Gene Drive
Modulating CRISPR gene drive activity through nucleocytoplasmic localization of Cas9 in S. cerevisiae
... CRISPR gene drives using various NLS and NES fused to ...of gene drive ...and gene drives activated for 5 ...assess gene drive ...“percent gene drive activity”. ...
11
Problem formulation for gene drive mosquitoes designed to reduce malaria transmission in Africa: results from four regional consultations 2016–2018
... using gene drive technology to control mosquito vector popula- tions were not the intended focus of the consultation, these issues were widely discussed among participants and were recognized as an ...
13
Informed consent and community engagement in open field research: lessons for gene drive science
... CRISPR/Cas9 gene editing system has generated new possibilities for the use of gene drive constructs to reduce or suppress mosquito populations to levels that do not support disease transmission ...
12
Gene drive systems: do they have a place in agricultural weed management?
... any gene drive that has the stated goal (or the inherent potential) of driving a species to extinction would not be desirable, and stringent reg- ulations would likely prohibit those aims and potential ...
10
Gene drive for population genetic control: non functional resistance and parental effects
... Gene drive is a natural process of biased inheritance that, in principle, could be used to control pest and vector ...nuclease-based gene drive aimed at suppressing a population, resistance ...
8
Population Dynamics Models of Invasive Rodent Eradication with Gene Drive Technology.
... suppressing gene drive described in this model is distinct from other control techniques for several important ...of gene drives do not mean to prevent the evolution of resistance ...of gene ...
139
Evolution of Resistance Against CRISPR/Cas9 Gene Drive
... CRISPR/Cas9 gene drive (CGD) promises to be a highly adaptable approach for spreading genetically engineered alleles throughout a species, even if those alleles impair reproductive ...
15
Development of a Novel Killer-Rescue Self-Limiting Gene Drive System for Insect Population Replacement.
... (K-R) gene drive system can be used to drive anti-viral/anti-pathogen genes through a wildtype population to reduce or eliminate its vector ...anti-pathogen gene), decreases below 5% by 40 ...
197
Engineering of Dengue Virus Refractoriness in Aedes aegypti and Development of an Underdominant Gene Drive System in Drosophila melanogaster
... I built and evaluated miRs against AAIAP (targeting sites TCACCGATAACAAAGT- TAAAGA and GAAGATGAACCAAATAGAAAAC) to test whether or not suppression of IAP in Aedes albopictus cells had the same e↵ect as in S2 cells, but ...
143
The origins of global invasions of the German wasp (Vespula germanica) and its infection with four honey bee viruses
... CRISPR/Cas9 gene drive systems (Drury et ...a gene drive system in these populations, because if any genetically modified individuals were re-introduced back to their native range, it would be ...
29
Reduced representation sequencing identifies small effective population sizes of Anopheles gambiae in the north western Lake Victoria basin, Uganda
... and drive systems have been demonstrated ...and gene drive system will be introduced as identifying levels of gene flow (genetic exchange) and the effective population size (N e ) will be ...
12
MicroRNA expression and gene regulation drive breast cancer progression and metastasis in PyMT mice
... As Gene- Codis enrichment analysis is based on the identification of closed item sets from annotated genes, we used it to identify the MBs from the annotated ...mouse gene set and used a biclustering-based ...
13
The role of temperate bacteriophages in bacterial infection
... Temperate bacteriophages can also drive host genome evolution through gene.. disruption, duplication, transduction or by acting as anchor points for major chromosomal.[r] ...
41
To drive or not to drive? A simple evolutionary model
... As the Proposition states, the higher is the net benefit of using the car and/or the negative impact of this choice on alternative transport users, the higher is the incentive to use the[r] ...
24
Prediction and characterization of promoters and ribosomal binding sites of Zymomonas mobilis in system biology era
... To develop a reliable dual reporter-gene system, fluo- rescent protein pairs should meet some requirements. Firstly, the pair should have distinguishable excitation and emission spectrum to avoid interplay between ...
13
The Drosophila mojavensis Bari3 transposon: distribution and functional characterization
... to drive the transcription of downstream se- quences, thus behaving as a promoter (Figure ...transposase gene is a possible event in vivo, further supporting the hy- pothesis that Bari3 is an active ...
14
Dissecting the regulatory switches of development: lessons from enhancer evolution in Drosophila
... reporter gene constructs to be ...B gene (Celniker et ...reporter gene studies [for early resolution of the eve stripe enhancers see papers by Goto and Harding (Goto et ...
9
CPM 68K Technical Manual and Installation Feb84 pdf
... Be careful here since the drive names might not be the same as the normal CP/M-68K drive names if a hard disk subsystem is installed; the first floppy disk drive is always drive A for FO[r] ...
31
B03P 4805 0008A M224XAS CE Manual Sep85 pdf
... Control of DRIVE SELECTED Signal ••••• Key 5 in SWI "ON" side ••• A drive is in a selected state regardless of DRIVE SELECT 1 ~ 4, which means DRIVE SELECTED signal is always true and al[r] ...
128
The overmethylated genes in Helicobacter pylori-infected gastric mucosa are demethylated in gastric cancers
... Even though the master stomach-specific genes and retroelements sustain the high-fidelity replication of concurrent methylation patterns, erroneous DNA methylation that is more common than erroneous DNA base sequences ...
13