the smooth vaccine strains in sheep and goats, and several

re-searchers started to question the feasibility of developing rough

Brucella

vaccine strains (

16

,

17

). Consequently, the suitability of

rough mutants for live-vaccine development remains a topic of

debate.

Previous studies on the virulence and induced protective

im-munity of the

wboA

gene deletion rough mutants was performed

using

Brucella

spp. with various genetic backgrounds and under

different experimental conditions, which made it difficult to

com-pare the results. In this study, we selected the

wboA

gene, a model

gene that encodes a glycosyltransferase responsible for OPS

po-lymerization. We then evaluated the virulence, pathogenicity, and

induced protective immunity of four rough mutants derived from

different parent strains under the same experimental conditions.

These results will be useful to evaluate the effects of genetic

back-grounds on the characteristics of

wboA

gene deletion rough

mu-tants generated from the different parent

Brucella

spp.

MATERIALS AND METHODS

Bacterial strains and media.The virulentB. abortus2308,B. melitensis16 M, andB. canisRM6/66 and the vaccine strainB. abortusS19 were all kindly donated by Qianni He (Institute of Veterinary Research, Xinjiang Academy of Animal Sciences, China). The strains mentioned above were originally collected and preserved in the Chinese Veterinary Culture Col-lection Center (CVCC). The epidemic strainB. melitensisNI was isolated

Received27 September 2012Returned for modification15 October 2012

Accepted27 November 2012

Published ahead of print12 December 2012

Address correspondence to Qingmin Wu, [email protected], or Yanli Lv, [email protected].

Copyright © 2013, American Society for Microbiology. All Rights Reserved.

doi:10.1128/CVI.00573-12

on August 17, 2020 by guest

http://cvi.asm.org/

(2)

from an aborted bovine fetus from Inner Mongolia by our laboratory. This strain, also referred to as the smooth virulentB. melitensisstrain biovar 3, induced abortion in pregnant cattle, sheep, and goats. The com-plete NI genomes were sequenced. AllBrucellastrains, including the par-ent strains and the derived mutants, were routinely grown in tryptic soy broth (TSB) or tryptic soy agar (TSA) at 37°C.Escherichia colistains were grown on Luria-Bertani (LB) plates overnight at 37°C, with or without supplemental ampicillin (100 mg/liter) and chloromycetin (30 mg/liter) (Table 1). All work with live virulentBrucellastrains was performed in biosafety level 3 facilities at China Agricultural University.

Animals.Four- to 6-week-old female BALB/c mice were purchased from Weitong Lihua Laboratory Animal Services Centre (Beijing, China), bred in individually ventilated cage rack systems, and subsequently trans-ferred to the biosafety level 3 facilities of China Agricultural University at the beginning of the experiments. Pregnant female sheep at 100 to 120 days of gestation were obtained from brucellosis-free regions and deter-mined to be seronegative with the brucellosis Rose-Bengal plate aggluti-nation test (RBT) (9) and a standard tube agglutination test (SAT). The animals were housed in restricted-access large-animal isolation facilities. At the end of the experiments, all of the animals were euthanized with an animal-culling device and disposed of according to relevant national reg-ulations. All experiments involving animals followed the regulations en-acted by the Beijing Administration Office of Laboratory Animals.

Construction ofwboAdeletion mutants and their complementary strains.To construct the recombinant plasmid for deleting thewboAgene (the accession numbers of thewboAgenes in the genomes ofB. abortus

2308, B. melitensis 16 M, B. melitensis NI, and B. abortus S19 are BAB1_0999, BMEI0998, BMNI_I0963, and BabS19_I09300, respec-tively), the 5=and 3=fragments flanking the gene of interest were amplified with the primers shown inTable 2. According to the methods and proce-dures of Kahl-McDonagh (20), the recombinant plasmid

pEX18Ap-⌬wboAwas created by a two-round PCR amplification, restricted

diges-tion, and ligation and then introduced intoB. abortus2308 and S19 andB. melitensis16 M and NI by electroporation.Brucellacolonies sensitive to ampicillin (Amps) were selected on a sucrose-containing medium (Sucr). ThewboAdeletion mutants were then verified by PCR and sequencing analysis and are referred to asB. abortus2308-SB6,B. abortusS19-RB6,B. melitensis16 M-MB6, andB. melitensisNI-NB6. To construct comple-mentation strains, primers were designed to amplify the wholewboAgene. The resulting PCR products were digested with BamHI and HindIII and then ligated into a pBBR1MCS plasmid (18) digested with the same en-zymes. The resultant recombinant vector, pBBRwboA, was then electro-porated intoB. abortus2308-SB6,B. abortusS19-RB6,B. melitensis16 M-MB6, andB. melitensisNI-NB6. The complementation strains loaded with pBBRwboAwere selected on TSA plates containing chloromycetin. Lastly, the selected complementation strains were verified by PCR and designated CB. abortus2308-SB6, CB. abortusS19-RB6, CB. melitensis16 M-MB6, and CB. melitensisNI-NB6.

Phenotypic characterization of the mutants.The phenotypes of the mutants and their complementation strains were characterized by coag-glutination of the killed bacterial suspensions with the acriflavine solution and the antisera against smooth and roughBrucellastrains and by colony staining with crystal violet solution (21).B. abortus2308 (smooth) andB. canisRM6/66 (rough) were used as phenotype controls.

Virulence in BALB/c mice.Twenty-five mice were intraperitoneally inoculated with a dose of 106CFU in 0.1 ml phosphate-buffered saline (PBS) for each strain (including the rough mutants, the complementation strains, and the parent strains). Another 25 mice received 0.1 ml PBS per mouse as a control. Five infected mice from each infected group or from the control group were randomly selected and euthanized via carbon di-oxide asphyxiation at 1, 3, 6, 9, and 11 weeks postinoculation. At each time point, spleens were collected aseptically, homogenized in 1 ml of PBS, and then serially diluted (1/10, 1/100, and 1/1,000). A 200-␮l aliquot of each dilution and undiluted spleen homogenates were plated on TSA plates,

TABLE 1Bacterial strains and plasmids

Strain or plasmid Characteristic(s) Source or reference

Bacterial strains

B. abortus2308 Wild type, smooth, virulent Qianni He laboratory

B. melitensis16 M Wild type, smooth, virulent Qianni He laboratory

B. melitensisNI Epidemic strain, smooth, virulent This laboratory

B. abortusS19 Vaccine strain, smooth Qianni He laboratory

B. canisRM6/66 Wild type, rough, virulent Qianni He laboratory

B. abortusS19-RB6 wboAdeletion mutant of S19 This work

B. abortus2308-SB6 wboAdeletion mutant of 2308 This work

B. melitensis16 M-MB6 wboAdeletion mutant of 16 M This work

B. melitensisNI-NB6 wboAdeletion mutant of NI This work

Escherichia coliDH10B F⫺mcrA⌬(mrr-hsdRMS-mcrBC)␸80dlacZ⌬M15⌬lacX74 endA1 recA1 deoR⌬(ara-leu)7697 araD139 galU galK nupG rpsL(Strr)nupG

Invitrogen

Plasmids

pEX18AP sacB blaAmpr 19

pBBR1MCS Broad-host-range plasmid; Cmr 18

pEX18Ap-⌬wboA pWUO359-pWUO360/pWUO361-pWUO362 cloned into pEX18Ap forwboAgene deletion This study

pBBRwboA pWUO359c-pWUO362c cloned into pBBR1MCS for complementation assay This study

TABLE 2Primers used in this study

Primer name Genetic sequence site (restriction enzyme used) Fragment

pWUO359 5=GGAATTCATCGACGGCGGAACTGG 3=(EcoRI) wboAupstream

pWUO360 5=AAGCTTCGCCTCGGTACTTAACTGG 3=(HindIII) wboAupstream

pWUO361 5=CCGAGGCGAAGCTTGGGCAGCGGCATGAATA 3=(HindIII) wboAdownstream

pWUO362 5=CGGGATCCAGCCGACGAGCAAATAGAA 3=(BamHI) wboAdownstream

pWUO359c 5=CGGGATCCTCCAACTTCATAACTCTAG 3=(BamHI) wboAoperon

pWUO362c 5=AAGCTTTCATGCCGCTGCCCTCACG 3=(HindIII) wboAoperon

on August 17, 2020 by guest

http://cvi.asm.org/

(3)

incubated for 3 to 5 days at 37°C with 5% (vol/vol) CO2, and checked daily for growth. The bacteria recovered from the spleens were enumerated to evaluate the survival of each strain in mice (20,22). The results are pre-sented as the mean number of CFU per spleen⫾standard deviation (SD) in each group. If no bacteria grew in the undiluted homogenized sample, the spleen was assumed to contain less than 5 bacteria, below the limit of detection of 5 CFU/spleen.

Protection test in mice.Experiments were performed according to the procedure in theManual of Diagnostic Tests and Vaccines for Terrestrial Animals(9). Five mice were intraperitoneally inoculated at a dose of 106 CFU/mouse for each rough mutant or the vaccine strainB. abortusS19, respectively. Another five mice were intraperitoneally inoculated with 0.1 ml PBS as a control. Each mouse was challenged with 2⫻105CFU of the wild-type strainB. abortus2308 at 14 weeks after vaccination. Two weeks later, the challenged mice were euthanized as described above. Spleens were collected and homogenized in 1 ml of PBS, serially diluted, and plated onto TSA. The challenged bacterial burden of the spleen was used to measure the protective immunity index.

Cross-protection test in mice.The mutants that conferred a high level of protection in the protection test were selected for a cross-protection assay. Fifteen mice were intraperitoneally vaccinated at a dose of 106CFU/ mouse forB. abortusS19-RB6 orB. melitensis16 M-MB6. Another 15 mice were intraperitoneally inoculated with 0.1 ml of PBS as a control. At 12 weeks postinoculation, five vaccinated mice from each group were randomly challenged at a dose of 2⫻105CFU/mouse withB. abortus 2308,B. melitensis16 M, orB. melitensisNI. Two weeks later, the chal-lenged mice were euthanized as described above. The spleens were col-lected, homogenized in 1 ml of PBS, serially diluted, and plated on TSA. The challenged bacterial burden of the spleen was used to measure the protective immunity index.

Pathogenicity study in sheep.To compare the pathogenicities ofB. abortusS19-RB6 andB. melitensis16 M-MB6 with that ofB. melitensis16 M, the three strains were subcutaneously inoculated into five pregnant female sheep (100 to 120 days of gestation on average) at a dose of 109 CFU, which is considered the standard dose ofB. melitensisRev.1 vaccine for the immunization of sheep and goats (9). The inoculated sheep were observed daily until abortion or delivery, and the lambs were euthanized immediately after birth. Throughout the period of observation, samples of afterbirths, including lungs, livers, spleens, and abomasal fluid, were aseptically collected from the aborted fetuses and lambs for bacteriologi-cal examination. Approximately 30 days after delivery, the sheep were euthanized and necropsied. Samples of the liver, spleen, mammary gland, supramammary lymph nodes, and parotid lymph nodes were collected for bacteriological examination. Afterward, the samples were aseptically re-moved from storage bags, submerged in 70% ethanol, and placed on a sterile petri plate. Approximately 0.5 g of tissue was aseptically extracted

from each sample. Each section was then homogenized in a 50-ml sterile tube containing 1 ml of PBS, and 200␮l of the homogenates was plated on TSA. The plates were incubated for 3 to 5 days at 37°C with 5% (vol/vol) CO2and checked daily for growth. Animals were considered infected based upon the presence ofⱖ1 CFU ofBrucellain any tissue (23).

Serological tests.To evaluate the antibody response induced byB. abortusS19-RB6 andB. melitensis16 M-MB6, a sample of approximately 5 ml of blood was collected from the jugular vein of each vaccinated sheep at 7, 15, 30, 45, and 60 days postinoculation. The presence of OPS-specific antibodies in the sera was determined by the smoothBrucellaantigen (from the China Institute of Veterinary Drug Control) according to the SAT procedure (21,24). To detect antibodies against rough LPS antigens, SAT was performed with the roughBrucellaantigen (from the Chinese Centers for Disease Control Prevention) based on the same procedure.

Statistical analysis.A Student’sttest was performed to analyze the data from the mouse virulence and protection experiments, and aPvalue of⬍0.05 was considered significant.

Nucleotide sequence accession numbers.The GenBank accession numbers of the complete NI genome sequence are CP002931 and CP002932.

RESULTS

Construction of rough

Brucella wboA

deletion mutants.

Bru-cella wboA

gene deletion mutants were constructed via a

double-recombination event and confirmed by PCR with the primers in

Table 2

(

Fig. 1

) and by sequencing analysis (data not shown).

Genetic complementation strains corresponding to each mutant

were constructed by electroporating pBBR

wboA

into

B. abortus

2308-SB6,

B. abortus

S19-RB6,

B. melitensis

16 M-MB6, and

B.

melitensis

NI-NB6. The four mutants were determined to be

rough phenotypes based on the results of the coagglutination

as-say, crystal violet colony staining, and the acriflavine agglutination

assay, whereas the genetic complementation strains C

B. abortus

2308-SB6, C

B. abortus

S19-RB6, C

B. melitensis

16 M-MB6, and

C

B. melitensis

NI-NB6 regained their smooth phenotype. This

confirmed that the four

wboA

deletion mutants and their

corre-sponding genetic complementation strains were successfully

con-structed.

Virulence differences in

wboA

deletion mutants derived

from different genetic backgrounds.

We further determined the

in vivo

survival times and bacterial loads in mice harboring the

four

wboA

deletion mutants. The numbers of viable bacteria

re-covered from the spleens of

B. abortus

2308-SB6-,

B. melitensis

NI-NB6-,

B. melitensis

16 M-MB6, and

B. abortus

S19-RB6-inoc-FIG 1PCR identification ofB. abortus2308-SB6 (A),B. abortusS19-RB6 (B),B. melitensis16 M-MB6 (C), andB. melitensisNI-NB6 (D). (A) Lane 1, DNA marker; lane 2, PCR products ofB. abortus2308; lane 3, PCR products of pEX18Ap-⌬wboA; lane 4, PCR products ofB. abortus2308-SB6. (B) Lane 1, DNA marker; lane 2, PCR products ofB. abortusS19; lane 3, PCR products of pEX18Ap-⌬wboA; lane 4, PCR products ofB. abortusS19-RB6. (C) Lane 1, DNA marker; lane 2, PCR products of pEX18Ap-⌬wboA; lane 3, PCR products ofB. melitensis16 M-MB6; lane 4, PCR products ofB. melitensis16 M. (D) Lane 1, DNA marker; lane 2, PCR products ofB. melitensisNI; lane 3, PCR products of pEX18Ap-⌬wboA; lane 4, PCR products ofB. melitensisNI-NB6.

on August 17, 2020 by guest

http://cvi.asm.org/

(4)

ulated mice were found to be much lower than those from mice

infected with the respective parent strains. As shown in

Fig. 2A

, the

mutant

B. abortus

S19-RB6 was not detected from the inoculated

mice at 6 weeks postinoculation, whereas the

B. abortus

S19 parent

strain persisted for 11 weeks (

Fig. 2B

).

B. melitensis

NI-NB6 and

B.

melitensis

16 M-MB6 were completely cleared at 9 weeks

postin-oculation, whereas

B. abortus

2308-SB6 had the longest survival

time of all the mutants and persisted for 11 weeks in mice (

Fig. 2

).

At the end of the test,

B. melitensis

16 M,

B. abortus

2308, and

B.

melitensis

NI were recovered at 10

4

CFU, 10

5

CFU, and 10

4

CFU,

respectively, from the spleens of the inoculated mice. The

viru-lence levels of the corresponding complementation strains were

similar to that of the parent strains (data not shown). These results

indicated that the four

Brucella wboA

deletion mutants were

at-tenuated in mice and that the virulence levels were significantly

different in the

wboA

deletion mutants derived from different

ge-netic backgrounds.

Differences in protective efficacy of

wboA

deletion mutants

with different genetic backgrounds.

To evaluate the potential

protective immunity induced by the mutants against the

virulent-strain challenge, the numbers of challenge virulent-strains recovered from

the spleens of all the vaccinated mice were compared to the

num-bers recovered from the control mice. The challenge strain

B.

abortus

2308 was expected to be recovered in all of the control

mice. Protective immunity was expressed as log

10

units of

protec-tion (

25

). As shown in

Table 3

,

B. abortus

S19-RB6 and

B.

meliten-sis

16 M-MB6 (1.53 and 1.42 protection units, respectively)

con-ferred greater protection than

B. melitensis

NI-NB6 and

B. abortus

2308-SB6 (0.82 and 0.90 protection units, respectively) (

P

0.05). Meanwhile, the challenge strain

B. abortus

2308 was

recov-ered in all of the challenge control mice, and there was a

statisti-cally significant difference (

P

0.05) between the mutant groups

and the challenge control groups in protective immunity.

Cross-protection of

B. melitensis

16 M-MB6 and

B. abortus

S19-RB6 mutants against challenge with different

Brucella

spp.

To explore the cross-protective immunity induced by the rough

mutants,

B. melitensis

16 M-MB6- and

B. abortus

S19-RB-vacci-nated mice were challenged with the virulent

B. abortus

2308,

B.

melitensis

16 M, and

B. melitensis

NI. The virulent strains were

recovered from the spleens of the challenged mice, and the results

are presented in

Table 4

.

B. melitensis

16 M-MB6 induced better

protection against the homologous

B. melitensis

16 M and

B.

melitensis

NI challenges than against the heterologous

B. abortus

2308 challenge. The numbers of protection units against the

ho-mologous

B. melitensis

16 M and

B. melitensis

NI challenges were

2.17 and 2.06, respectively, which were significantly higher than

those against the heterologous

B. abortus

2308 challenge (1.08

protection units;

P

0.001). In contrast,

B. abortus

S19-RB6

in-duced greater protection against the homologous

B. abortus

2308

challenge (1.94 protection units) than against the heterogeneous

B. melitensis

16 M and

B. melitensis

NI challenges (1.03 and 0.63

protection units, respectively;

P

0.05).

Pathogenicity of

B. melitensis

16 M-MB6 and

B. abortus

S19-RB6 mutants in pregnant sheep.

The pathogenicity of

Brucella

strains in pregnant ruminants includes persistent infection,

still-birth, and abortion (

26

). In this study, two groups of pregnant

sheep were inoculated with

B. melitensis

16 M-MB6 and

B. abortus

S19-RB6. During nearly 3 months of observation, only one sheep

(S3) aborted at 28 days after infection in the

B. melitensis

16

M-MB6-inoculated group, whereas all four of the other sheep in

this group and all of the

B. abortus

S19-RB6-inoculated sheep

produced normal lambs 40 to 60 days postinoculation. Abortion

was defined as the premature expulsion of a nonviable fetus,

whereas premature live lambs, who were hypoactive and had

dif-ficulty sucking colostrum, were regarded as weak lambs (

27

).

To determine the survival

in vivo

of

B. melitensis

16 M-MB6

and

B. abortus

S19-RB6, bacteria from the maternal sheep, fetus,

and lambs were recovered, and the animals with one or more

isolated

Brucella

colonies in any tissue were considered

bacterio-logically positive. Our results showed that only the afterbirth and

fetus from the aborted sheep in the

B. melitensis

16

M-MB6-inoc-ulated group was positive, and no mutant was recovered from the

lambs and afterbirths of the normal delivered sheep at the time of

euthanasia (

Table 5

). These results indicated that

B. abortus

S19-RB6 was a safe strain for pregnant sheep, whereas

B. melitensis

16

M-MB6 remained somewhat pathogenic in the pregnant sheep.

Antibody responses in

B. melitensis

16 M-MB6- and

B.

abor-tus

S19-RB6-inoculated sheep.

The antibody responses in the

B.

melitensis

16 M-MB6- and

B. abortus

S19-RB6-inoculated sheep

are presented in

Fig. 3

. In sheep inoculated with either

B. melitensis

TABLE 3Protection against challenge withB. abortus2308

Treatment group (n⫽5) Log10CFU in spleen (⫾SD)a UPb

B. melitensis16 M-MB6 3.52⫾0.33c 1.42 B. abortus2308-SB6 4.12⫾0.11c 0.82 B. melitensisNI-NB6 4.04⫾0.05c 0.90

B. abortusS19-RB6 3.41⫾0.36c 1.53

S19 3.29⫾0.32c 1.65

PBS control 4.94⫾0.07

aMean and SD of the log

10CFU per spleen.

b

UP, units of protection. Average of log10CFU in the spleens of PBS-inoculated mice

minus average of log10CFU in the spleens of vaccinated mice.

c

P⬍0.05 (significant) compared with the value for the PBS control group.

TABLE 4Cross-protection ofB. melitensis16 M-MB6 andB. abortus

S19-RB6 against challenge with homologous and heterologous strains in mice

Treatment group (n⫽5) Log10CFU in spleen (⫾SD)

a UPb

16 M challenge

B. melitensis16 M-MB6 3.44⫾0.27c,d 2.17 B. abortusS19-RB6 4.58⫾0.57c,e 1.03

PBS control 5.61⫾0.41

NI challenge

B. melitensis16 M-MB6 3.14⫾0.57c,d 2.06 B. abortusS19-RB6 4.57⫾0.60c,e 0.63

PBS control 5.20⫾0.07

2308 challenge

B. melitensis16 M-MB6 4.79⫾0.11c 1.08 B. abortusS19-RB6 3.93⫾0.12c 1.94

PBS control 5.87⫾0.22

a

Mean and SD of the log10CFU per spleen.

bUP, units of protection. Average of log

10CFU in the spleens of PBS-inoculated mice

minus average of log10CFU in the spleens of vaccinated mice.

cP0.05 (significant) compared with the value for the PBS control in each challenge group.

dP0.001 (significant) compared to the 2308 challenge group in theB. melitensis16 M-MB6-inoculated group.

eP0.05 (significant) compared to the 2308 challenge group in theB. abortus S19-RB6-inoculated group.

on August 17, 2020 by guest

http://cvi.asm.org/

(5)

16 M-MB6 or

B. abortus

S19-RB6, no antibodies against OPS were

detected by the smooth-antigen-based SAT at different time

points postinoculation. However, antibodies against rough

Bru-cella

were detected in the sera of the

B. abortus

S19-RB6- and

B.

melitensis

16 M-MB6-inoculated sheep with 1:25 to 1:50 titers at

15 days postinoculation. The antibody titers peaked at 30 days

postinoculation, with titers ranging from 1:50 to 1:100. At 60

days postinfection, the serum samples from all of the

inocu-lated sheep agglutinated with the rough

Brucella

antigens at

1:25 to 1:50 dilution.

DISCUSSION

In recent decades, numerous rough mutants have been generated

by disrupting LPS synthesis genes, including

wboA

,

wboB

,

wbkA

,

gmd

,

per

,

wzm

,

pgm

,

wa**

, and

manB

core

. However, none of these

artificially constructed rough mutants induced protective

immu-nity equivalent to that of

B. melitensis

Rev.1 in animal models (

28

).

One rough vaccine candidate,

B. melitensis

BmH38R

wbkF

,

in-duced 54% protection, whereas

B. melitensis

Rev.1 afforded 100%

protection in sheep (

16

). The

wboA

-disrupted rough derivative of

B. melitensis

16 M also induced only partial protection against

both infection and abortion following challenges in goats (

17

).

However, the rough vaccine strains RB51 and 45/20 have been

reported to confer long-term protection against brucellosis in

an-imals. Shumilov et al. also reported that an inactivated adjuvant

vaccine prepared from rough

B. abortus

KB 17/100 had superior

immunogenic properties, allowing all vaccinated heifers to resist

experimental infection by a virulent

Brucella

sp. (

3

). As mentioned

above, there are disputes in the

Brucella

vaccine research field over

the feasibility of inducing protective immunity by rough

Brucella

mutants. We hypothesized that the rough vaccine strains should

be acceptable for use in brucellosis eradication campaigns if they

yield good protective immunity for over 6 months.

According to a report by González et al., the genetic

back-ground (i.e.,

B. melitensis

16 M and

B. melitensis

H38) affects the

properties of rough mutants, as

B. melitensis

H38 rough mutants

were more effective vaccine candidates than their

B. melitensis

16

M counterparts in mice (

28

). Thus, when the effective rough

vac-cine candidates were screened, the impact of the genetic

back-grounds of different parent strains on the rough

Brucella

mutants

should be considered. Although the

wboA

mutants have been

eval-uated in the backgrounds of

B. melitensis

,

B. abortus

, and

B. suis

,

different experimental conditions were used. For example, the

inoculation doses were 10

5

CFU/mouse for Nikolich et al. (

29

)

and 1

10

8

to 2

10

8

CFU/mouse for McQuiston et al. and

Monreal et al. (

30

,

31

), whereas the challenge doses were 5

10

4

CFU/mouse for Monreal et al. (

31

) and 1

10

4

CFU/mouse for

González et al. (

28

). There were also variations in the vaccination

time before challenge, e.g., 8 weeks for Winter et al. (

32

) and 4

weeks for Monreal et al. (

31

). Therefore, these variations in

exper-imental conditions pose difficulties in comparing the virulence

and protective immunity conferred by these mutants, leaving

questions about the novel rough vaccines unresolved.

In this study,

B. melitensis

16 M,

B. abortus

2308,

B. abortus

vaccine strain S19, and

B. melitensis

NI were used as the parent

strains for the generation of

wboA

deletion rough mutants. In the

mouse survival assays, the survival times were compared among

the four mutants

B. melitensis

16 M-MB6,

B. abortus

2308-SB6,

B.

abortus

S19-RB6, and

B. melitensis

NI-NB6 (

Fig. 2

).

T-cell-medi-ated immunity has been reported to be the primary mode of

im-mune protection against

Brucella

(

33

35

), and thus, the rough

FIG 2Kinetics ofB. abortusS19-RB6,B. abortus2308-SB6,B. melitensisNI-NB6, andB. melitensis16 M-MB6 (A) and the parent strainsB. abortusS19 and 2308 andB. melitensisNI and 16 M (B) in mice. Twenty-five mice were inoculated with each strain at a dose of 106CFU/mouse. Five mice per group were euthanized at 1, 3, 6, 9, and 11 weeks postinoculation, and the virulence of each strain was determined based on the number of CFU recovered from the spleen, which is expressed as the mean⫾SD (n⫽5) of individual log10CFU/spleen.

TABLE 5Pathogenicity of the rough mutants in pregnant sheep

Pregnant sheep no.

Sheep culture resultsa Fetus or lamb status

Delivery time (days p.i.)b

Afterbirths Tissues

Birth no.

and status Tissuesa

B. melitensis16 M-MB6-inoculated group

S1 ⫺ ⫺ 2 healthy ⫺ 49

S3 ⫹ ⫺ 1 aborted ⫹ 28

S5 ⫺ ⫺ 2 healthy ⫺ 45

S7 ⫺ ⫺ 1 healthy ⫺ 54

S9 ⫺ ⫺ 3 healthy ⫺ 52

B. abortusS19-RB6-inoculated group

S2 ⫺ ⫺ 2 healthy ⫺ 43

S4 ⫺ ⫺ 1 healthy ⫺ 50

S6 ⫺ ⫺ 1 healthy ⫺ 55

S8 ⫺ ⫺ 2 healthy ⫺ 48

S10 ⫺ ⫺ 2 healthy ⫺ 45

aIsolation of1 CFUBrucellafrom any tissue indicated that the animal was positive (⫹). Samples designated negative (⫺) indicate that the organism was not cultured from the tissue.

b

p.i., postinoculation.

on August 17, 2020 by guest

http://cvi.asm.org/

(6)

mutants that persisted for the longest time in the vaccinated

ani-mals were expected to be the best vaccine candidates. However,

B.

abortus

2308-SB6, with the longest survival time of all the mutants,

conferred the worst protection against

B. abortus

2308 challenge

in mice. In contrast,

B. abortus

S19-RB6 was cleared from mice in

less than 6 weeks but yielded relatively good protection. These

results suggest that the protective efficacy of rough

wboA

deletion

mutants is less closely associated with their survival time in mice

but more closely associated with the genetic background of the

parent strain. Moreover,

B. melitensis

16 M-MB6 and

B. abortus

S19-RB6 yielded better protection against challenge with

B.

abor-tus

2308 than

B. abortus

2308-SB6 and

B. melitensis

NI-NB6,

sug-gesting that not all

B. abortus

-derived rough mutants could

in-duce similar protective immunity against homologous

challenge to

B. abortus

2308. Therefore, it will be necessary to

screen the parent strains for novel rough

Brucella

vaccine

de-velopment in the future.

In the cross-protection assay,

B. melitensis

16 M-MB6 and

B.

abortus

S19-RB6 were selected for use in both homologous and

heterologous challenges, because they yielded better protection

than the other two mutants in the protective-efficacy assay.

How-ever, both

B. melitensis

16 M-MB6 and

B. abortus

S19-RB6 yielded

only somewhat greater protection against homologous challenges

than against heterologous challenges. A similar phenomenon was

also observed by Winter in the evaluation of the protective efficacy

of

B. melitensis

VTRM1 and

B. suis

VTRS1 (both

wboA

-disrupted

mutants) in mice (

32

). Moreover,

B. abortus

RB51 has been

re-ported to induce good protective immunity against

B. abortus

in

cattle (

36

), but it is not effective against

B. suis

infection in cattle

(

37

) and ovine brucellosis caused by either

B. melitensis

or

B. ovis

(

38

,

39

). Similar to the smooth vaccine strains, such as

B. abortus

S19 (which failed to protect heifers against experimental infection

with

B. suis

biovar 1 [

40

]), the rough

Brucella

mutants had

differ-ences in cross-protective immunity.

The results of pathogenicity examination indicated that not all

of the

Brucella

spp. could be used as parent strains for generating

safe vaccines. For instance,

B. abortus

S19-RB6, which was derived

from the vaccine strain

B. abortus

S19, exhibited a high level of

safety in pregnant sheep. However, the inoculation of pregnant

sheep with

B. melitensis

16 M-MB6 induced abortion in one of the

five animals in this study, suggesting that this rough mutant was

still somewhat pathogenic to pregnant animals. Since the

glyco-syltransferase encoded by

wboA

is responsible for OPS

polymer-ization, we hypothesized that there are components other than

OPS associated with the pathogenicity of

Brucella

in pregnant

an-imals. In support of this hypothesis, available

Brucella

vaccines,

such as

B. abortus

S19 and

B. melitensis

Rev.1, are attenuated

in

vivo

but induce abortion when they are subcutaneously inoculated

into pregnant animals, and a naturally occurring rough virulent

strain,

Brucella ovis

, can induce abortion in ewes (

41

). As the

transplacental transmission mechanism of

Brucella

is not clearly

understood, it is necessary to identify factors affecting the

preva-lence of abortion for the development of safer

Brucella

vaccines.

Therefore, in specific regions and countries, the generation of a

good rough vaccine may depend on the genetic backgrounds of

the parent strains and/or the epidemic

Brucella

strains, as each

vaccine provides effective protection against a specific

Brucella

species in the preferred host (

14

).

In conclusion, there were noticeable differences in virulence,

pathogenicity, and induced immunity protection among the four

wboA

deletion mutants generated from different parent strains

with diverse genetic backgrounds. Although the

wboA

mutants

were not ideal vaccine candidates in this study, our results

sug-gested that it is necessary to consider the parent strains (the

refer-ence strains or the epidemic

Brucella

strains in the different animal

herds), as well as the desired target genes, when developing novel

rough

Brucella

vaccines.

ACKNOWLEDGMENTS

We thank Qianni He from the Institute of Veterinary Research, Xinjiang Academy of Animal Sciences, China, for kindly providing us withBrucella

strains.

This work was supported by the National Basic Research Program of China (973 Program; 2010CB530202), the Special Fund for Agro-Scien-tific Research in the Public Interest (200903027), and the Beijing Science Foundation of China (project no. 6101002).

REFERENCES

1.Corbel MJ.1997. Brucellosis: an overview. Emerg. Infect. Dis.3:213–221. 2.Rice TB.1946. Brucellosis in human beings. Mon. Bull. Indiana State

Board Health49:125.

3.Shumilov KV, Sklyarov O, Klimanov A.2010. Designing vaccines against cattle brucellosis. Vaccine28(Suppl. 5):F31–F34.

4.Alton GG.1968. Further studies on the duration of the immunity pro-duced in goats by the Rev. 1 Brucella melitensis vaccine. J. Comp. Pathol.

78:173–178.

5.Alton GG.1990. Brucella melitensis, p 384 – 410.InNielsen K, Duncan JR (ed), Animal brucellosis. CRC Press, Boca Raton, FL.

6.Nicoletti P.1990. Vaccination, p 284 –299.InNielsen K, Duncan JR (ed), Animal brucellosis. CRC Press, Boca Raton, FL.

FIG 3Antibody responses in sheep subcutaneously infected with 109CFUB. abortusS19-RB6 (A) andB. melitensis16 M-MB6 (B). The titers of specific anti-smooth and -rough antigens were determined by SAT as described in Materials and Methods. The horizontal bars represent the average titer value for each group. *,P⬍0.05, and **,P⬍0.001; the rough-antigen-based SAT results were compared with the smooth-antigen-based SAT results for each mutant group.

on August 17, 2020 by guest

http://cvi.asm.org/

(7)

7.Alton GG, Elberg SS.1967. Rev. 1 Brucella melitensis vaccine: a review of ten years of study. Vet. Bull.371:793– 800.

8.Blasco JM.1997. A review of the use of Brucella melitensis Rev. 1 vaccine in adult sheep and goats. Prev. Vet. Med.31:275–283.

9.Office International des Epizoonties.2004. Manual of diagnostic tests and vaccines for terrestrial animals, 5th ed. Office International des Epizooties, Paris, France.

10. Cheville NF.2000. Development, testing and commercialization of a new brucellosis vaccine for cattle. Ann. N. Y. Acad. Sci.916:147–153. 11. Schurig GG, Roop RM, II, Bagchi T, Boyle S, Buhrman D,

Sriranga-nathan N.1991. Biological properties of RB51; a stable rough strain of Brucella abortus. Vet. Microbiol.28:171–188.

12. Schurig GG, Sriranganathan N, Corbel MJ.2002. Brucellosis vaccines: past, present and future. Vet. Microbiol.90:479 – 496.

13. Adone R, Francia M, Ciuchini F.2008. Evaluation of Brucella melitensis B115 as rough-phenotype vaccine against B. melitensis and B. ovis infec-tions. Vaccine26:4913– 4917.

14. Adone R, Francia M, Pistoia C, Pesciaroli M, Pasquali P. 2011. B. melitensis rough strain B115 is protective against heterologous Brucella spp. infections. Vaccine29:2523–2529.

15. Moriyón I, Grilló MJ, Monreal D, González D, Marín C, López-Goñi I, Mainar-Jaime RC, Moreno E, Blasco JM.2004. Rough vaccines in animal brucellosis: structural and genetic basis and present status. Vet. Res.35:1–38.

16. Barrio MB, Grilló MJ, Muñoz PM, Jacques I, González D, de Miguel MJ, Marín CM, Barberán M, Letesson JJ, Gorvel JP, Moriyón I, Blasco JM, Zygmunt MS.2009. Rough mutants defective in core and O-polysac-charide synthesis and export induce antibodies reacting in an indirect ELISA with smooth lipopolysaccharide and are less effective than a Rev. 1 vaccine against Brucella melitensis infection of sheep. Vaccine27:1741– 1749.

17. Elzer PH, Enright FM, McQuiston JR, Boyle SM, Schurig GG.1998. Evaluation of a rough mutant ofBrucella melitensisin pregnant goats. Res. Vet. Sci.64:259 –260.

18. Kovach ME, Phillips RW, Elzer PH, Roop RM, II, Peterson KM.1994. pBBR1MCS: a broad-host-range cloning vector. Biotechniques16:800 – 802.

19. Murphy KC, Campellone KG, Poteete AR.2000. PCR-mediated gene replacement in Escherichia coli. Gene246:321–330.

20. Kahl-McDonagh MM, Ficht TA.2006. Evaluation of protection afforded by Brucella abortus and Brucella melitensis unmarked deletion mutants exhibiting different rates of clearance in BALB/c mice. Infect. Immun.

74:4048 – 4057.

21. Alton GG, Jones LM, Pietz DE.1975. Laboratory techniques in brucel-losis. Monogr. Ser World Health Organ.1975:1–163.

22. Briones G, IÑón de Iannino N, Roset M, Vigliocco A, Paulo PS, Ugalde RA.2001. Brucella abortus cyclic beta-1,2-glucan mutants have reduced virulence in mice and are defective in intracellular replication in HeLa cells. Infect. Immun.69:4528 – 4535.

23. Kahl-McDonagh MM, Elzer PH, Hagius SD, Walker JV, Perry QL, Seabury CM, den Hartigh AB, Tsolis RM, Adams LG, Davis DS, Ficht TA.2006. Evaluation of novel Brucella melitensis unmarked deletion mu-tants for safety and efficacy in the goat model of brucellosis. Vaccine24: 5169 –5177.

24. Elfaki MG, Al-Hokail AA, Nakeeb SM, Al-Rabiah FA.2005. Evaluation of culture, tube agglutination, and PCR methods for the diagnosis of bru-cellosis in humans. Med. Sci. Monit.11:MT69 –MT74.

25. Ugalde JE, Comerci DJ, Leguizamón MS, Ugalde RA.2003. Evaluation of Brucella abortus phosphoglucomutase (pgm) mutant as a new live rough-phenotype vaccine. Infect. Immun.71:6264 – 6269.

26. Carvalho Neta AV, Mol JP, Xavier MN, Paixão TA, Lage AP, Santos RL.

2010. Pathogenesis of bovine brucellosis. Vet. J.184:146 –155.

27. Xavier MN, Paixão TA, Poester FP, Lage AP, Santos RL.2009. Patho-logical, immunohistochemical and bacteriological study of tissues and milk of cows and fetuses experimentally infection. J. Comp. Pathol.140: 149 –157.

28. González D, Grilló MJ, De Miguel MJ, Ali T, Arce-Gorvel V, Delrue RM, Conde-Alvarez R, Muñoz P, López-Goñi I, Iriarte M, Marín CM, Weintraub A, Widmalm G, Zygmunt M, Letesson JJ, Gorvel JP, Blasco JM, Moriyón I. 2008. Brucellosis vaccines: assessment of Brucella melitensis lipopolysaccharide rough mutants defective in core and O-po-lysaccharide synthesis and export. PLoS One3:e2760. doi:10.1371/journal .pone.0002760.

29. Nikolich MP, Warren RL, Lindler LE, Izadjoo MJ, Hoover DL.2010. Attenuation of defined Brucella melitensis wboA mutants. Vaccine

28(Suppl. 5):F12–F16.

30. McQuiston JR, Vemulapalli R, Inzana TJ, Schurig GG, Sriranganathan N, Fritzinger D, Hadfield TL, Warren RA, Lindler LE, Snellings N, Hoover D, Halling SM, Boyle SM.1999. Genetic characterization of a Tn5-disrupted glycosyltransferase gene homolog inBrucellaabortus and its effect on lipopolysaccharide composition and virulence. Infect. Im-mun.67:3830 –3835.

31. Monreal D, Grilló MJ, González D, Marín CM, De Miguel MJ, López-Goñi I, Blasco JM, Cloeckaert A, Moriyón I.2003. Characterization of

Brucellaabortus O-polysaccharide and core lipopolysaccharide mutants and demonstration that a complete core is required for rough vaccines to be efficient againstBrucellaabortus andBrucellaovis in the mouse model. Infect. Immun.71:3261–3271.

32. Winter AJ, Schurig GG, Boyle SM, Sriranganathan N, Bevins JS, En-right FM, Elzer PH, Kopec JD.1996. Protection of BALB/c mice against homologous and heterologous species ofBrucellaby rough strain vaccines derived fromBrucellamelitensis andBrucella suisbiovar 4. Am. J. Vet. Res.

57:677– 683.

33. Collins FM.1974. Vaccines and cell-mediated immunity. Bacteriol. Rev.

38:371– 402.

34. Jiang X, Baldwin CL.1993. Effects of cytokine on intracellular growth of Brucella abortus. Infect. Immun.61:124 –134.

35. Ko J, Splitter GA.2003. Molecular host-pathogen interaction in brucel-losis: current understanding and future approaches to vaccine develop-ment for mice and humans. Clin. Microbiol. Rev.16:65–78.

36. Olsen SC, Bricker B, Palmer MV, Jensen AE, Cheville NF. 1999. Responses of cattle to two dosages of Brucella abortus strain RB51: serol-ogy, clearance and efficacy. Res. Vet. Sci.66:101–105.

37. Olsen SC, Hennager SG.2010. Immune response and protection against experimental Brucella suis biovar 1 challenge in non-vaccinated or RB51-vaccinated cattle. Clin. Vaccine Immunol. doi:10.1128/CVI.00326-10. 38. El Idrissi AH, Benkirane A, El Maadoudi M, Bouslikhane M, Berrada J.,

Zerouali A.2001. Comparison of the efficacy ofBrucella abortusstrain RB51 andBrucella melitensisRev. 1 live vaccines against experimental infection withBrucella melitensisin pregnant ewes. Rev. Sci. Tech.20:741– 747.

39. Jiménez de Bagüés MP, Barberán M, Marín CM, Blasco JM.1995. The

Brucella abortusRB51 vaccine does not confer protection against Brucella ovis in rams. Vaccine13:301–304.

40. National Veterinary Services Laboratory.2010. Standard operating pro-cedures. SOP-Sero-1022, -1024, -1025, -1026, -1027, and -1051. National Veterinary Services Laboratory, Ames, IA.

41. Libal MC, Kirkbride CA.1983. Brucella ovis-induced abortion in ewes. J. Am. Vet. Med. Assoc.183:553–554.

on August 17, 2020 by guest

http://cvi.asm.org/

Figure

TABLE 1 Bacterial strains and plasmids
FIG 1 PCR identification of B. abortus 2308-SB6 (A), B. abortus S19-RB6 (B), B. melitensis 16 M-MB6 (C), and B
TABLE 4 Cross-protection of B. melitensis 16 M-MB6 and B. abortusS19-RB6 against challenge with homologous and heterologous strains inmice
TABLE 5 Pathogenicity of the rough mutants in pregnant sheep
+2

References

Related documents

The sensitivity analysis by changing the pseudo tenure to real tenure based on Fitriany (2011) that after the enactment of the regulation of the PAF rotation, there are PAFs

Мөн БЗДүүргийн нохойн уушгины жижиг гуурсанцрын хучуур эсийн болон гөлгөр булчингийн ширхгийн гиперплази (4-р зураг), Чингэлтэй дүүргийн нохойн уушгинд том

19% serve a county. Fourteen per cent of the centers provide service for adjoining states in addition to the states in which they are located; usually these adjoining states have

Field experiments were conducted at Ebonyi State University Research Farm during 2009 and 2010 farming seasons to evaluate the effect of intercropping maize with

The paper is discussed for various techniques for sensor localization and various interpolation methods for variety of prediction methods used by various applications

In theory, FRET is a radiationless energy transfer process, so ideally, a single emission spectrum of the output fluorophore should be observed, as illustrated in Fig.2.7

National Conference on Technical Vocational Education, Training and Skills Development: A Roadmap for Empowerment (Dec. 2008): Ministry of Human Resource Development, Department

Results suggest that the probability of under-educated employment is higher among low skilled recent migrants and that the over-education risk is higher among high skilled