Bacterial communities associated with different sample months
Bacterial communities associated with jellyfish
... marine bacterial community remain poorly ...the bacterial community associated with ...the bacterial community associated with ctenophores and scyphomedusae respectively in this thesis ...
171
The microbial ecology of human-associated bacterial communities
... complex communities, interacting with each other and with our immune systems, collectively forming the human ...rial communities to understand aspects of their microbial ...out different aspects of ...
160
Variation in the structure and function of invertebrate-associated bacterial communities
... Sodalis prevalence is well documented in tsetse flies. Despite this, its role within the host is not well understood. In combination with existing genomic resources, the draft genomes presented here may help us to ...
210
Daylight exposure modulates bacterial communities associated with household dust
... per sample and converted to absolute abun- dances (16S rRNA gene copies × mg −1 dust) by scaling relative normalized RSV counts in each community by estimates of total bacterial abundance per milligram dust ...
13
Bacterial communities of juvenile corals infected with different Symbiodinium (dinoflagellate) clades
... genetically different, Symbiodinium types have been shown to differentially affect the physiology of the coral host; their effects on the bacterial partners in the association are ...the bacterial ...
15
Fungal and Bacterial Communities in Indoor Dust Follow Different Environmental Determinants
... at different times or over short periods of time [4, 5, ...several months) have used spore counts or cultivation [3, 18, ...14 months of monitoring [23], confirming studies that had shorter ...
15
Bacterial and Fungal Communities Associated with the Production of A Nigerian Fermented Beverage, "Otika"
... 3. Results Types, Occurrence and Population of Microbial Isolates during "Otika" Production Based on the cultural, microscopic and biochemical characteristics, twelve and nine different species of bacteria ...
8
The Origin, Succession, and Predicted Metabolism of Bacterial Communities Associated with Leaf Decomposition
... the bacterial communities of the terrestrial leaf phyllosphere partly contributed to the community that inhabited aquatic leaf packs using SourceTracker predictive ...the bacterial decomposer ...
15
Diurnal cycling of rhizosphere bacterial communities is associated with shifts in carbon metabolism
... each sample spectrum were evaluated on van Krevelen diagrams generated from the complex mass spectra obtained by ESI FTICR MS ...each sample was averaged to give the NOSC of soluble organic matter in that ...
13
Plant growth promotion potential is equally represented in diverse grapevine root-associated bacterial communities from different biopedoclimatic environments
... three different agroclimatic ...the different cultivars and rainfall and temperature regimes, the rhizo- sphere and endosphere microbial communities are different among the three ...
18
Diverse bacterial communities are recruited on spores of different arbuscular mycorrhizal fungal isolates
... Diversity of the bacterial communities strictly associated with spores of different 257. AMF isolates 258.[r] ...
36
Effect of bacterial inoculation, plant genotype and developmental stage on root-associated and endophytic bacterial communities in potato (Solanum tuberosum)
... for bacterial interaction with plants as often demonstrated by the occurrence of higher bacterial densities (De Boer et ...involved bacterial groups have different kinds of interactions with ...
11
Diversity, stability, and uptake of diazotrophic bacterial communities associated with corals of the Great Barrier Reef
... coral-associated bacterial communities can be detected across coral species, life stages and reef ...which bacterial communities differed significantly between reef locations and varied ...
170
Abundance, structure and function of zooplankton-associated bacterial communities within the York River, VA
... free-living bacterial community, 5ml o f 5pm filtered York River water was added to a sterile 15-mL centrifuge ...Each sample was sonicated for 40 second on ice with an ultrasonic homogenizer at 4 W output ...
188
Characterization of the total and viable bacterial and fungal communities associated with the International Space Station surfaces
... original sample) and 100 μL of each dilution was plated (in duplicate) on Reasoner’s 2A agar (R2A for envir- onmental bacteria), Potato Dextrose Agar with chloram- phenicol (100 μg/mL; PDA for fungi), and blood ...
21
A Cross-sectional study of diverse bacterial and fungal communities in different body habitats in Sardinian centenarians
... fungi communities in the murine gut [186], while in our cohort different age groups didn‟t display a clear age-dependent ...negatively associated groups: one including Debaryomyces, Saccharomyces and ...
148
Experimental Study on the Phlogopite Weathering Potential of Bacterial Communities Isolated from Different Soil Profiles
... minerals associated with chemical ...soils, bacterial diversity is due to habitat heterogeneity, which involves diversity in terms of resources, physicochemical conditions and biological ...
29
A metagenomic study of bacterial communities associated with the saxitoxin producing dinoflagellate, Pyrodinium bahamense var. Compressum
... AAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGA CTACHVGGGTATCTAATCC-3’ which target the V3 and V4 hypervariable regions of the 16S. The underlined oligonucleotides are the Illumina adapter ...
9
Bacterial communities associated with culex mosquito larvae and two emergent aquatic plants of bioremediation importance.
... examined bacterial communities associated with larval mosquitoes and their ...characterized bacterial communities associated with late larval instars of the western encephalitis ...
12
Introduction of Complementary Foods to Infants within the First Six Months and Associated Factors in Rural Communities of JimmaArjo
... factors associated with early introduction of complementary feeding in the study ...a sample of 382 respondents supplemented by qualitative data generated using in-depth interviews of 15 key ...1-2 ...
8