Death Receptor 5 (DR5)
The Apoptotic Effect of the Methanol Extract of Polygonum cuspidatum through Up Regulation Death Receptor 5 and CHOP in HSC 2 Human Oral Cancer Cells
... of death receptor 5 ...to DR5 up-regulation is required for the anti-cancer ac- tivity of MEPC in HSC-2 cells and MEPC may be a promising drug candidate for oral ...
6
In Vitro and In Vivo Evaluation of 89Zr-DS-8273a as a Theranostic for Anti-Death Receptor 5 Therapy
... anti-human death receptor 5 (DR5) agonistic antibody, has cytotoxic activity against human cancer cells and induces apoptosis after specific binding to ...of DR5 expression in vivo in ...
10
Preparation and functional studies of hydroxyethyl chitosan nanoparticles loaded with anti-human death receptor 5 single-chain antibody
... Materials and methods: The anti-human death receptor 5 single-chain antibody was con- structed and expressed. Protein-loaded hydroxyethyl chitosan nanoparticles were prepared, and their size, ...
9
Gefitinib upregulates death receptor 5 expression to mediate rmhTRAIL-induced apoptosis in Gefitinib-sensitive NSCLC cell line
... follows: DR5 (199bp), 5 ′ –GGGATGGTCAAGGTCGGTG–3 ′ (for- ward) and 5 ′ –CAGCCACAATCAAGACTACGG–3 ′ (reverse); caspase3 (165 bp), 5 ′ –AGAACTG GACTGTG GCATTGAG–3 ′ (forward) and 5 ′ ...
8
The novel proteasome inhibitor carfilzomib activates and enhances extrinsic apoptosis involving stabilization of death receptor 5
... both DR5 and DR4, which are well known death receptors for the death ligand TRAIL, we speculated that CFZ would sensitize cancer cells to TRAIL-induced ...
11
Synthetic ligands of death receptor 5 display a cell-selective agonistic effect at different oligomerization levels
... for DR5 surface expression by flow ...of DR5 on the BJAB cells, with a maximum of 30 % after 2 hours of incubation in our experimental ...since DR5 internalization reached almost 95% after one hour ...
15
The enhanced expression of death receptor 5 (DR5) mediated by HBV X protein through NF kappaB pathway is associated with cell apoptosis induced by (TNF α related apoptosis inducing ligand) TRAIL in hepatoma cells
... and DR5, we detected the expressions of DR4 and DR5 on gene and protein levels in Huh-7-HBX cells and control ...and DR5 but also protein expression of these receptors were significant higher in ...
9
Suppression of death receptor 5 enhances cancer cell invasion and metastasis through activation of caspase-8/TRAF2- mediated signaling
... reduced DR5 expression was reported to be associated with metastatic lesions ...of DR5 expression in primary tumors with metastasis and their matching lymph node metastasis compared to primary tumors with ...
15
Ethanolic extract of Descurainia sophia seeds sensitizes A549 human lung cancer cells to TRAIL cytotoxicity by upregulating death receptors
... bound death receptor 4 (DR4, also known as TRAIL- receptor 1 or TNF receptor superfamily member 10A) and death receptor 5 (DR5, also known as TRAIL-receptor ...
8
Original Article Blocking TRAIL-DR5 signaling with soluble DR5 alleviates acute kidney injury in a severely burned mouse model
... (TRAIL)-Death receptor 5 (DR5) signaling in the pathogenesis of ...and DR5 expression levels were significantly increased in the kidney 24 h after the ...Soluble DR5 treatment ...
9
Transformation of SV40-immortalized human uroepithelial cells by 3-methylcholanthrene increases IFN- and Large T Antigen-induced transcripts
... TRICK2A: death receptor 5 or DR5 (also Apo2; TRAIL-R2; TRICK2; or KILLER); IAP3: inhibitor of apoptosis protein 3; HSIAH2: inhibitor of apoptosis protein 2; IRRP + DAP1: ...
14
Pregnane X receptor activation potentiates ritonavir hepatotoxicity
... cell death and tissue injury, including death receptor 5 (Dr5), BCL2-associated X (Bax), and monocyte chemoattractant protein 1 (Mcp1) in the liver of hPXR/CYP3A4 mice pretreated with ...
7
Nanomedicine and cancer immunotherapy: focus on indoleamine 2,3-dioxygenase inhibitors
... dioxygenase (IDO) enzymatic activity contributes to interferon-gamma induced apoptosis and death receptor 5 expression in human non- small cell lung cancer cells. Asian Pac J C[r] ...
14
The flavokawains: uprising medicinal chalcones
... the death-receptor and mitochondrial-mediated apoptotic me- chanism ...of death receptor 5, Bim and Puma were up-regulated while the expression of survivin, an anti-apoptotic protein ...
7
Original Article Dihydroartemisinin and cisplatinum synergistically induced apoptosis in human lung adenocarcinoma H1299 cells
... Total RNA of each group was extracted using TRIzol (Invitrogen, USA) reagent and cDNA was reversed transcribed using ReverTra Ace qPCR RT Kit (TOYOBO, Dalian, China) following the instruction of the manufacturer. Primers ...
12
Activation of autophagic flux by epigallocatechin gallate mitigates TRAIL-induced tumor cell apoptosis via down- regulation of death receptors
... cell death in PCa cells, while inhibition of autophagy can enhance reagent-induced cell death [40, ...of death receptors DR4 and DR5 (Figure 2 and Figure ...cell death via activation of ...
9
Deregulation of the Egfr/Ras signaling pathway induces age-related brain degeneration in the Drosophila mutant vap
... In Drosophila, many studies have been done to assess the role of the Egfr/Ras signal transduction cascade in cell prolifer- ation, differentiation, and developmental cell survival but little is known about the function ...
10
A Hermeneutical Examination of Creation in Islam at Georgia State University
... 1-(4-Bromophenyl)-4-methylpiperazine (67, EAR-II-148). 1,4-Dibromobenzene (1.0 g, 4.2 mmol), N-methylpiperazine (0.46 mL, 4.2 mmol), 2,2'-bis(diphenylphosphino)-1,1'-binaphthyl (BINAP, 0.20 g, 0.31 mmol), ...
287
Tailored design of NKT-stimulatory glycolipids for polarization of immune responses
... cell receptor with glycolipids presented by ...T-cell receptor V β as α ...T-cell receptor when complexed with ...T-cell receptor, account for their superior anti-cancer efficacy in tumor ...
10
Down-regulation of DcR2 sensitizes androgen-dependent prostate cancer LNCaP cells to TRAIL-induced apoptosis
... cell death is only linked to the DR5 receptor, moreover they found DcR1 receptor expres- sion to be undetectable, whereas DcR2 was significantly more abundant in tumour cells than ...
14