Relationship of the CD5 B cell to human
tonsillar lymphocytes that express
autoantibody-associated cross-reactive
idiotypes.
T J Kipps, S F Duffy
J Clin Invest.
1991;
87(6)
:2087-2096.
https://doi.org/10.1172/JCI115239
.
We examined human tonsillar B cells for expression of autoantibody heavy-chain or kappa
light-chain cross-reactive idiotypes (CRIs), respectively defined by murine MAbs G6 or
17.109. We find 17.109 or G6 each specifically binds a subpopulation of B cells,
respectively reacting with 3.8 +/- 3% (mean +/- SD) or 2.0 +/- 1.2% of all tonsillar
lymphocytes. Cells reactive with both 17.109 and G6 comprise only 0.4 +/- 0.3% of tonsillar
lymphocytes. Although each tested specimen had 17.109-positive cells, 2 of 19 tonsils
(11%) did not have any G6-reactive cells. We find that CRI-positive cells and CD5 B cells
both co-express slgD but fail to bind peanut agglutinin or MAbs specific for CD10, indicating
that both cell types reside in the mantle zones of secondary B cell follicles. However, less
than half of the B cells bearing one or both of these CRIs express detectable levels of CD5.
Nevertheless, we find that G6-reactive lymphocytes constitute a multiclonal population of
cells that express homologous heavy chain variable region genes, each rearranged to one
of several distinct and apparently nonmutated D and JH gene segments. Collectively, these
studies indicate that expression of nondiversified autoantibody-encoding variable region
genes may not be an exclusive property of B cells that bear detectable levels of the CD5
surface antigen.
Research Article
Find the latest version:
Relationship
of
the
CD5 B
Cell
to
Human
Tonsillar
Lymphocytes
That Express
Autoantibody-associated
Cross-reactive
Idiotypes
Thomas J.Kippsand Stuart F.Duffy
Department ofMedicine, University of California, San Diego, La Jolla, California 92093-0945
Abstract
Weexamined humantonsillarB cellsforexpressionof autoan-tibody
heavy-chain
or kappa light-chain cross-reactive idio-types(CRIs),
respectively defined by murine MAbs G6 or17.109. Wefind 17.109orG6 each specifically binds a sub-population of B cells, respectively reacting with 3.8±3% (mean±SD) or 2.0±1.2% of all tonsillar lymphocytes. Cells reactive with both 17.109andG6 comprise only 0.4±0.3% of tonsillar lymphocytes. Although each tested specimen had 17.109-positive cells, 2of 19 tonsils(11%) did nothave any
G6-reactive
cells. WefindthatCRI-positive
cells and CD5 B cells both co-expressslgDbutfail to bind peanutagglutininorMAbsspecificforCD10, indicatingthat both cell typesreside inthe mantle zonesofsecondary B cellfollicles.However, less than half ofthe B cellsbearingone or both of these CRIs
ex-press detectable levelsof CD5. Nevertheless,wefindthat G6-reactive lymphocytes constitute a multiclonal population of cells that express homologous heavy chain variable region genes, eachrearrangedtooneof several distinctandapparently nonmutated D and JH gene segments.Collectively,these stud-iesindicatethatexpression of nondiversified autoantibody-en-codingvariableregiongenes may not be anexclusiveproperty ofBcells that beardetectablelevelsofthe CD5 surface
antigen.
(J. Clin. Invest. 1991.
87:2087-2096.) Key
words: autoanti-body * CD5 B cell *cross-reactiveidiotype-V geneexpressionIntroduction
MalignantBcellsfrompatients with chronic lymphocytic leu-kemia
(CLL)'
or small lymphocytic lymphoma (SLL) fre-quently express antibodies bearing cross-reactive idiotypes (CRIs) associated withIgMautoantibodies.Inastudyofover 30 CLLpatients, one-fourth ofthepatients withkappa light chain-expressing leukemia cells had malignant lymphocytes thatexpressedaCRIdefined by reactivity withaMAb, desig-nated17.109(1). Thisantibody,preparedagainstanIgMrheu-Addressreprintrequests to Dr. Kipps, Department of Medicine,
Uni-versityof California,SanDiego,La Jolla, CA 92093-0945.
Receivedfor publication5November 1990 and in revised form 4
February1991.
1.Abbreviations used in this paper: APC, allophycocyanin; CD, cluster of differentiation antigen; CDR, complementarity determiningregion;
CLL, chronic lymphocytic leukemia; CRI, cross-reactive idiotype;D,
diversity;FR, antibody variable region framework; JH, heavy-chain
joining region; PCR, polymerase chain reaction;PE, phycoerythrin;
PNA, peanutagglutinin;RF, rheumatoidfactor;VHgene, heavy chain
variable regiongene; VK gene, kappa light chain variable region gene.
matoid factor (RF) recognizesakappa
light
chain-associated CRIpresent on manyIgMparaproteins
withRFactivity (2, 3).
Furthermore, nearly
one-fifth
of all surfaceIg-expressing
CLL werefoundtoreactwith G6 (4). This MAb isspecific
foranIg
heavy
chain-associated
CRI present on several RF parapro-teins (5).Interestingly,
nearly half of the CLLcaseswith leuke-miacellsreactive with 17.109 also reacted withG6, reflecting
abiased
co-expression
of these CRIs (4,6).
Evaluation of the molecular
basis
for these CRIs in CLL revealed that each is a serologic marker forexpression
ofaconserved immunoglobulinV
gene(s)
with littleor nosomatic mutation. The 17.109-reactive neoplastic B cellsfrom unre-lated patientsexpressnearly identical kappalight
chain vari-ableregiongenes(VK genes)thatbelongtotheVKIIIb sub-sub-group(7, 8). Finally, thesequencesof the VKgenesexpressed
by 17.109-reactive leukemia cells share>99%nucleic acid
se-quence homology with a
germline
VKIII geneisolated from placentalDNA,designatedHumkv325
(9).Similarly,
G6-reac-tive leukemia cells from unrelated patientsexpress homolo-gousheavy chain variableregion
genes(VHgenes)
of the VH1 subgroup (10).Moreover,comparisons
of the deduced amino acidsequences of G6-reactive CLL and that ofG6-negative
antibody heavy chains encoded by VH1 genes suggestthat the G6-CRI in CLL is relatively resilientto substitutions within complementarity determining
region
3(CDR3), butaffected bypermutations
withinCDR1and CDR2.Together these data arguethattheG6-CRIinCLL isaserologic marker fora con-served VH1 gene alsoexpressed with littleor nosomatic muta-tion.Conceivably, the
frequent expression
of theseautoanti-body-associated CRIsinCLLorSLL mayreflecttherepertoire ofthe presumed normal cellcounterpart tothesemalignancies, namely the clusterof differentiation antigen 5 (CD5) B cell. CD5Bcellsconstituteasmallsubpopulation of humanB lym-phocytes in lymphoid organs andperipheral blood ofnormal adults( 1-15). Thesecellscomprisethemajority ofBcellsin theprimary follicles of human fetalspleen(16, 17),wherehigh proportions ofcells express these CRIs (18). Finally, CD5 B lymphocyteshave been reported to include nearly all the cells thatspontaneously produce IgM autoantibodies (19, 20), in-cludingRF. Asnoted,IgMautoantibodies frequentlybear the 17.109 CRI or the G6 CRI (3, 5, 21). Also, IgM molecules co-expressing both CRIs almost invariablyhave RFactivity (22).However, therelationshipbetween CD5 B cells and non-malignant B cells that co-express autoantibody-associated CRIshas not been evaluated. Accordingly,weexamined hu-man tonsillar lymphocytes to determine the prevalence and surface antigen phenotype ofthe Bcellsthatbear the 17.109 and/ortheG6 CRI.
Methods
Patientmaterials. Weobtained freshresidual lymphoid material from
patients (ages 7-69, mean 26yr) undergoing surgical tonsillectomy
J.Clin. Invest.
©TheAmericanSocietyfor ClinicalInvestigation,Inc.
0021-9738/91/06/2087/10 $2.00
(TableI). Sections of each tonsil were frozen at -700C for immunohis- Chromaprobe Immunological) as described (1). Biotinylated antibod-tochemical analysesasdescribed (4, 23). A single-cell suspension was ies used to stain cells for three- or four-color immunofluorescence anal-madefrom the remainder of each specimen. Mononuclear cells were yses were developed with Texas Red-avidin (Molecular Probes, Inc.). isolated on density gradients of Ficoll-Hypaque, washed in Hanks' bal- Fluorescein-conjugated peanutagglutinin(FITC-PNA) was obtained ancedsaltsolution and then suspended in FCS containing 10% dimeth- from Vector Laboratories, Inc., Burlingame, CA. With the exception of ylsufoxide (Sigma Chemical Co., St. Louis, MO), for storage in liquid PE or APC-labeled MAbs, all reagents were spun at 100,000gfor 15 nitrogen. Viability of recovered cells exceeded 90% before analyses. min before use.
Antibodies andfluorescenceprobes. G6, a murine
IgG,
MAb reac- Flow cytometric analyses. Three- and four-color flow cytometrictive with aautoantibodyheavychain-associated CRI (5) was provided analyses were performed using a FACScan (Becton, Dickinson & Co.,
byDrs.RizgarMageed and RoyJefferis(University of Birmingham, San Jose, CA) equipped with Consort30 (Hewlett-Packard Co., Palo Birmingham, England). We obtained an IgG1 MAb specific for a Alto, CA) or a dual laser FACStarP` (Becton Dickinson & Co.)
VKIIIbsubgroup determinant(s) (24), from Dr. George Abraham (Uni- equipped with a MicroVAX computer (Digital Equipment Corp., versityofRochester, Rochester, NY). MAb 17.109 is as described (2). Marlboro, MA), asdescribed (30). The latter allowed for use ofElectric
Fluorochrome-conjugated MAbs specific for CDIO (CALLA), and Desksoftware (Dr. R. Hardy, Fox Chase Cancer Center, Philadelphia, CDl9(Leu 12)werepurchasedfromBecton-Dickinson Immunocy- PA). Unless otherwise indicated, cells were labeled with
fluorochrome-tometrySystems, San Jose, CA. Hybridomas obtained from the Ameri- conjugated MAbs and reagents in staining medium consisting of bio-canType Culture Collection, Rockville,MDwereOKT3, an IgG2. tin-deficientRPMI-1640 (Irvine Scientific, Santa Ana, CA), 3% FCS
anti-CD3 (25), DA4-4, anIgG, anti-human mu heavychain(26), (Gibco Laboratories, Grand Island, NY), and 50 mM Hepes (Irvine dTA4- 1,anIgG3 anti-human delta heavy chain (27), and THB-5, an Scientific),pH7.6. Although viability of the analyzed cell populations
IgG2,anti-CD21 (C3dR) (28).SC-l anIgG2,MAbreactive withhu- generally exceeded 90%, cells were stained also with propidium iodide
manCD5 (29), was provided by Dr. Robert Fox (Scripps Clinic and (1
;&g/ml)
toallow us to discriminate between living and dead cells ResearchFoundation, La Jolla, CA). Anti-human kappa or anti-hu- duringFACScan analysis (30).manlambdaMAb-producinghybridomas were as described (1, 7).An- IsolationofG6-reactive cells. Tonsillar lymphocytes, 108, from ton-tibodieswerepurified from ascitesviaprecipitationwith ammonium silno.7(Table I),wereincubatedwithFITC-conjugated G6 for 30 min
sulfateandeitherabsorptionwith quartenaryaminoethyl(Pharmacia at4°C, washed,and thenincubated with 1.6 x 107 anti-mouse IgG FineChemicals,Uppsala, Sweden) or Protein ASepharose column magnetic microspheres(Dynabeads, Dynal, Inc., Oslo, Norway) for 1 h
chromatography (BioRad Laboratories, Richmond, CA).Purified anti- at4°Cwithgentleagitation.FACscan analysesof the G6-labeled cell
bodieswereconjugatedwitheitherfluorescein isothiocyanate (FITC; population beforeaddition of themagneticbeads demonstrated 4.1% Molecular Probes, Inc., Eugene, OR), normal human serum-biotin of the cellsdisplayed brightgreenfluorescencewhenexcited at 488 nm
(PierceChemical Co.,Rockford, IL), R-phycoerythrin(PE; Chroma- (TableI).Magneticbead-bound cellswereisolated by twice decanting probeImmunological,RedwoodCity,CA),orallophycocyanin (APC; the cellsuspensionin the presence ofastrongmagneticfield. FACScan
TableI.LymphocyteSubpopulationsin Human Tonsil
Sampleno. Sex Dx Patient age CD3 CD5 CD19 CD5 B IgM IgD K L 17.109 VK3b G6 G6/17.109
yr %
I M CT 16 4 27 97 21 76 74 49 41 4.2 6.1 3.4 0.2
2 F CT 20 6 25 93 16 75 69 51 38 6.3 9.1 4.5 0.7
3 M AT 22 26 31 73 2 58 54 39 30 4.4 5.5 2.0 1.0
4 F AT 20 15 29 78 13 45 29 50 33 1.3 2.2 0.8 0.1
5 F AT 7 39 44 64 3 59 42 40 30 4.0 4.3 1.5 0.5
6 M CT 41 22 29 77 6 55 45 44 31 5.1 5.5 2.5 0.2
7 M CT 32 19 50 74 31 54 50 44 31 5.1 7.8 4.1 0.8
8 M OSA 69 34 40 64 5 33 30 34 28 2.9 3.0 1.6 0.2
9 F AT 19 49 55 45 10 24 19 20 19 3.3 ND 1.2 0.2
10 M CT 41 18 32 62 12 59 54 40 23 2.4 2.6 0.0 0.0
11 M CT 27 32 35 63 2 36 23 26 28 3.1 ND 2.2 0.2
12 F CT 17 52 55 44 6 22 19 21 17 2.9 3.1 2.2 0.3
13 M CT 24 14 26 87 11 48 36 42 38 3.7 ND 2.0 0.5
14 F AT 4 13 36 77 26 62 59 40 39 4.6 5.8 1.8 0.3
15 M CT 30 19 28 77 12 64 59 44 35 3.4 5.9 3.4 0.3
16 M OSA 42 11 29 91 18 69 71 51 37 6.0 ND 0.0 0.0
17 F CT 21 27 47 71 17 48 45 40 30 2.6 5.6 2.3 0.2
18 M AT 14 4 40 97 36 83 83 62 31 4.3 ND 2.7 0.3
19 M CT 21 38 44 55 8 31 28 30 22 3.9 5.0 3.3 0.7
Average 26 23 37 73 13 52 47 40 30 3.9 5.1 '2.2 0.4
SD 15 14 10 16 10 18 19 11 7 1.2 2.0 1.2 0.3
Inthe column labeled "Dx"arethediagnoses underlyingthe medicalindicationfortonsillectomy:AT,acutetonsillitis(history<6mo);CT,
chronicorrecurrenttonsillitis;andOSA,obstructivesleepapnea. In the column labeled"patient age"arethe ages of thepatientsfrom whom
biopsyspecimenswereobtained. Values inremainingcolumns indicate the percentagesofcellsthat have the surfaceantigen phenotypelisted
atthe top of each column. Below each columnarethemeanpercentages(average)andstandard deviations of themean(SD)of the values in each column.ND,notdone.
analysisdemonstrated thedecanted cell populationdid notcontain
anyresidual labeled cells.Cellsadheringtothe tubewallinthe presence of the magnetwererecovered, washed inRPMI-1640,and then used as the source ofG6-positivecells. DNAwasisolated fromG6-positive
cellsasdescribed(8,10),except thatsubsequenttodigestionwith Pro-teinase-K,themagneticbeadswereremovedfromthepreparation by
1-min centrifugationat13,000 g.
Polymerase chainreaction(PCR)amplification ofgenomic DNA.
PCR wasperformedon 1 Agof DNA isolated fromG6-positivecells
using Taqpolymerase(31) (Cetus Corp.,Emoryville, CA)and primers
thatcorrespondtothesensestrandofasequencecommontothe leader
sequence of allVHl genes
[dGTTCHTCACCATGGACTGGACTG,
H=A/C/TJ and to the anti-sense strand of a JH consensus
[dCCTGAGGAGACMGTGACC, M=C/T],asdescribed
(10).
Atthe5'endof eachprimer, restriction sitesfor HindIllorEcoRI, respec-tively,wereaddedtofacilitatecloningof theamplifiedgenefragments.
After 30 cycles ofPCR,theamplifiedgenefragmentwasdigestedwith
EcoRIandHindIII,purifiedvia agarosegelelectrophoresis,andthen
cloned intoaHindIII/EcoRI-digested pUC19vector
(Bluescribe,
Stra-tagene, LaJolla,CA)for transformation into competent XL-1 Blue (Stratagene). Coloniescontaining plasmidswithrecombinantinserts
wereidentifiedasdescribed(7, 10).PlasmidDNAcontaining amplified
recombinant insert DNA was isolated for double-stranded DNA
se-quencingasdescribed (32). Inaddition, 1/20thof the PCR reaction mixture was analyzed by the method of Southern, as described (8).
Oligonucleotideprobescorrespondingtotheanti-sense of a sequence in the second complementarity determining region (G6-CDR2)
[dGCGTAGTTTGCTGTACC]
or to the anti-sense of a sequence in the second framework region (VHI-FR2)[dCCATCCACT-CAAGCCCJof the VHI gene expressed by G6-reactive CLL(10)were usedtoprobe thefilter-immobilizedDNA.Oligonucleotide synthesis, labeling, hybridization, and washing conditions were as described (1), with afinal 1-minwashing temperature of
490C.
For DNA sequence analyses, weusedtheGenetics Computer Group Sequence Analysis Software Packageon aVAX750mainframe computer.Results
Multiparameter
flowcytometricanalyses of tonsillar lympho-cytes. We examined the lymphocytes from 19 tonsils usingmultiparameter
flow cytometric analyses. Althoughmost speci-mens werefrom youngadultswithacute orchronic tonsillitis, two surgical specimens(nos. 8 and 16in TableI)
were from patients with obstructive sleep apnea that required tonsillec-tomy toameliorate
partialupperairway obstruction.Wecould notdiscernanyconsistent phenotypic difference between these twoandthe other lymphocyte populations (TableI).
The pro-portion ofCDI9-positiveBcells (73±16%;mean±standard de-viation) generally exceededtheproportion of CD3-positiveT cells(23±14%) by twofold (Table I).Wereadily detected CD5 B cellsin each tonsil specimen (Table I). The proportion of CD5B cells wascalculatedas the percentage ofBcells labeled witha
fluorochrome-labeled
anti-CD5 MAb minus thebackground percentage (< 0.5%) of B cells stained with afluorochrome-labeled
anti-CD3 MAb of the samemouseIgisotype. Similarto thevariationnoted in the proportions ofB cellsexpressingCD5 in theperipheral blood of young healthyadults(15),
theproportionsoftonsillar lym-phocytesthatco-expressedCD5 and pan-Blymphocyte surfaceantigens
ranged from2% to36% ofthe totallymphocytesor from 3%to 42% ofthe total B cells (Table I).We examined tonsillar lymphocytes for reactivity with 17.109 orG6. With few exceptions, each tonsil contained a subpopulation of CRI-positive B cells that expressed the 17.109
and/or
theG6 CRI(Table
I).
Cellsbearing
either CRIuniformly
expressed
B celldifferentiationantigens
CDl9 and CD21(data
notshown). Lymphocytes
thatbound17.109com-prised
asubpopulation
ofB cells thatexpressed
kappa
light
chainof theVKIIIb subgroup.
Theproportion
of17.109-posi-tive cells
ranged
from 1.3%to6.3%(m
=3.9±1.2%)
ofthe totallymphocytes,
from 3%to16%(m
=10±3%)
ofthekappa
light
chain-bearing cells,
andfrom 46%to97%(m
=77±16%)
ofthe cellsexpressing kappa light
chains of theVKIIIb subgroup
(Ta-ble
I). Except
in tonsilspecimens
fromtwoindividuals,
G6-pos-itivecells
expressed
eitherkappa
orlambdalight
chains andcomprised
0. 1-4.5%(m
=2.1±1.2%)
ofthe totallymphocytes.
Cells
expressing
both the17.109andG6CRIcomprised
avery smallsubpopulation
constituting
<0.1-1%(m
=0.4±0.3%)
of thetotallymphocyte population (Table I).
Tonsillarlympho-cytes fromtwoindividuals
(nos.
10 and 16 in TableI)
didnotpossess any cells that
expressed
detectable levelsoftheG6-CRI(Table
I).
Immunohistochemicalanalysis
offreshfrozen tissue sections of these two tonsilspecimens
confirmed that these tonsilslackedanyG6-reactivelymphocytes (data
notshown).
Four-color immunofluorescence
analyses
demonstrated thatCRI-positive
tonsillarlymphocytes
share with tonsillar CD5Bcells thephenotype
of mantlezonelymphocytes. Ton-sillarBcellscanbedelineated intosubpopulations
basedupon the differentialexpression
ofsIgD,
CD10 and receptors for PNA(Fig. 1).
Cellsresiding
withinthe mantlezonebearsIgD
and fail to bind PNA orMAbs
specific
forCD1O(CALLA),
whereasBcellswithin the germinalcentergenerallylack sub-stantial
sIgD,
express low levels ofCDIOandavidlybindPNA(33-35).
Wefind that> 95% of tonsillarBcellsreactive with 17.109and/or
G6expresssIgD andfailtobindPNAorMAbsspecific
forCDI0(Fig. 1, top).
CD21-positive
B cells that bind anti-CD5 MAbs also have this phenotype (Fig. 1,middle).
However,wenotethat thegatedCD21-positiveB cell popula-tionsfailtobindanti-CD3 MAbsofthesame mouseIg
isotype
(Fig.
1,bottom).
These data indicatethat tonsillarCD5 Bcells reside in the sameanatomic sites asdo CRI-positive Bcells,
namely within the mantle zones encapsulating thegerminal
centersof
secondary
B cell follicles.Despite
sharingthephenotypeofmantle zone B cells,CRI-bearing lymphocytes,
andCD5 B cells each appeartocomprise
independent
but partially overlappingBcell subsets.First,the proportions of CD5Bcellswithinthespecimens apparentlydo not correlate with the proportions of cells found to express eitherone orbothof thetwoCRIs.For example,inspecimenno. 3, MAbs 17.109 or G6 respectively reacted with 4.4% or 2.0% of the lymphocytes, whereas only 2% of thisspecimen's cells expressed bothpan-B cellsurface antigens and detectable levels ofCD5 (Table I). In contrast, specimen no. 18 had a much greater proportion ofCD5 B cells (36%) than tonsil no. 3, but stillhad proportions ofCRI-bearing cells that were compa-rable tothat ofspecimen no. 3 (Table I). Secondly, over one half of the tonsillar B cellsexpressing 17.109 and/or G6 do not expressdetectablelevelsofthe CD5 surface antigen. For exam-ple,cellsstaining with PE- 17.109 displaybrightergreen
cc
LO
a 0
CIO
IgD PNA CD10
andG6 CRIsalso do not expressdetectablelevels of CD5(Fig. 3,
right panel).
Analyses
of
VH genesrearranged
in G6-reactive tonsillarlymphocytes.
To examine the molecular basis forCRI expres-sion in normaltonsil,weevaluatedtheVHgenesrearrangedinG6-reactive lymphocytes using the PCR. Approximately 4
X 106 G6-reactive cells were isolated from tonsillar lympho-cytes of tonsil no. 7 (Table I). Because all G6-reactive IgM proteins of knownsequence haveheavy chain variable regions of theVHI subgroup (10, 36),weperformedPCRongenomic DNA extracted from
G6-positive
cellsusing
oligonucleotide0)
0 0)0
CD3
Figure 1.Probability distribution of tonsil-lar Blymphocytes electronically gated to depict only those cells staining positively with APC-conjugated anti-CD21. Contour plots describe the logarithmic red (ordi-nate) or green(abscissa)fluorescence in-tensity of cells stained with PE anti-CRI
MAb G6(top row), PE anti-CD5 (middle row), or PE anti-CD3 (bottom row) and
FITCanti-IgD (left column),FITC-PNA
(middle column), or FITC anti-CDIO (right column).
primers designed to amplify any VHl that hadundergone Ig gene rearrangement with DJH gene segments (10). Southern analyses of
l/20th
of the reactionproduct indicated that such PCR generatedfragmentsof - 600bp that hybridizedspecifi-cally with an oligonucleotide complementary to the second framework region of all known VHl genes (VH1-FR2) (10) (data not shown). Furthermore, PCR of 1
gg
of DNA from G6-reactivetonsillar lymphocytesgeneratedamountsofVH1 geneproductcomparabletothatof PCRusing 1 uig ofgenomic DNA fromG6-reactiveCLL B cells(datanotshown).Nucleic acidsequenceanalysesofthe clonedPCRproducts
... Figure2. FACScan immunofluorescence
;--. . analyses of tonsillar lymphocytes labeled with PE-conjugated 17.109 and
fluores-cein-conjugatedanti-CD3(left) or
fluores-2kit cein-conjugated anti-CD5 (right). Num-bers correspond to the relative red
(ordi-nate)
orgreen(abscissa)
fluorescence intensityof the cells when excited at 488CD5
nm.U)
0
E
z0
a)
ci)
a:
17.109+
Cells
Fluorescence
revealthatG6-reactive tonsillar cellsexpresshomologous VH1 genes.Independentcolonies of bacteriatransformed with plas-midscontaining inserts derived from PCR of G6-reactive ton-sillarlymphocyte DNAwere screened byhybridization with oligonucleotide
"VHl-FR2"
oranoligonucleotide specific
for the second CDR ofVHl genes found to encode theG6-CRI (G6-CDR2) (10). The DNA from all such colonies annealed with either oligonucleotide probe under conditions of highstringency
(datanot shown). 15colonieswerechosenatran-dom for nucleic acidsequenceanalyses. Allclones have VH1 genesthatarehighlyhomologoustothatofL7, whichin turn is identical with thatofaVH l geneexpressed inG6-reactive CLL (10). Theheterogeneity noted in the fifth base ofeachsequence reflects the sequence of theVH 1 primerused toamplify the rearranged VH genes(Fig.4).Thisprimer hasanA/C/T wobble atthisposition. Except for clone L8, allclonescontain func-tionally rearrangedVHl genes.The VHgeneof L8 isan appar-entpseudogene.ThisVH gene has asingle point deletion inthe second baseof codon 71 (Fig. 4)that produces downstream termination codons inthethirdframework and
complemen-tarity determining
region (Figs.4and5).Allother cloneshave functional VH1 geneswithout stop codonsor gene rearrange-ments that shift the reading frame ofdownstream gene seg-ments.Despite each clone having nearly identical VH regions, thereisgreatdiversity amongthevariousclonesinthethird CDR(CDR3)andfourthframework regions.Theseregionsare encodedbythe D and JH gene segments, that undergo recombi-nationandamino-terminalnucleic acid base insertion immedi-ately before VHgene rearrangement(42, 43).As such, the se-quenceoftheCDR3generallyisidiosyncraticto each Ig V gene rearrangement. Only two clones,
L17
andL37, share identity in the deducedCDR3region,indicatingthatthese two variable region genes most likely were derived from the same B cell clone(Fig.
5). All other clones have highly distinctive se-quences in the deduced CDR3region,indicating that each was derived fromanindependentIg Vgene rearrangement (Fig. 5). Most clones have a segment within CDR3 that has a high de-greeof sequence homologywith aknown germlineDminigene (37-41)(Fig.5). Ofthe 14 distinct clones analyzed, at least 11 different germlineDsegments may be represented. In the re-gion presumably encoded by a rearranged JH gene segment, nearly half (6/13) ofthe 13distinctandapparently functional clones useJH4 (L17/37,
L25,L34, L36, L39, and L41), three17.109/G6+
Cells
Figure3. Relative greenfluorescence intensityof tonsillarlymphocyteselectronically gatedto
in-cludeonlythose cellsstaining positivefor
PE-conjugated
17.109(left)orPE-conjugated 17.109 andAPC-conjugated G6(right). Histograms 10o 1100correspond
tothelogarithmic
greenfluorescenceintensityof suchcellswhen co-stained with
FITC-conjugatedanti-CD3(solid line)or FITC-conju-gated anti-CD5(dashedline).
useJH5 (L22, L26, L42), four use JH6 (L7, L26, L30, and L33) (Fig. 5). The VHl pseudogene, L8, apparently isjuxtaposed with JHl. In addition to the variety noted in the D and JH gene segments, thelengthsoftheregions presumablyencodedbythe DJH gene segments varies greatly among the various clones, ranging from 18 codonsfor the shortest(L26)to38 codons for L30(Fig. 5).
Discussion
Thisstudyexamines therelationship betweenCD5 B cells and tonsillar lymphocytes that express major autoantibody-asso-ciated CRIs respectively defined by MAbs 17.109 or G6. The former constitute a significant subpopulation of B cells that readily isidentified in each tonsil population (Table I). The latter definesignificantly smaller proportionsof Bcells,and for G6-CRI-expressingcells, are notrepresented in all tonsils ex-amined. Both populations have surface antigen phenotypesof mantle zonelymphocytes. Although originally claimedto re-side in thegerminalcentersof human tonsil(1 1), tonsillar B cellsexpressing CD5 subsequentlywere notedtoexpress low levelsofLeu 16(CD20)using multiparameter flow cytometric analyses (34). Inaddition, we notethatboth tonsillar CD5 B cells andCRI-positiveBcells expresssurface IgDand lack de-tectablebinding affinityforanti-CD 10 MAbs and PNA. These phenotypic characteristics distinguish B cells located in the mantle zone from lymphocytes residing within thegerminal
center(34, 35).As
such,
thesestudies indicatethatCD5Bcells reside inthe same anatomic location asdocellsbearingthe 17.109orG6 CRI.However,not allCRI-bearingBcellsare"CD5-positive"B cells. Despite sensitive immunofluorescence techniques, we findthatlessthanhalf ofthe B cellsbearingthe17.109-CRI or theG6-CRIexpressdetectable levels of CD5. Thisalsoistrue for B lymphocytesco-expressing both CRIs. Asindicated by studiesonisolatedIgMparaproteins(22), such 17.109 and G6 reactive cells have a high probability of bearingsIgwith RF
activity.
This suggeststhatRF-bearingBcells may not express detectablelevelsof CD5..
@
* * * * * @ * * * * * @ * * * * * @******
*****@
* * * * * @*****@
* * * * * .******
* . . . . . * * * * * @ * * * * * @ * * * * * @ * * * * * * * * * * * * * * * * * @ * * * * * @ * * * * * @ * * * * * @ * * * * * @ * * * * * @ * * * * * * * * * * @ * * * * * @ * * * * * @ * * * * * @ * * * * * @ * * * * * @*****@
*****@
*****@
* * * * * * * * * * * * * * * * * e* * * * * *
*****@
* * * * * @*****s
* * * * * @*****@
*****@
*****@
* * * * * @ * * * * * @*****@
* * * * * * * * * * * @ * * * * * @ * * * * * @ * * * * * § * * * * * @ * * * * * @*****@
*.
***@
* * * * * @ * * * * * @ * * * * * @ * * * * * @ * * * * * * * * * * * @ * * * * * @ * * * * * @ * * * * * @ * * * * * @*****@
* * * * * @*****@
******@
* * * * @ * * * * * @ * * * * * @*****@
*****@
*****@
* * * * * @ * * * * * @ * * * * * * * . . * * ******@
* * * * * @ * * * * * @*****@
* * * * * @ * * * * * @ * * * * * @ * * * * * @ * * * * * @ * * * * * @*****@
* * . * * @ * * * * * * * * * * * e* * * * * e
******
*****@
*****e
* * * * * e * * * * * *
Eq
*****@
*****@
*****@
* . . . .* * * . * @
*****@
* * . * * @ * * * * * @ * * * * * @ * * * * * @ * * * * * @*****@
*****@
* * * * * @ * * * * * @*****@
* * * * * * * * * * * @*****Z
*****@
* * * * * @*****@
* * * * * @ * * * * * @ * * * * * @ * * * * * @ * * * * * @ . * * * @ * * * * * @ * * * * * @ * * * * * @ * * * * * @ * * * * * @ * * * * * @*****@
*****@
* * * * * @ * * * * * @ * * * * * @ * * * * * e* * * * * e * * * * * @
* * * * * @
*****@
* * * * * @
*****@
C) U . U U .
* * * * * § * * * * * @ *****@
*****@
* * . @ * * * @ * * * @ * * * Z* * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * * * * * * * * * * * * * @ * * * @ * * * * * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * . @ * * * @ * . . @ * * * | * * . @ * * * @ * * . @ * * * @ * * . @ * * * * * * * @ * * * @ * * * * * * * * * * . * * * * * * * . * * @ @ @ * * . @ * * * e * . . e
* * * @ * * * * * * * * * * * * * * * @ * * . @ * * * * * * * * * * * @ * * . @ * * * e * * . @
* * * @
* * . @ * * * s * * . s * * * @ * * * @ * * * * * * . @ * * * s * * * @ * * * @ * * * @ * * @ @ * * * @ * * * @ * * * @ * * * @ * * * Z * * * * * * * @
. . * Eq
* * * q * * * q * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * e * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @
* * * e * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @ * * * @
EqEq U U
* * * @
* * * @ * * * @ * * * e
* * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * e * * @ * * @
* * e
* * e
* * @ * * @ * * @ * * @ * * @ * * * * * * * * * * * @ * * @ * * * * * 9 * * @ * * @ * * 9 * * 9
* * @ * * @
* * e
* * @ * * @ * * @
* * *
* * @ * * Z * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * * * * @ * * @ * * @ * * Z * * | * * @ * * @ * * @ * * * * * e * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * * * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * @ @
* * 9 * * 9 * * 9 * * 9 * * 9 * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * @ * * § * * v * * @ * * @ * * @
* * @ * * e * * @ * * @ 4J H E-4
LI
E90-4 2t 14H to (>1 00 tooU :>U VO 'OE C2) + UH 0IuUtn
UU)E-;
EH :ON coins 4)U U) coc i4 tCD Ln i4u to O >1 Co CD
CoH<
r t7 t7 r- OCrun w o m v w r- m N rON v
uO
w o m v w r m-4csr- w iN N N N m m m M m m v -w r Go r- C1 CN c N04 (I m m m m m qw
a- G- 0 G- 1. 6. 0. 1. 0 Fa 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 1- 0 0
* ... *
rCcN v LA D 0o v w r- aM -4 N
r
(4
( N N (N (') ( (f ( ( C)0 0 :> H E-4 u E-4 H 0 0 H
9
tJ
H 0K t
0 0: uE ZE-4 u E-4U E-4 uthese cells acquired phenotypic characteristics ofgerminal centerlymphocytes; i.e., they lost sIgD expression and became positive for CD 10. However, as noted, CRI-bearing B cells that do not express CD5 have thephenotypeof mantle zone lym-phocytes. Thus,CD5-negative CRI-bearingBcells at leastdo not representsuchdifferentiatedCD5 B cells.
Alternatively, CRI-bearing B lymphocytes may constitute a B cell population with characteristics ofthe CD5 B cell. Al-thoughused asamarkerforasubpopulationofBlymphocytes, theexpression of CD5 hasnoknownrelationshipto the appar-entphysiology of the CD5Bcell,and may in fact be an epiphe-nomenon(reviewedinreference45). Furthermore, B cells can-not bedelineated readily into discrete subpopulations basedon thedetectable levelof CD5 surface antigen. Enumeration of CD5Bcellsrequires subtraction methods,inwhich thepercent numberof isotype-control-stained B cells that have fluores-cence above acertain threshold is subtracted frompercent num-berofanti-CD5-MAb-stained cells thataredetected above that samethreshold. Cells with extremelylowlevels of CD5 may not fluoresce brightly enough to be scored as positive, even whenstained withthebrightest of fluorochrome-labeled anti-CD5MAbs. Assuch, itmay beargued thatall
CRI-bearing
B cellsactuallymay expressCD5, butat levelsbelowdetection using flow cytometric analyses.Finally, CRI-bearing"CD5-negative"Bcells may be simi-lar to theCD5-negative "sister" population ofBcells detected in the mouse (46-48). Inexperimentsaimedatcharacterizing the CD5 B cell populationandits progenitors in the mouse peritoneum, peritonealBcells werefoundthatdidnot express surface CD5 but apparentlyhadotherphenotypic traits pecu-liartoCD5 Bcells (46), such as thesurface expression of MAC-1
(CDl
lb) (49),extendedlongevity in vitro,orabilityto gener-atespontaneousoligoclonalBcellexpansions in vivothat re-semble human B cell CLL(50). Intransfer experiments,suchCD5-negative
sister cells initially were found toreconstitute miceonly whenever theadoptivehosts were reconstituted with CD5 Bcells (46). More recentstudies, however, suggest that such cells mayconstitute a relatedbut possibly independent andself-renewing
Bcellsubpopulationthat mayarise latter in ontogenythanBcells thatexpressdetectable levelsof the CD5 surfaceantigen
(46, 48). By analogy,CD5-negative CRI-bear-ingBcellsmay begeneratedat alaterstageofBcell develop-mentthanCRI-bearing CD5Bcells,butstillexpress manyof thetraitsthat areassociated with the CD5Bcell.Onepeculiar phenotypic characteristicproposedforCD5 B cells isstable IgV gene expression with little orno somatic mutation. Independent clones of CD5 B cells may express identicalVgeneswithout evidence for somaticmutation (51, 52). The antibodiesencoded by such V genes frequently are reactive withavariety of selfantigens, i.e., proteolytically pro-cessederythrocytemembranes, denatured DNA, and/or the Fc portion of self IgG (53-57). Stable expression ofsuch V genes
with little or no somatic mutation may account for the finding that CD5 B cells are enriched for cells that spontaneously pro-duceIgM autoantibodies (19, 20).
Inthis light, itwasimportanttoexaminethe V genes ex-pressed by CRI-bearing cells. Previous studies indicated that the G6 CRI was found onIg heavy chains oftheVH1subgroup (58). In CLL, G6 reactive leukemia cells were found to express identical VH 1 genes, indicating that the G6 CRI is a marker for oneVH1 gene(s) expressed with little or no somatic mutation (10). However, itwas not known whether thisrelationshipis valid for nonmalignant G6-reactive B cells. Conceivably, B cells free to permute theirexpressedV genesthroughthe pro-cessof somatic mutationmay express G6-reactiveIgencoded by other VHl genes or VHl genes that have diversified from those present in the germline DNA. Indeed, the VHl heavy chains of a few IgM autoantibodies that share only modest homologytotheheavy chainexpressed byG6-reactive CLLare
knownto reactwith the G6 MAb(58). Particularlyinlightof the finding that a large fraction of G6-reactive cells do not
expressdetectablelevelsofCD5,itwasimportanttoexamine theVH1 genes usedbycellsexpressingthe G6-CRI.
Nucleic acid sequence analyses of the Ig VH1 genes rearranged and presumablyexpressedin G6-reactive cells re-vealedlittle evidencefor somatic mutation. Otherthan clones LI7,L30,andL34,all otherclones haveVHl genes that were identicalto L7(Fig. 4). The VH genesofclones LI 7and L34, thatapparentlyarederived from thesame Bcell clone(LI 7/ L34), differ from L7 atonly twosites
(Fig.
4). LI 7 andL34, moreover, share with an independent clone, L30, the same nonconservative G-> Asubstitution in codon74.Conceivably theL17/L34 and the L30VHl genes arederived from thesame allele.Inthiscase,thecommon basesubstitution notedin these clones may represent an allelic polymorphism in the VH1 gene(s)encoding
G6-reactive heavy chains, rather than a so-matic mutation event. In any case,inover5,600 bases evalu-ated forthe VHgenesofthe 13 independentand functional clones, we find only three base substitutions, representing afidelity
in the DNA sequencesof>99.94%. Theabsence of even nonconservative base changes indicates that the con-served VHgene sequences are not the mere consequence of selection forcellshaving reactivity fortheG6MAb. Rather, these data indicate that G6-reactive tonsillar B cells express homologous VH1 geneswith littleor nosomatic mutations.Evenin the CDR3 region,muchofthediversityapparently isnot the result of somatic mutation subsequent to Ig gene rearrangement. Except atsites flankingthe Dregion that may be generated by amino-terminal sequence insertions, three-fourthsof the independent clones (1 1/15)have short stretches of complete homology with known germlineDsegments (L7, L8, L22, L24, L26, L30, L33, L34, L36, L39, L42). Also, ex-ceptforcodonsimmediately contiguoustothe D-JHjunction, all clonesthat use the same JH gene segment have sequences
Figure4. Nucleic acidsequencecomparison ofrearrangedIgVH I genes amplified from G6-reactive tonsillar lymphocytes. The name of each
sequenceislistedontheleft.All sequences are compared withL7.Adot (-)indicates homology between the compared sequences and a letter
indicatesabasedifference.In L8, thesite of the single base deletion is framed with brackets. Listed above the sequence ofL7are the amino acid
positionnumbersaccordingtoKabat et al. (37), and descriptions indicating the location of the leader sequence, theCDR1 and CDR2. The 5' endof the leadersequence that corresponds to the PCR primer isindicated by a double underline. The sequences recognized by the
oligonucle-otide probes"FR2"(aapositions 44-49)and "CDR2"(aapositions55-60) are underlined. These sequence data are available from EMBL/
D
SEGMENT
GlyGlyLysGlyIleThrMetThrSer
L7 GGGGGCAAAGGAATTACTATGACTTCT
Dxp'1 T...GT-CGGGGAGTTATTATAAC LeuGlyGlyValEndGlnLeuValArgV
L8 GAGGGGGAGTATAGCAGCTCGTCCGCG DN4 ...
GlySerThrValThrThrGlyAsp
L17 GGGAGTACGGTGACTACGGGAGAT
DAl T--C.
A--A---GluGlyTyrCysSerSerThrSerCysSer
L22 GAGGGATATTGTAGTAGTACCAGCTGCTCG
DLR4 A...ATGCCC GluValValGlyCysSerSerThrSerCys
L24 GAGGTGGTTGGTTGTAGTAGTACCAGCTGC
DLR2 A-GATA...TATGCCC SerLeuArgArgTyrSerSerGlyTrpTyrGluGly
L25 TCCCTCCGGCGGTATAGCAGTGGCTGGTACGAGGGT
DN1 G. CA.
GlyAsp
L26 GGGGAC
Dq52 CTAACT...
L30 Dxpl
JH
SEGMENT
TyrCysTyrTyrTyrGlyMetAspValTrpGlyGlnGlyThrThrValThrValSerSer TACTGCTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA
A... JH6
alLeuProAlaLeuGlyProGlyHisProGlyHisArgLeuLeu
TACTTCCAGCACTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCA
GCTGAA... JH1 PheAspTyrTrpGlyGlnGlyThrLeuValThrValSerSer TTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCA TAC...A... JH4 AsnTrpPheAspProTrpGlyGlnGlyThrLeuValThrValSerSer AACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCA
. T.A.
JH5
TyrTyrTyrTyrGlyMetAspValTrpGlyGlnGlyThrThrValThrValSerSer TACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA
TAC...G... JH6 PheAspTyrTrpGlyGlnGlyThrLeuValThrValSerSer
TmTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCA
TAC...A... JH4 AsnTrpPheAspProTrpGlyGlnGlyThrLeuValThrValSerSer AACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCA
. T.A.
JH5
GlyArgThrArgValSerValSerThrLeuTyrAspSerSerGlyTyrTyrAspPheSerGly TyrTyrGlyMetAspValTrpGlyGlnGlyThrThrValThrValSerSer
GGCCGGACCCGGGTATCGGTTTCGACCCTCTATGATAGTAGTGGTTATTACGACTTCTCCGGC TACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA
*TATTA-G--AT-TTG-C...TA--Gly
L33 GGA
DLR1 ...TATTGTACTGGTGGTGTATGCTATACC
GlySerSerTrpThr
L34 GGCAGCAGCTGGACC DN1
A...TA-MetTyrAsnTrpAsnPhe
L36 ATGTATAACTGGAACTTT DM1 G...AC
GlySerThrValThrThrGlyAsp
L37 GGGAGTACGGTGACTACGGGAGAT
DAl T--C
A--A----AspThrSerSerGlyTyrTyrArg
L39 GATACTAGTAGTGGTTATTATCGC
Dxp4 GTATTAC..
TT-T-G...AC-GlyGlyValAlaGlyArgProHis
L41 GGCGGAGTTGCTGGTAGGCCCCAT DLR4
AGGATATT-TA-T-CCA----C--T,--GlyGlyMetGlyTyrCysSerGlyGlySerCys
L42 GGGGGGATGGGATATTGTAGTGGTGGTAGCTGC DLR2 A...TACTCCC
TACTACTAC... G... JH6
TyrTyrTyrTyrTyrGlyMetAspValTrpGlyGlnGlyThrThrValThrValSerSer
TACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA
G.
-G---JH6
PheAspTyrTrpGlyGlnGlyThrLeuValThrValSerSer
TTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCA
TAC...A... JH4 PheAspTyrTrpGlyGlnGlyThrLeuValThrValSerSer
TLTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCA
TAC...A... JH4
PheAspTyrTrpGlyGlnGlyThrLeuValThrValSerSer TTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCA
TAC...A... JH4 LeuAspTyrTrpGlyGlnGlyThrLeuValThrValSerSer
CTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCA
TACT...A... JH4
PheAspTyrTrpGlyGlnGlyThrLeuValThrValSerSer
TTCGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCA TAC--T...A... JH4
TyrTrpPheAspProTrpGlyGlnGlyThrLeuValThrValSerSer
TACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCA
A.T .A. JH5
Figure5.DeducedDand JHsegmentsof theIgheavy chain variable
region
sequences.Eachsequenceiscompared
totheknown D andJH
seg-mentsthat have thegreatesthomology(37-41).Sequence
comparisons
areindicatedasinFig.
2. Thesesequencedataareavailable fromEMBL/GenBank/DDBJ under accession numbers M65090-M65 104.
thatdiffer fromknown
germline JH
genesegmentsatthesamesiteand with thesamebase substitution
(Fig. 5).
Forexample,
all clones withJH4 differ from
published
germline JH4
mini-genes
(59)
withaA-- G substitutioninthe sixth codon of theJHsegment(Fig. 5).In addition,anA- Gsubstitution at this
samelocationwasnotedinthededuced
JH4
genesegment
usedby G6-reactive leukemiccells
(10)
and4B4,
ahuman-humanBcell
hybridoma
expressing
aVH4
gene with littleor nosomaticmutation (56). Itis
unlikely
thatsuchsubstitutions would oc-currepeatedly
indifferent clones thathadundergone
indepen-dent gene rearrangements. As
such,
exceptatsites that maybepermuted
during
the process ofIg
generearrangement,thedif-ferencesfrompublished JHsequence maybesecondaryto ge-netic
polymorphisms,
rather thantosomaticmutations in therearrangedJH gene segment.
Itis
unlikely
that the methods used in thisstudy
skewedour analysestofavor isolation ofrearranged
Vgenesthatnot un-dergonesomaticmutation. We usedprimers
corresponding
to consensussequencescommon toallJH
genesegmentsandtoasequenceatthe 5'
region
of allVH
1 leader sequences.ably, chancemutationsin arearranged VH1 gene at thesites recognizedbythese primersmaydisrupttheabilityof thatVHl gene to be amplified by our methods. However, these same
primershavesuccessfully amplified
VHl
genesotherthanthose foundinthisstudy, including VHl genes that haveundergone apparent somatic mutationsubsequent to V gene rearrange-ment. (T.J. Kipps, R. Kobayashi, andS.Duffy, unpublished observations). Also, theamount ofVHlgeneproductproduced in PCR of G6-reactive tonsillar lymphocytes is comparableto that produced in PCR of G6-reactive leukemia cell DNA. Thus,itseemsunlikely that the bias introduced byour meth-odscouldaccountfor the results thatweobtainedinthisstudy.
Rather, a morelikely
explanation
is that G6-reactive tonsillar Bcells expresshomologousVH 1genes with little or nosomatic mutations.Consistent with this interpretation isourfindingthatsome
ofthetonsilstesteddidnothave any cellsreactivewithG6. If the G6 MAb could bindtoheavychainsencodedby several different VHIgenes, thenfindingpersons without any
G6-posi-tive cells wouldbeunlikely. Thatover I10%ofthe tonsils
exam-ineddidnot have any cellsreactive with the G6 MAb, indicates that afairly high
proportion
ofthepopulationmaylack expres-sion ofanyVHgenesthatcanencodeIg heavy chainswiththis major CRI. Considering theconservation
noted in theVHl
gene sequencesof G6-reactive cells([10] and this study), the frequent expression ofthe VH 1 gene(s) encoding the G6-CRI the fetal immune repertoire (18, 60), the association of the G6-CRI with IgM autoantibodies (5, 61), and relative high-fre-quency expression of this CRI in CLL and SLL(4, 6), the absence of G6expressionmayreflectapolymorphisminVH1 gene use thatpossiblyhas
physiologic significance.
Finally, these studies indicate thatarelativelyhigh propor-tion of mantelzonelymphocytesexpresses autoantibody-asso-ciated CRIs.sIgD-bearingcellsconstituteonlyafraction ofthe total Bcells, ranging from 37% to 87% ofthe
CD19-positive
cells(Table I).Asnoted,the 17.109 CRIand/or the G6 CRI predominantly is expressedby cells thatco-expresssIgD.Since suchsIgD bearingcellspredominantlyrepresentmantlezone lymphocytes, the 17.109-reactive, orG6-reactivecells, respec-tively, mayconstitute 4-17% and0-12%of the mantlezone lymphocytes. Thesefrequenciesapproach those notedforCRI
expression
in CLL. Conceivably transformation of lympho-cytessuchasthosefound inthemantelzone may accountfor thehighfrequency
expression ofautoantibody-associated CRIs inCLL and related malignancies.However, thereisan appar-entbiasfor co-expression ofboth 17.109 and G6 by leukemia cellpopulations
thatisnotnotedin mosttonsillarlymphocyte populations studied. Biased co-expression ofthe 17.109 CRI and the G6 CRIby leukemiacellpopulationsmayreflect selec-tion of CRI-bearingcellsbasedupon thebinding activities of theexpressedIg. Furthercomparativeanalysesofthe immuno-globulinsproduced by malignant and normal B cells may help resolve whetherneoplastic CRI-bearingcellsarise
from asub-setofnormalCRI-bearingBlymphocytes.
Acknowledgments
Wethank Drs. Rizgar Mageed and Roy Jefferis (University of Bir-mingham, BirBir-mingham, England) fortheG6 MAbandDr. George Abraham (University of Rochester, Rochester, NY) for the anti-VHIIIb MAb.WethankDr.DennisA.Carson(University of
Califor-nia,SanDiego) for his carefulreadingof thismanuscript andhelpful
advice. In
addition,
weacknowledge
the finetechnicalassistanceofMr. Grant Meisenholder.Dr.
Kipps
isaScholar of the LeukemiaSociety
ofAmerica,fundedin partbythe Scott
Helping
Hand Fund. This workwassupported
inpartbyNational Institutes of HealthgrantsAR38475 andAGO4100.
References
1.Kipps,T.J.,S.Fong,E.Tomhave,P. P.Chen,R. D.Goldfien,and D.A.
Carson. 1987.High-frequency expressionofaconservedkappalight-chain
vari-able-regiongene inchroniclymphocyticleukemia.Proc.Nall. Acad.Sci. USA.
84:2916-2920.
2.Carson,D.A.,and S.Fong.1983.Acommonidiotopeonhuman
rheuma-toid factorsidentifiedbyahybridomaantibody.Mol.Immunol. 20:1081-1087.
3. Carson,D.A.,P.P. Chen,T. J. Kipps,V.Radoux,F. R. Jirik,R.D.
Goldfien,R.I.Fox, G. J.Silverman,and S.Fong. 1987.Idiotypicandgenetic
studies ofhumanrheumatoidfactors. Arthritis Rheum.30:1321-1325.
4.Kipps,T.J.,B.A.Robbins,P.Kuster,and D.A.Carson. 1988.
Autoanti-body-associatedcross-reactiveidiotypes expressedathigh frequencyinchronic
lymphocyticleukemia relativetoB-celllymphomasoffollicularcentercell
ori-gin.Blood.72:422-428.
5.Mageed,R.A.,M.Dearlove,D.M.Goodall,and R.Jefferis.1986.
Immun-ogenicandantigenic epitopesofimmunoglobulins.XVII. Monoclonal
antibod-iesreactivewithcommonandrestrictedidiotopestotheheavychainof human
rheumatoidfactors.Rheumatol.Int.6:179-183.
6.Kipps,T.J.,B. A.Robbins,A.Tefferi,G.Meisenholder,P.M.Banks,and D.A.Carson. 1990.CD5-positiveB-cellmalignanciesfrequentlyexpress
cross-reactiveidiotypesassociatedwithIgMautoantibodies.Am.J.Pathol.
136:809-816.
7.Kipps,T.J.,E.Tomhave,P. P.Chen,and D.A.Carson. 1988.
Autoanti-body-associatedkappalightchain variableregiongeneexpressedinchronic lym-phocyticleukemia with littleornosomatic mutation.Implicationsforetiology
andimmunotherapy.J.Exp.Med. 167:840-852.
8.Pratt,L.F.,L.Rassenti,J.Larrick,B.Robbins,P.Banks,and T. J.Kipps.
1989.Immunoglobulingeneexpressioninsmalllymphocyticlymphomawith littleornosomatichypermutation.J.Immunol.143:699-705.
9.Radoux, V.,P. P.Chen,J.A.Sorge,and D.A.Carson. 1986.Aconserved humangermlineVkappagenedirectlyencodesrheumatoidfactorlightchains. J.
Exp.Med. 164:2119-2124.
10.Kipps,T.J.,E.Tomhave,L.F.Pratt,S.Duffy,P. P.Chen,and D.A.
Carson. 1989.DevelopmentallyrestrictedVHgeneexpressedathigh frequency
inchronic
lymphocytic
leukemia.Proc.NaWl. Acad.Sci. USA. 86:5913-5917.11.Caligaris-Cappio,F.,M.Gobbi,M.Bofill,and G.Janossy. 1982.
Infre-quentnormalBlymphocytesexpress features of B-chroniclymphocytic
leuke-mia. J.Exp.Med.155:623-628.
12.Gobbi, M.,F.Caligaris-Cappio,and G.Janossy.1983. Normalequivalent
cellsofBcellmalignancies:analysiswith monoclonalantibodies.Br.J.
Haema-tol. 54:393-403.
13.Gadol, N.,and K.A.Ault. 1986.Phenotypicandfunctional
characteriza-tion of human Leu I(CD5)cells.Immunol.Rev. 93:23-34.
14.Hardy,R.R.,and K.Hayakawa. 1986.Developmentandphysiologyof
Ly-lBand its humanhomolog,Leu-l B.Immunol.Rev.93:53-79.
15.Kipps,T.J.,and J. H.Vaughan.1987.Geneticinfluenceonthe levelsof
circulatingCD5B
lymphocytes.
J.Immunol. 139:1060-1064.16.Bofill,M.,G. Janossy,M. Janossa,G. D. Burford,G. J.Seymour,P. Wernet,and E. Kelemen. 1985. Human B celldevelopment.II.Subpopulations
in the human fetus. J.Immunol. 134:1531-1538.
17.Antin,J.H.,S.G.Emerson,P.Martin,N.Gadol,andK A. Ault.1986. Leu-I+(CD5+)Bcells:amajor
lymphoid
subpopulationin fetalspleen.Pheno-typicand functional studies. J.Immunol.136:505-5 10.
18.Kipps, T.J.,B. A. Robbins,and D. A.Carson. 1990. Uniformhigh frequencyexpressionofautoantibody-associatedcross-reactiveidiotypesin the
primaryBcellfollicles of human fetalspleen.J.Exp.Med. 171:189-196. 19.Casali, P.,S. E.Burastero,M.Nakamura,G.Inghirami,andA.L. Not-kins. 1987. Human
lymphocytes
makingrheumatoid factor andantibodytobelongtoLeu-l+B-cell subset. Science(Wash. DC).236:77-81.
20.Hardy,R.R.,K.Hayakawa,M.Shimizu,K.Yamasaki,andT.
Kishi-moto.1987. Rheumatoid factor secretion from human Leu-l+Bcells. Science
(Wash.DC).236:81-83.
21.Carson,D.A.,P.P.Chen,T. J.Kipps,V.Radoux,F.Jirik,R.D.Goldfien,
R.I.Fox,G. J.Silverman,and S.Fong.1987. Molecular basis forthe
cross-reac-tive idiotypeson human anti-IgGautoantibodies(rheumatoid factors).Ciba
Found.Symp. 129:123-134.
22.Silverman,G.
J.,
R.D.Goldfien,P.Chen,R. A.Mageed,R.Jefferis,F. Goni,B.Frangione,S.Fong,and D. A.Carson.1988.Idiotypicandsubgroupanalysisof human monoclonal rheumatoidfactors:implicationsfor structural andgeneticbasisof autoantibodiesin humans. J.Clin.Invest.82:469-475.
and relateddisorders: practical aspects of frozen section technique and interpreta-tion. J.Clin. Lab.Anal. 1:104-115.
24.Greenstein, J. L., A. Solomon, and G. N. Abraham. 1984. Monoclonal antibodies reactive with idiotypic and variable-region specific determinants on humanimmunoglobulins.Immunology. 51:17-25.
25.Reinherz, E. L., R. E. Hussey, and S. F. Schlossman. 1980. A monoclonal antibody blocking human T cell function. Eur. J. Immunol. 10:758-762.
26.Maruyama, S., H. Kubagawa, and M. D. Cooper. 1985. Activation of human B cells andinhibition of their terminal differentiation by monoclonal anti-mu antibodies. J.Immunol. 135:192-199.
27. Kubagawa, H., W. E.Gathings, D. Levitt, J. F. Kearney, and M. D. Cooper. 1982.Immunoglobulinisotype expression of normal pre-B cells as deter-mined byimmunofluorescence. J. Clin. Immunol. 2:264-269.
28. Tedder, T. F., L. T.Clement, and M. D. Cooper. 1984. Expression ofC3d receptors during human B celldifferentiation:Immunofluorescenceanalysis with theHR-5monoclonalantibody. J. Immunol. 133:678-683.
29. Fox, R. I., D. Harlow,I. Royston, and J. Elder. 1982. Structural character-ization of the human T cell surface antigen (p67) isolated from normal and neoplastic lymphocytes. J.Immunol. 129:401-405.
30.Parks, D. R.,L. L.Lanier, and L. A. Herzenberg. 1986. Flow cytometry
andfluorescenceactivated cellsorting (FACS). In Handbook of Experimental
Immunology. D. M.Weir,L. A.Herzenberg, and C. Blackwell,editors.Blackwell ScientificPublications, Oxford. 29.1-29.21.
31.Saiki, R. K., D. H.Gelfand,S.Stoffel,S. J.Scharf,R.Higuchi, G. T. Horn, K. B.Mullis, and H. A. Erlich. 1988. Primer-directed enzymatic amplification of DNAwith a thermostable DNA polymerase.Science(Wash.DC). 239:487-491.
32. Hattori, M., and Y.Sakaki. 1986. Dideoxy sequencing method using denaturedplasmid templates.Anal. Biochem. 152:232-238.
33. Hsu, S.-M., and E. S.Jaffe. 1984. Phenotypic expression of B-lympho-cytes. 2. Immunoglobulin expression ofgermialcentercells. Am. J. Pathol.
114:396-402.
34.Gadol, N.,M. A.Peacock, andK. A.Ault.1988.Antigenicphenotype and functional characterization of human tonsil B cells.Blood.71:1048-1055.
35. Weinberg, D. S., K. A. Ault, M.Gurley, and G. S. Pinkus. 1986. The humanlymph nodegerminalcentercell:characterization and isolation byusing
two-colorflowcytometry. J.Immunol. 137:1486-1494.
36.Newkirk, M. M., H. Gram, G. F. Heinrich, L. Ostber g, J. D. Capra, and R. L.Wasserman. 1988. Complete protein sequences of the variableregionsof the clonedheavy andlight chainsofahumananticytomegalovirus antibody reveal astriking similarity to human monoclonal rheumatoid factors of the Wa idiotypic family. J.Clin.Invest.81:1511-1518.
37. Kabat, E.,T.T.Wu, M.Reid-Miller, H. M. Perry, and K. S. Gottesmann. 1987. Sequences of Proteins of Immunological Interest. Publication No. 1987:165-462. U.S. Government PrintingOffice, Bethesda, MD.
38.Siebenlist,U., J. V.Ravetch,S.Korsmeyer,T.Waldmann,and P. Leder.
1981.HumanimmunoglobulinDsegments encoded in tandemmultigenic fami-lies. Nature(Lond.).294:631-635.
39.Ichihara, Y., M. Abe,H.Yasui,H.Matsuoka,andY.Kurosawa.1988.At
leastfive DH genes of humanimmunoglobulin heavychainsareencoded in 9-kilobaseDNAfragments.Eur. J.Immunol. 18:649-652.
40.Ichihara, Y.,H.Matsuoka,and Y. Kurosawa. 1988.Organizationof
hu-manimmunoglobulinheavy chaindiversitygene loci. EMBO(Eur.Mol. Biol.
Organ.)J.7:4141-4150.
41.Matsuda, F., K. H. Lee, S.Nakai,T.Sato,M.Kodaira,S.Q.Zong,H.
Ohno,S.Fukuhara,andT.Honjo.1989.Dispersedlocalization ofD segments in
thehumanimmunoglobulin heavy-chainlocus.EMBO(Eur.Mol. Biol.Organ.)
J. 7:1047-1051.
42.Yancopoulos, G. D., andF. W.Alt. 1986.Regulationof theassemblyand
expressionofvariable-regiongenes.Annu.Rev. Immunol. 4:339-368.
43.Desiderio,S.V., G.D.Yancopoulos,M.Paskind,E.Thomas,M.A.Boss,
N.Landau,F. W.Alt,and D.Baltimore. 1984. Insertion ofNregionsinto
heavy-chain genes is correlated withexpressionof terminaldeoxytransferasein B cells. Nature(Lond.).311:752-755.
44.Caligaris-Cappio,F.,M.Riva,L.Tesio,M.Schena,G.Gaidano,and L.
Bergui.1989.Human normalCD5+Blymphocytescanbeinducedto differen-tiatetoCD5- Blymphocyteswithgerminalcentercell features. Blood.
73:1259-1263.
45.Kipps,T. J. 1989. TheCD5 B cell. Adv. Immunol. 47:117-185.
46.Herzenberg,L. A., A. M.Stall,P. A.Lalor,C.Sidman,W. A.Moore,and
D.R.Parks. 1986. TheLy-lBcelllineage. Immunol.Rev.93:81-102.
47.Herzenberg,L. A., andA.M.Stall.1989.ConventionalandLy-I B-cell
lineagesin normal andmutransgenicmice.Cold Spring Harbor Symp. Quant.
Biol.54:219-225.
48.Herzenberg,L. A., andL.A.Herzenberg.1989. Toward a layered immune
system.Cell. 59:953-954.
49.Herzenberg,L. A., A.M. Stall, J. Braun, D. Weaver, D. Baltimore, and R.
Grosschedl. 1987.Depletionofthe predominant B-cell population in mu
heavy-chaintransgenic mice.Nature(Lond.). 329:71-73.
50.Stall,A.M.,M.C. Farinas, D. M. Tarlinton, P. A. Lalor, L. A.
Herzen-berg,and S.Strober.1988. Ly-I B-cell clonessimilar to human chronic
lympho-cytic leukemia routinelydevelop in older normal mice and youngautoimmune
Zealand Black-relatedanimals.Proc.Natl.Acad.Sci. USA. 85:7312-7316. 51.Forster, I., H. Gu, and K. Rajewsky. 1988. Germline antibody V regions
asdeterminants ofclonalpersistenceandmalignantgrowth in the B cell
compart-ment.EMBO(Eur. Mol. Biol. Organ.)J.7:3693-3703.
52.Tarlinton,D.,A.M.Stall, and L. A. Herzenberg. 1988. Repetitive usage of
immunoglobulinVHand D gene segments inCD5+ Ly-l B clonesof (NZB
xNZW)F1mice. EMBO (Eur. Mol. Biol.Organ.)J. 7:3705-10.
53.Reininger,L., P.Ollier,P.Poncet,A.Kaushik, and J. C. Jaton. 1987.
NovelVgenes encodevirtually identicalvariableregions of six murine
monoclo-nalanti-bromelain-treatedred blood cellautoantibodies.J.Immunol.
138:316-323.
54.Sanz, I.,P.Casali,J. W.Thomas,A.L.Notkins,and J. D.Capra. 1989.
Nucleotide sequencesof eighthumannaturalautoantibodyVHregions reveals apparentrestricteduseofVHfamilies.J.Immunol.142:4054-4061.
55.Nakamura, M.,S. E.Burastero,Y.Ueki,J. W.Larrick,A.L.Notkins, and
P.Casali. 1988. Probingthe normalandautoimmuneBcell repertoire with
Epstein-Barr virus: frequencyofBcellsproducingmonoreactivehigh affinity
autoantibodies inpatientswith Hashimoto'sdiseaseandsystemiclupus
erythe-matosus.J.Immunol. 141:4165-4172.
56.Sanz, I.,H.Dang,M.Takei,N.Talal,andJ. D.Capra.1989.VHsequence
ofahumananti-Smautoantibody.Evidence thatautoantibodiescanbe unmu-tatedcopiesofgermlinegenes. J.Immunol. 142:883-887.
57.Baccala, R.,T. V.Quang,M.Gilbert,T.Ternynck,andS. Avrameas.
1989. Twomurine naturalpolyreactive autoantibodiesareencodedby
nonmu-tatedgerm-linegenes. Proc. Natl.Acad.Sci. USA. 86:4624-4628.
58.Newkirk,M.M.,R.A.Mageed,R.Jefferis,P. P.Chen,and J.D.Capra.
1987.Completeamino acid sequences of variableregionsoftwohumanIgM rheumatoidfactors,BOR and KASofthe Waidiotypic family,revealrestricted
useofheavyandlightchainvariableandjoining regiongene segments. J.Exp.
Med. 166:550-564.
59.Ravetch,J.V.,U.Siebenlist,S.Korsmeyer,T.Waldmann,and P. Leder.
1981. Structureof the humanimmunoglobulinmulocus:characterization of
embryonicandrearrangedJ andDgenes.Cell.27:583-591.
60.Schroeder,H.W., Jr.,J. L.Hillson,andR.M. Perlmutter. 1987.Early
restrictionofthe humanantibody repertoire.Science(Wash.DC).238:791-793. 61.Shokri,F.,R.A.Mageed,E.Tunn,P.A.Bacon,and R.Jefferis. 1990.
Qualitativeandquantitative expressionofVHIassociatedcrossreactiveidiotopes
withinIgMrheumatoidfactorfrompatientswithearlysynovitis.Ann.Rheum.
Dis.49:150-154.