Flagellin P
Maf dependent bacterial flagellin glycosylation occurs before chaperone binding and flagellar T3SS export.
... unglycosylated flagellin in the secreted fractions, we ana- lysed the flagellin isolated from the precipitated culture supernatant of a maf1 mutant strain and the glycosylated flagellin sheared from ...
16
Extracellular secretion of a recombinant therapeutic peptide by Bacillus halodurans utilizing a modified flagellin type III secretion system
... Initially, a number of different genetically engineered strains of B. halodurans BhFD05 were compared. The secretion efficiency of the fusion proteins was deter- mined by comparing the levels of the recombinant peptide ...
10
Incorporation of Membrane-Anchored Flagellin into Influenza Virus-Like Particles Enhances the Breadth of Immune Responses
... membrane-anchored flagellin on enhancing the production of cytokines, cytokine secretions from splenocytes of mice immunized with flagellin- containing VLPs were determined and compared to those of the ...
11
Method for the isolation of highly purified Salmonella flagellins
... The 10 flagellin preparations were of a high degree of purity, as demonstrated by electron microscopy, sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and measurement of salmo[r] ...
5
The Aeromonas caviae AHA0618 gene modulates cell length and influences swimming and swarming motility
... In recent years, it has been established that a number of bacteria can posttranslationally modify their flagellin protein subunits by the addition of sugars via the O- glycosylation of serine or threonine residues ...
15
Immunogenicity and Efficacy of Flagellin-Envelope Fusion Dengue Vaccines in Mice and Monkeys
... FljB flagellin phase 2 (STF2) at the carboxyl terminus, replacing domain 3 (R3), or at both the C-terminal and R3 positions ...on flagellin- EIII fusion proteins have been demonstrated to elicit protective ...
10
Differentially-expressed genes in rice infected by Xanthomonas oryzae pv. oryzae relative to a flagellin-deficient mutant reveal potential functions of flagellin in host–pathogen interactions
... of flagellin, caused these defense responses and a strong inhibition of growth in ...1999). FLAGELLIN SEN- SITIVE2 (FLS2), the receptor that recognizes flagellin in ...2000). Flagellin and ...
11
Flagellin concentrations in expectorations from cystic fibrosis patients
... express flagellin. This is the first time that flagellin concentrations in the sputum of CF pa- tients has been ...carry flagellin producing ...while flagellin seems to be always present in ...
7
Flagellin attenuates experimental sepsis in a macrophage dependent manner
... whether flagellin was sufficient to improve mortality in lethal sepsis, we examined the effects of flagel- lin administration using a mouse model of CLP-induced le- thal ...of flagellin 2 h after CLP ...
14
Evidence for recombination in the flagellin locus of Campylobacter jejuni: implications for the flagellin gene typing scheme
... conserved flagellin profiles across different pulsed-field gel electrophore- sis types and ribotypes ...that flagellin gene typing should not be used as the sole basis for epidemiological grouping of ...
7
NRC4 gene cluster is not essential for bacterial flagellin-triggered immunity
... ATACA AAAAACGGTACATACC----CAG AGG ATGC—(80bp)—CTAC AGTCAGGAATCTTGCAGCTG AGG TTCAA premature stop 122 aa, 12% ATACA AAAAACGGTACATACC----CAG AGG ATGC—(80bp)—CTAC AGTCAGGAATCTTGCA--CTG AG[r] ...
12
Modeling and analysis of a microresonating biosensor for detection of salmonella bacteria in human blood
... The scattering matrix method is used for the analytical formulation to analyze the behavior of the electric field propagation inside the MRR system. The baseline unit flow cell is contained blood sample with no SB ...
15
Murine Monoclonal Antibodies againstEscherichia coli O4 Lipopolysaccharide and H5 Flagellin
... 6. Cobeljic, M., B. Miljkovic-Selimovic, D. Paunovic-Todosijevic, Z. Velickovic, Z. Lepsanovic, N. Zec, D. Savic, R. Ilic, S. Konstantinovic, B. Jovanovic, and V. Kostic. 1996. Enteroaggregative Escherichia coli ...
5
Dual-linker gold nanoparticles as adjuvanting carriers for multivalent display of recombinant influenza hemagglutinin trimers and flagellin improve the immunological responses in vivo and in vitro
... The maturation efficacy of BMDCs and JAWS II cells by AuNPs-HA/FliC or soluble antigens and adjuvants was compared by measuring the expression of cell surface markers MHC class II, CD80, CD86, and CD40. As shown in ...
16
Campylobacter Colonization in Turkey Flocks Reared in North Carolina
... There are highly conserved and variable regions present in the flagellin gene locus of Campylobacter. These attributes make this region a suitable region for PCR-RFLP. Several different restriction enzymes may be ...
84
NRC4 gene cluster is not essential for bacterial flagellin-triggered immunity
... Wu CH, Belhaj K, Bozkurt TO, Birk MS, Kamoun S (2016) Helper NLR proteins NRC2a/b and NRC3 but not NRC1 are required for Pto-mediated cell death and resistance in Nicotiana benthamiana. [r] ...
9
Clonal Relationships among ShigellaSerotypes Suggested by Cryptic Flagellin Gene Polymorphism
... subunit, flagellin (18), which carries antigenic determinants of the H (flagellar) anti- ...the flagellin amino acid sequence and its structural gene ...of flagellin are important for the structure ...
5
Characterization of flagella purified from enterohemorrhagic, vero cytotoxin producing Escherichia coli serotype O157:H7
... The effect of bacterial proteases on the size of flagellin subunits was determined by gel electrophoresis of flagellar filaments that were isolated and purified in the presence or absenc[r] ...
6
Flagellin A Toll-Like Receptor 5 Agonist as an Adjuvant in Chicken Vaccines
... ligand flagellin induced the chicken immune system and elicited a mixed Th1 and Th2 response, though with an inclination toward a Th2 response (79, ...that flagellin used in combi- nation with LPS induced a ...
10
Burkholderia cenocepacia Lipopolysaccharide Modification and Flagellin Glycosylation Affect Virulence but Not Innate Immune Recognition in Plants
... Induction of pathogenesis-related gene 1 (PR-1) by LPS and flagellin. Host defense responses in A. thaliana depend on ROS and NO production and induction of host defense or stress- associated genes, such as genes ...
11