deformed wing virus (DWV)
The role of deformed wing virus in the initial collapse of varroa infested honey bee colonies in the UK
... obscure virus, deformed wing virus (DWV) has become the most prevalent honey bee virus after the appearance of varroa in all countries where the mite has become established, thus ...
9
Localization of deformed wing virus infection in queen and drone Apis mellifera L
... of deformed wing virus infection within the honey bee reproductive castes (queens, drones) was investigated by in situ hybridization and immunohistology from paraffin embedded ...the DWV ...
5
A comparison of deformed wing virus in deformed and asymptomatic honey bees
... Abstract: Deformed wing virus (DWV) in association with Varroa destructor is currently attributed to being responsible for colony collapse in the western honey bee (Apis ...of deformed ...
13
The spread and evolution of RNA viruses among honey bees and the wider insect community with particular emphasis on deformed wing virus (DWV)
... Deformed wing virus and other viruses once thought to be ‘honey bee viruses’ are now understood to be widespread generalists capable of infecting diverse ...for virus spillover and emergence ...
220
Polymerase Chain Reaction detection of deformed wing virus (DWV) in Apis mellifera and Varroa destructor
... of deformed wing virus (DWV) in Apis mellifera ...from DWV infected individual mite or bee produced a 395 nucleotide DNA fragment clearly identifiable by agarose gel ...having ...
10
Diversity in a honey bee pathogen : first report of a third master variant of the deformed wing virus quasispecies
... with Deformed Wing Virus (DWV) type A variant (Dainat et ...2009). DWV, a member of the single-stranded positive-sense RNA genus Iflavirus (Lanzi et al, 2006), exists as a group of ...
11
Honey Bee Deformed Wing Virus Structures Reveal that Conformational Changes Accompany Genome Release
... picornavirus-like deformed wing virus (DWV) has been directly linked to colony collapse; however, little is known about the mechanisms of host at- tachment or entry for DWV or its ...
15
Covert deformed wing virus infections have long term deleterious effects on honeybee foraging and survival
... that deformed wing virus (DWV) represents an important long-term stressor, as it has been statistically associated with both winter mortality and colony collapse in many studies ...[14-24]. ...
27
Molecular approaches to the analysis of deformed wing virus replication and pathogenesis in the honey bee, Apis mellifera
... of Deformed Wing Virus (DWV), a highly prevalent honey bee virus that causes wing deformity and mortality in honey bees worldwide, in both bees with wing deformity ...
9
Evidence of Varroa mediated deformed wing virus spillover in Hawaii
... the Deformed Wing virus, resulting in a spillover ...The virus was found in non-Apis species on Oahu, and island where the mite is ...the virus was not found in non-Apis species on ...
13
Development of a Honey Bee RNA Virus Vector Based on the Genome of Deformed Wing Virus
... tagged DWV constructs. While deletion of foreign gene from RNA virus vector genomes were reported previously [37,38], this was the first study of the genetic stability of a picorna-like RNA virus ...
16
Molecular and Biological Characterization of Deformed Wing Virus of Honeybees (Apis mellifera L.)
... the DWV nucleotide and predicted amino acid sequences revealed a perfect match with the N-terminal amino acid sequences and with mass spectrometry data of the purified structural proteins, proving that the ...
12
Localization of deformed wing virus (DWV) in the brains of the honeybee, Apis mellifera Linnaeus
... The DWV left primer sequence was (5'-AGCATGGGTGAAGAAATGTC-3'), and the DWV right primer sequence was (5'-ATATGAATGTGCCG- CAAACA-3'), which amplifies the region between base 5288 and 5390 on the DWV ...
7
Deformed wing virus is a recent global epidemic in honeybees driven by Varroa mites
... One Sentence Summary: Honeybees are undergoing a DWV pandemic, coinciding with the emergence of the Varroa mite, with the global spread driven by Western bee populations.... Main Text: T[r] ...
12
Recombinants between Deformed wing virus and Varroa destructor virus 1 may prevail in Varroa destructor infested honeybee colonies
... qPCR, DWV Structural (4917-4939), F 1384 GGAGCTTCTGGAACGGCAGGT qPCR, DWV Structural (5013-4993), R 1425 TTCATTAAAACCGCCAGGCTCT qPCR, VDV-1 Non-structural (8623-8644), F 1426 CAAGTTCAGGTCTCATCCCTCT qPCR, ...
19
Evidence for damage dependent hygienic behaviour towards Varroa destructor parasitised brood in the western honey bee, Apis mellifera
... and deformed wing virus (DWV) poses an especially serious threat to honey bee ...of DWV may cause fatal DWV infections in the developing bee, while pupae parasitised by mites not ...
8
ABC assay : method development and application to quantify the role of three DWV master variants in overwinter colony losses of European honey bees
... Abstract: Deformed wing virus (DWV) is one of the most prevalent honey bee viral pathogens in the ...viruses, DWV is a quasi-species, which is comprised of a large number of different ...
15
Deformed wing virus is a recent global epidemic in honeybees driven by Varroa mites
... 2009 deformed NA VDV-1 KP765082 NA FRYB2D France A. mellifera 2009 deformed VDV-1 VDV-1 KP765083 KP734710 FRYB2H France ...2009 deformed VDV-1 VDV-1 KP765085 NA FRYB4D France A. mellifera 2009 ...
28
Molecular and phylogenetic characterization of honey bee viruses, Nosema microsporidia, protozoan parasites, and parasitic mites in China
... paralysis virus (ABPV), black queen cell virus (BQCV), chronic bee paralysis virus (CBPV), deformed wing virus (DWV), Israeli acute paralysis virus (IAPV), Kashmir ...
15
Flight performance of actively foraging honey bees is reduced by a common pathogen
... and Deformed Wing Virus complex (DWV) for each ...of DWV reduced flight distance by two thirds and duration by one ...of DWV was shown to have a significant, but weakly positive ...
11