Death Receptor 5 (DR5)

Top PDF Death Receptor 5 (DR5):

In Vitro and In Vivo Evaluation of 89Zr-DS-8273a as a Theranostic for Anti-Death Receptor 5 Therapy

In Vitro and In Vivo Evaluation of 89Zr-DS-8273a as a Theranostic for Anti-Death Receptor 5 Therapy

Background: DS-8273a, an anti-human death receptor 5 (DR5) agonistic antibody, has cytotoxic activity against human cancer cells and induces apoptosis after specific binding to DR5. DS-8273a is currently being used in clinical Phase I trials. This study evaluated the molecular imaging of DR5 expression in vivo in mouse tumor models using SPECT/CT and PET/MRI, as a tool for drug development and trial design. Methods: DS-8273a was radiolabeled with indium-111 and zirconium-89. Radiochemical purity, immunoreactivity, antigen binding affinity and serum stability were assessed in vitro. In vivo biodistribution and pharmacokinetic studies were performed, including SPECT/CT and PET/MR imaging. A dose-escalation study using a PET/MR imaging quantitative analysis was also performed to determine DR5 receptor saturability in a mouse model. Results:

10 Read more

The Apoptotic Effect of the Methanol Extract of Polygonum cuspidatum through Up Regulation Death Receptor 5 and CHOP in HSC 2 Human Oral Cancer Cells

The Apoptotic Effect of the Methanol Extract of Polygonum cuspidatum through Up Regulation Death Receptor 5 and CHOP in HSC 2 Human Oral Cancer Cells

Polygonum cuspidatum is used as a traditional medicinal herb for the therapy of various diseases including several types of cancers. In the present study, we focused on addressing the anti-cancer activity and molecular mechanism of metha- nol extract of Polygonum cuspidatum (MEPC) in HSC-2 human oral cancer cells. The effect of MEPC on oral cancer cells was estimated by 3-(4,5-dimethylthiazol-20yl)-(3-carboxymethoxyphenyl)-2-(4-sulphophenyl)-2H-tetrazolium (MTS) assay, 4’-6-diamidino-2-phenylindole (DAPI) staining and Western blot analysis. MEPC inhibited the cell viability and induced apoptosis through the induction of death receptor 5 (DR5). MEPC also increased the expression of C/EBP ho- mologous protein/growth arrest and the DNA damage-inducible gene 153 (CHOP), a transcription factor induced by ER stress. Thus, we concluded that the induction of CHOP leading to DR5 up-regulation is required for the anti-cancer ac- tivity of MEPC in HSC-2 cells and MEPC may be a promising drug candidate for oral cancer.

6 Read more

Preparation and functional studies of hydroxyethyl chitosan nanoparticles loaded with anti-human death receptor 5 single-chain antibody

Preparation and functional studies of hydroxyethyl chitosan nanoparticles loaded with anti-human death receptor 5 single-chain antibody

Materials and methods: The anti-human death receptor 5 single-chain antibody was con- structed and expressed. Protein-loaded hydroxyethyl chitosan nanoparticles were prepared, and their size, morphology, particle-size distribution and surface zeta potential were measured by scanning electron microscopy and laser particle-size analysis. Mouse H22 hepatocellular carcinoma cells were cultured, and growth inhibition was examined using the CellTiter-Blue cell-viability assay. Flow cytometry and Hoechst 33342 were employed to measure cell apoptosis. Kunming mice with H22 tumor models were treated with protein-loaded hydroxyethyl chitosan nanoparticles, and their body weight and tumor size were measured, while hematoxylin and eosin staining was used to detect antitumor effects in vivo and side effects from tumors.

9 Read more

Synthetic ligands of death receptor 5 display a cell-selective agonistic effect at different oligomerization levels

Synthetic ligands of death receptor 5 display a cell-selective agonistic effect at different oligomerization levels

endocytosis in BJAB cells but also in HCT116 and Jurkat cell lines, cells were incubated with a dose (EC50) of 2d or SPK for different time periods and assessed for DR5 surface expression by flow cytometry. In accordance with the litterature, SPK induced internalization of DR5 on the BJAB cells, with a maximum of 30 % after 2 hours of incubation in our experimental conditions. 2d had the same effect, although with faster kinetic since DR5 internalization reached almost 95% after one hour of incubation (Figure 5A). More surprisingly, the same profiles were obtained with both SPK and 2d when incubated with Jurkat cells (Figure 5B). Indeed, the kinetic of internalization of DR5, reaching 65 % after 15 minutes and a maximum of 85 % after 2 hours upon 2d treatment, was faster than upon SPK treatment, reaching only 37 % after 15 minutes and 52 % after 2 hours. In HCT116, 2d induced a clear internalization of DR5 (approximately 50% after 1 hour) whereas SPK did not induce any internalization. In all cases, internalization of DR5 was confirmed by immunocytochemistry experiments. A clear cytosolic localization of DR5 was depicted in

15 Read more

The novel proteasome inhibitor carfilzomib activates and enhances extrinsic apoptosis involving stabilization of death receptor 5

The novel proteasome inhibitor carfilzomib activates and enhances extrinsic apoptosis involving stabilization of death receptor 5

Carfilzomib (CFZ) is a second generation proteasome inhibitor approved for the treatment of patients with multiple myeloma. It induces apoptosis in human cancer cells; but the underlying mechanisms remain undefined. In the present study, we show that CFZ decreases the survival of several human cancer cell lines and induces apoptosis. Induction of apoptosis by CFZ occurs, at least in part, due to activation of the extrinsic apoptotic pathway, since FADD deficiency protected cancer cells from undergoing apoptosis. CFZ increased total and cell surface levels of DR5 in different cancer cell lines; accordingly it enhanced TRAIL-induced apoptosis. DR5 deficiency protected cancer cells from induction of apoptosis by CFZ either alone or in combination with TRAIL. These data together convincingly demonstrate that DR5 upregulation is a critical mechanism accounting for CFZ-induced apoptosis and enhancement of TRAIL-induced apoptosis. CFZ inhibited the degradation of DR5, suggesting that DR5 stabilization contributes to CFZ-induced DR5 upregulation. In summary, the present study highlights the important role of DR5 upregulation in CFZ-induced apoptosis and enhancement of TRAIL-induced apoptosis in human cancer cells.

11 Read more

TRAIL induces apoptosis in oral squamous carcinoma cells: a crosstalk with oncogenic Ras regulated cell surface expression of death receptor 5

TRAIL induces apoptosis in oral squamous carcinoma cells: a crosstalk with oncogenic Ras regulated cell surface expression of death receptor 5

Next, we tested the cellular responses to the agonist antibodies against DR4 or DR5. The results showed that TRAIL-sensitive cell lines (HN31, HN30 and HN4) were selectively sensitive to both DR4 and DR5 monoclonal antibodies (Figs. 2A & 2B), which correlated with the extent of apoptosis (Figs. 2C & 2D) in the corresponding samples. Anti-DR5 antibody also induced growth inhibition and apoptosis in HN6, HN12 and OSCC3 lines (Fig. 2B & 2D). However, anti-DR4 antibody showed a different cytotoxicity profile where it induced apoptosis in all five cell lines, but not HN6 (Fig. 2A & 2C). The resistance of HN6 cells persisted at higher concentrations of anti-DR4 up to 100 µg/mL (data not shown). Nevertheless, these results demonstrate a significant number of OSCC cell lines that are susceptible to both rhTRAIL and its agonistic antibodies. The results warrant additional studies to assess the potential utility of TRAIL receptor targeted biologic agents in the treatment of oral squamous cell carcinomas.

12 Read more

Gefitinib upregulates death receptor 5 expression to mediate rmhTRAIL-induced apoptosis in Gefitinib-sensitive NSCLC cell line

Gefitinib upregulates death receptor 5 expression to mediate rmhTRAIL-induced apoptosis in Gefitinib-sensitive NSCLC cell line

Methods: Human PC9 non-small cell lung cancer cells harboring an epidermal growth factor receptor mutation were used as a model for the identification of the therapeutic effects of gefitinib alone or in combination with rmhTRAIL, and cytotoxicity was assessed by MTT assays. Cell cycle and apoptosis were investigated using flow cytometry. Moreover, the effects of drugs on DR5, BAX, FLIP, and cleaved-caspase3 proteins expressions were analyzed using Western blot analyses. Finally, quantitative polymerase chain reaction analysis was carried out to assess whether rmhTRAIL and gefitinib modulate the expression of genes related to drug activity. Results: Gefitinib and rmhTRAIL synergistically interact to inhibit cell proliferation, and apoptosis assessment demonstrated that associations of drug increased the apoptotic index. rmhTRAIL when used alone downregulated DR5 and upregulated BAX, FLIP, and cleaved- caspase3 proteins expressions. However, results obtained in Western blot analyses demonstrated that the combined treatment-induced cell apoptosis was achieved involving upregulated DR5, cleaved-caspase3, and BAX proteins expression and downregulated FLIP protein expression. Moreover, quantitative polymerase chain reaction showed that gefitinib modulated the expres- sion of targets related to rmhTRAIL activity.

8 Read more

The enhanced expression of death receptor 5 (DR5) mediated by HBV X protein through NF kappaB pathway is associated with cell apoptosis induced by (TNF α related apoptosis inducing ligand) TRAIL in hepatoma cells

The enhanced expression of death receptor 5 (DR5) mediated by HBV X protein through NF kappaB pathway is associated with cell apoptosis induced by (TNF α related apoptosis inducing ligand) TRAIL in hepatoma cells

TTGGTTCTTCTG and TTAGGGTTT AAATGTATAC CC. Primers for β-actin amplificaiton were GGCATCGT- GAT GGACTCCG and GCTGGAAGGTGGACAGCGA. The UitraTaq enzyme PCR kit was used for PCR reaction and amplification condition was 94 °C for 5 min, followed with 94 °C for 40 s, 67 °C for 30 s, 72 for 1 min for 30 cy- cles and a final extension at 72 for 10 min each. The PCR products were subjected to electrophoresis in 1 % agarose gel and visualized by ethidiun bromide staining. The real- time PCR primers for DR4, DR5 AND GAPDH were CTGAGCAACGCAGAC TCGCTGTCCAC and TCAAA GGACACGGCAGAGCCTGTGCCA, GGGAGCCGCT- CATGAGGAAGTT GG and GGCAAGTCTCTCTCCCA GCGTCTC, TGGAA GGACTCATGACCACA and TT CAGCTCAGGGATGACCTT, respectively. The real-time PCR was performed with a SYBR master mix (Toyobo, Japan), and amplification conditions were as follows: 94 °C for 3 min, and followed by 40 cycles of 95 °C for 30s, 60 °C for 30 s, 72 for 30s. The relative mRNA expression levels of DR4 and DR5 were normalized based on the GAPDH in each group.

9 Read more

Suppression of death receptor 5 enhances cancer cell invasion and metastasis through activation of caspase-8/TRAF2- mediated signaling

Suppression of death receptor 5 enhances cancer cell invasion and metastasis through activation of caspase-8/TRAF2- mediated signaling

Mutations in DR5 have been identified in various human tumors [20, 28–31]. Most mutations identified so far are located in and affect the intracellular death domain of the receptor, a region essential for binding to FADD. For example, mutations in the death domain were detected in 10% of non-small cell lung cancers [28] and in 12% of breast cancers exclusively from patients with lymph node metastasis [20]. These tumor-derived mutations very often result in DR5 losing its ability to form a functional DISC and to induce apoptosis [32, 33]. They can also function as dominant-negative mutants to inhibit death signaling [32]. Therefore, this is a relevant example of DR5 suppression under a physiological or cancer-related condition. The fact that approximately 12% of DR5 mutations were detected exclusively in metastatic breast cancers [20] strongly supports our finding that DR5 suppression may have a critical role in promoting metastasis of human cancer.

15 Read more

Original Article Blocking TRAIL-DR5 signaling with soluble DR5 alleviates acute kidney injury in a severely burned mouse model

Original Article Blocking TRAIL-DR5 signaling with soluble DR5 alleviates acute kidney injury in a severely burned mouse model

Abstract: Acute kidney injury (AKI) predicts high mortality in severely burned patients. Apoptosis plays a significant role during AKI; however, the apoptotic mechanisms underlying AKI induced by burn injury are not clear. Here, we report a critical role for tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL)-Death receptor 5 (DR5) signaling in the pathogenesis of AKI. C57BL/6 male mice were subjected to full thickness scald burn. Apoptosis was significantly up-regulated in mouse kidney 24 h after the burn. Meanwhile, the TRAIL and DR5 expression levels were significantly increased in the kidney 24 h after the burn. Soluble DR5 treatment reduced apoptotic cell death and alleviated kidney injury induced by the burn through blocking the interaction of endogenous TRAIL with DR5. These results demonstrated that TRAIL plays a deleterious role in AKI pathogenesis induced by scald burns. Inhibi- tion of TRAIL function in the kidney may represent a novel protective strategy to treat AKI in patients with burns.

9 Read more

Ethanolic extract of Descurainia sophia seeds sensitizes A549 human lung cancer cells to TRAIL cytotoxicity by upregulating death receptors

Ethanolic extract of Descurainia sophia seeds sensitizes A549 human lung cancer cells to TRAIL cytotoxicity by upregulating death receptors

In the mid-1990s, tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL), a new member of the TNF superfamily, was discovered [5, 6]. As a cytotoxic cytokine, TRAIL selectively induces apoptosis in tumor cells through homotrimeric binding to the membrane- bound death receptor 4 (DR4, also known as TRAIL- receptor 1 or TNF receptor superfamily member 10A) and death receptor 5 (DR5, also known as TRAIL-receptor 2 or TNF receptor superfamily member 10B), the recruitment of Fas-associated death domain protein (FADD), the formation of the death-inducing signaling complex (DISC), and the subsequent activation of caspase-8 and effector caspase-3 (extrinsic pathway). Activated caspase-8 also triggers the intrinsic apoptotic pathway by cleaving BH3-interacting domain death agonist (Bid); truncated Bid translocates to the mitochondria and induces cyto- chrome C release from the mitochondria, thereby acti- vating caspase-9 and caspase-3 [7–9]. TRAIL is an attractive anticancer therapeutic due to its ability to induce apoptosis in a broad spectrum of cancer cells while sparing most normal cells [10–12]. However, the clinical application of TRAIL therapy has been limited by its inherently short half-life in blood (3 – 5 min in rodents and 24–31 min in non-human primates), in- sufficient delivery to the targets, and the appearance of cancer cell populations with intrinsic or acquired resistance to TRAIL-mediated programmed cell death [13, 14]. Improvements in the plasma half-life of TRAIL and delivery efficiency of TRAIL have been attempted by manipulating its structure, such as by creating fusions with the immunoglobulin Fc domain [15] or by coupling or encapsulating TRAIL into liposomes [14, 16]. The de- velopment of an agonistic monoclonal antibody (mAb) or chimeric antigen receptors specific for TRAIL receptors are additional potential strategies for overcoming TRAIL instability [17].

8 Read more

Pregnane X receptor activation potentiates ritonavir hepatotoxicity

Pregnane X receptor activation potentiates ritonavir hepatotoxicity

Oxidative stress can lead to endo- plasmic reticulum (ER) stress (34). Indeed, we found that the ER is a tar- get organelle of RTV hepatotoxicity, as electron-microscopic analysis revealed massive ER dilation in hepatocytes of hPXR/CYP3A4 mice pretreated with RIF for 7 days followed by RTV (Figure 4A). In addition, lead-in treatment with RIF followed by RTV caused severe ER stress in the livers of hPXR/ CYP3A4 mice, as indicated by increased expression of ER stress biomarker mRNAs, including C/EBP homologous protein (Chop), binding immunoglobulin protein (Bip), and cyclic AMP-depen- dent transcription factor 3 (Atf3) (Figure 4, B and C). ER stress also occurred in the livers of hPXR/CYP3A4 mice pretreated with EFV for 7 days followed by RTV, but not in hPXR/Cyp3a-null mice with the same treatment (Supplemental Figure 9). Persistent ER stress can lead to cell death (34). Concordantly, we observed a significant increase in the expression of mRNAs encoded by genes associated with cell death and tissue injury, including death receptor 5 (Dr5), BCL2-associated X (Bax), and monocyte chemoattractant protein 1 (Mcp1) in the liver of hPXR/CYP3A4 mice pretreated with RIF for 7 days followed by RTV, but not in hPXR/Cyp3a-null mice (Figure 4, D–F). These data suggest that lead-in treatment with PXR acti- vators followed by RTV causes ER stress and hepatocellular injury and that it is CYP3A4 dependent.

7 Read more

A Hermeneutical Examination of Creation in Islam at Georgia State University

A Hermeneutical Examination of Creation in Islam at Georgia State University

General procedure for the synthesis of 15 -18. To a mixture of 2-chloro-4-vinylpyrimidine (0.115 g, 1.0 mmol) in toluene (5.0 mL) was added the corresponding nucleophile (dimethylamine, benzylamine, methoxide or ethane thiolate) (0.14 g, 1.0 mmol). The mixture was stirred at room temperature overnight or at 90 °C for 2 h, then cooled to room temperature, basified with sodium carbonate and extracted with ethyl ether (2 × 15 mL). The organic extracts were combined, dried over magnesium sulfate, and concentrated in vacuo to provide crude 2-chloro-4-substituted pyrimidine derivatives 11 – 14, that without further purification were used for the reaction with N- methylpiperazine. Thus, a solution of crude compounds 11 – 14 and N-methylpiperazine (0.14 mL, 1.2 mmol) in toluene (4.0 mL) was heated to 80 °C until a TLC analysis on silica gel eluting with hexanes/ethyl ether (80:20) showed the absence of 11 – 14 (several hours). The solution was cooled to room temperature, basified with sodium carbonate and extracted with ethyl ether (2 × 15 mL). The organic extracts were combined, dried over magnesium sulfate, and concentrated in vacuo to provide crude compounds 15 – 18. The crude products were purified on a chromatotron with normal phase EMD 60PF 254 silica gel eluting with hexanes/ethyl ether/methanol (80:15:5) to

287 Read more

Deregulation of the Egfr/Ras signaling pathway induces age-related brain degeneration in the Drosophila mutant vap

Deregulation of the Egfr/Ras signaling pathway induces age-related brain degeneration in the Drosophila mutant vap

The same suppression effect can be observed using a temperature-sensitive allele of the Egfr and aging the adult flies at the restrictive temperature. This experiment shows that a deregulation of the Egfr signaling pathway in adult vap flies is sufficient to cause degeneration of mature neu- rons. Strikingly, strong expression of the Egfr and Ras genes can be found in the brain of adult flies (Schejter et al., 1986; Segal and Shilo, 1986), and although nothing is known about their possible function in the adult fly brain, the suppression of the phenotype in adult vap mutants by reducing the Egfr activity shows that the Egfr is active in Drosophila adult neurons. This is consistent with the onset of the phenotype that takes place only in the adult fly. Signaling through the Egfr seems to induce, therefore, high levels of active Ras, which might be the cause of the phenotype. Genetic inter- actions with drk and sprouty, members of the Egfr/Ras path- way, also support this idea. Drk is a signaling protein that has been shown to bind in vitro the C terminal tail of the SOS protein, thereby linking receptor tyrosine kinase to Ras ac- tivation (Olivier et al., 1993). It has been also found that Drk signals to the Ras protein in vivo (Raabe et al., 1995). There- fore, reducing the levels of Drk might lead to a decrease of the levels of activated Ras in the vap mutant and to the subsequent suppression of the phenotype.

10 Read more

Oncolytic Vesicular Stomatitis Virus Induces Apoptosis in U87 Glioblastoma Cells by a Type II Death Receptor Mechanism and Induces Cell Death and Tumor Clearance In Vivo

Oncolytic Vesicular Stomatitis Virus Induces Apoptosis in U87 Glioblastoma Cells by a Type II Death Receptor Mechanism and Induces Cell Death and Tumor Clearance In Vivo

In some cell types, cross talk between the death receptor and mitochondrial apoptotic pathways is required for efficient in- duction of cell death. Death receptor signaling has been clas- sified as type I or type II, depending on whether signaling is independent of the mitochondrial pathway (type I) or depends on amplification by the mitochondrial pathway (type II) (38, 39). The death receptor pathway can activate the mitochon- drial pathway through caspase-8 cleavage of the proapoptotic BH3-only protein Bid. Cleaved Bid (truncated Bid [tBid]) then promotes destabilization of the mitochondria through activa- tion of proapoptotic mitochondrial proteins. Previous results from our laboratory indicated that activation of the mitochon- drial pathway by wt VSV is due in part to the activity of Bid (35). This raises the question of whether cross talk through Bid can be an important mechanism of cell death induced by M protein mutant VSV. In results presented here, we show that human GBM cells require a type II death receptor pathway to undergo apoptosis in the presence of an oncolytic M protein mutant VSV, M51R VSV. Unexpectedly, inhibition of apop- tosis by overexpression of antiapoptotic Bcl-X L had little if any effect on the time course of clearance of human GBM xeno- grafts in immunodeficient mice following treatment with M51R VSV. However, the pathological changes in tumors following treatment with virus were quite different in the pres- ence versus the absence of Bcl-X L overexpression. These re-

10 Read more

Determinants of death among under 5 children in Bangladesh

Determinants of death among under 5 children in Bangladesh

This present study revealed vitamin A deficiency as a significant predictor for U5CM. The risk to die had higher in children who did not feed vitamin A capsules during their two months of age. This finding is also consonant with many previous studies in developing countries [Rahmathullah et al., 2003, Klemm et al., 2008, Imdad et al., 2011, Humphrey et al., 1996]. Further, birth status (single vs. multiple) possessed a significant association dying at early childhood period. Children of multiple births were 12.40 times more likely to die before age 5 relative to the reference group of single birth. Previous studies in Bangladesh also identified multiple birth as a significant determinant of U5 mortality [Alam et al., 2007, Hong, 2006]. Besides, similar findings are found from Ethiopia [Bereka et al., 2017] and Zimbabwe [Kembo et al., 2009]. Since a large proportion of multiple birth child die before reaching their 5 years of age, future longitudinal study is required to increase the survival rate among multiple birth children.

14 Read more

Original Article Oxidative stress pathways of flavonoid toxicity in human breast tumor cells

Original Article Oxidative stress pathways of flavonoid toxicity in human breast tumor cells

nificant differences between 2.5 µM and 10.0 µM, and 10.0 µM and 50.0 µM naringenin showing a near linear response (Figure 7). This is consistent with finding by Suski [88] who found that during apoptosis MMP and activity of the respiratory chain decreased coincident with an increase in ROS production. However, for NT and ER+ no significant changes in MMP were detected (Figure 7). Overall the percent of dead cells positive for RHO dye was low with the highest percent at 9.0±0.62% for ER- cells. This suggests that other mechanisms may be at play affecting mitochondrial integrity includ- ing deficiency in oxidizable substances for mito- chondria, blockage of respiration, and with- drawal of growth factors and lack of extra cellular glucose supply [27, 89-92]. In addition, pathways leading to cell death do not necessar- ily involve mitochondria but rather can directly affect nuclear DNA leading to cell death. Take in it is entirety there was a clear difference in cell susceptibility to naringenin between NT, ER- and ER+ cells with respect to oxidative stress. Of significant ROS and O 2 - percents

14 Read more

Original Article Vagus nerve stimulation causes wake-promotion by affecting neurotransmitters via orexins pathway in traumatic brain injury induced comatose rats

Original Article Vagus nerve stimulation causes wake-promotion by affecting neurotransmitters via orexins pathway in traumatic brain injury induced comatose rats

housed in the Laboratory Animal center of the First Affiliated Hospital of Nanchang University (Nanchang, Jiangxi Province, China), and were maintained under controlled temperature and light conditions with food and water continu- ously available. Animals were divided into four groups: control group, TBI group, stimulated (TBI+VNS) and antagonist groups (TBI+SB- 334867+VNS). Each group comprised 30 rats. Rats in the TBI, stimulated, and antagonist groups were anesthetized using diethyl ether inhalation and allowed to breathe air spontane- ously. After anesthesia, the skull was exposed via a 5 mm vertical incision using conventional surgical techniques. A cross hit point was marked by a syringe needle at 2 mm left of the midline and 1 mm anterior to the coronal suture. A cylindrical impact hammer weighing 400 g was dropped from a vertical height of 40-44 cm along a previously marked space, resulting in a concave fracture of skull [20]. After injury, the incision was closed, and the animal was disinfected and moved to a cage. One hour later, they were classified into degrees of I-VI consciousness according to sensory and motor functions [21]. Degree I: Normal activity freely engaged in cages; degree II: decreased activity; degree III: decreased activity with motor in coordination; degree IV: righting reflex could be elicited and animals could stand up; degree V: righting reflex disappeared and ani- mals could react to pain; degree VI: animals have no reaction to pain. We defined rats in degrees V and VI, which lasted at least 30 min- utes, as rats in a comatose state and suitable for the following procedures.

10 Read more

<p>Use of Programmed Death Receptor-1 and/or Programmed Death Ligand 1 Inhibitors for the Treatment of Brain Metastasis of Lung Cancer</p>

<p>Use of Programmed Death Receptor-1 and/or Programmed Death Ligand 1 Inhibitors for the Treatment of Brain Metastasis of Lung Cancer</p>

Abstract: The central nervous system (CNS) is regarded as an immune privileged environment; however, changes in the neuroimmunology paradigm have led to an increased interest in systematic immunotherapy in lung cancer therapy. The presence of the lymphatic system in the CNS as well as the physiological and biochemical changes in the blood – brain barrier in the tumor microenviron- ment suggests that immunocytes are fully capable of entering and exiting the CNS. Emerging clinical data suggest that inhibitors of programmed death receptor-1/programmed death ligand 1 (PD-1/PD-L1) can stimulate surrounding T cells and thus have antitumor effects in the CNS. For example, PD-1 antibody (pembrolizumab) monotherapy has displayed a 20 – 30% encephalic response rate in patients with brain metastases from malignant melanoma or non-small cell lung cancer. Combined application of nivolumab and ipilimumab anti-PD-1 and anti-cytotoxic T-lymphocyte-associated protein 4 showed an encephalic response rate of 55% in patients with brain metastases of melanoma. Further evidence is required to verify these response rates and identify the mechanisms of curative effects and drug tolerance. While regional treatments such as whole-brain radiosurgery, stereotactic radiosurgery, and brain surgery remain the mainstream, PD- 1/PD-L1 inhibitors display potential decreased neurotoxic effects. To date, fi ve drugs have been approved for use in patients with encephalic metastases of lung carcinoma: the anti-PD-1 drugs, pembrolizumab and nivolumab, and the anti-PD-L1 agents, atezolizumab, durvalumab, and avelu- mab. In recent years, clinical trials of inhibitors in combination with other drugs to treat brain metastasis have also emerged. This review summarizes the biological principles of PD-1/PD-L1 immunotherapy for brain metastasis of lung cancer, as well as ongoing clinical trials to explore unmet needs.

17 Read more

N Methyl d Aspartate (NMDA) Receptor Blockade Prevents Neuronal Death Induced by Zika Virus Infection

N Methyl d Aspartate (NMDA) Receptor Blockade Prevents Neuronal Death Induced by Zika Virus Infection

based on previous reports indicating that this dose was sufficient to improve a number of alterations exhibited by AD and stroke mouse models (46, 47). Memantine treatment (30 mg/kg of body weight twice a day [b.i.d.]), starting on day 3 postinfection, failed to prevent the course of certain disease manifestations induced by ZIKV infection (see Fig. S5A and S5C to G in the supplemental material). ZIKV inoculation induced body weight loss starting at day 5 of infection in both vehicle- and memantine-treated groups (Fig. S5A). In accordance, ZIKV infection induced a similar increase in MPO activity (Fig. S5C) and production of chemokines and cytokines in the brain of vehicle- and memantine-treated ZIKV-infected mice (Fig. S5D to G). However, total and differ- FIG 5 NMDAR blockade prevents ZIKV-induced neuronal cell death in vitro. Shown are primary cultured cortical-striatal neurons from C56BL/6 embryos (E15) on day 5 of differentiation in vitro. (A and B) NMDAR antagonist treatment was performed after infection (adsorption time) and every 24 h. Analyses were performed 72 h after ZIKV infection. Memantine, MK-801, and agmatine were given at different concentrations: 10 and 100 nM and 1, 10, and 30 ␮ M for memantine, 1, 10, and 100 ␮ M for MK-801, and 0.4, 2, 10, and 50 ␮ M for agmatine. For ifenprodil dose-response, the concentrations were 0.0001, 0.001, and 0.01 ␮ M. (A) Memantine’s effect on neuronal cell death was analyzed by LIVE/DEAD assay 72 h after ZIKV infection (MOI of 1). Results are represented as percentage of dead neurons. (B) Viral load was recovered from culture supernatant 72 h after ZIKV infection. Results are shown as PFU per milliliter of culture supernatant. (C) Cell death was analyzed by LIVE/DEAD assay 72 h after ZIKV infection following MK-801 treatment (MOI of 1). Results are represented as percentage of dead neurons. (D) Cell death was analyzed by LIVE/DEAD assay 72 h after ZIKV infection following agmatine sulfate treatment (MOI of 1). Results are represented as percentage of dead neurons. (E) Cell death was analyzed by LIVE/DEAD assay 72 h after ZIKV infection following ifenprodil treatment (MOI of 1). Results are represented as percentage of dead neurons. Results are expressed as mean ⫾ SEM (A, C, and D) or the median (B) and are representative of four independent experiments. *, P ⬍ 0.05 compared to control uninfected neurons; #, P ⬍ 0.05 compared to ZIKV-infected neurons.

16 Read more

Show all 10000 documents...