Group A rotavirus
Group A Rotavirus Infection and Age-Dependent Diarrheal Disease in Rats: a New Animal Model To Study the Pathophysiology of Rotavirus Infection
... human rotavirus strains do not efficiently replicate in either animal, (ii) clinical disease is only observed in animals of ⱕ2 weeks of age, (iii) only homologous virus strains (isolated from the same species) ...
17
Prevalence of Group A Rotavirus in Piglets in a Peri Urban Setting of Arusha, Tanzania
... A Rotavirus (GARV) RNA detection was done using Conventional PCR with a universal primer set NSP3-F with nucleotides 963 to 982 (ACCATCTACACATGACCCTC) and NSP3-R with nucleotides 1049 to 1034 (GGTCACATAACGCCCC) ...
8
Evaluation of a Human Group A Rotavirus Assay for On Site Detection of Bovine Rotavirus
... bovine group A rotavirus causes significant economic loss in the dairy and beef industry due to increased morbidity and mortality, treatment costs, and reduced growth ...human group A ...
5
Serological survey of anti group A rotavirus IgM in UK adults
... A rotavirus immunoglobulin M class antibodies as a marker of recent ...of rotavirus in adults, irrespective of seasonal disease incidence in infants, IgM persistence or IgM ...adult rotavirus ...
9
VP7 and VP4 Genotyping of Human Group A Rotavirus in Buenos Aires, Argentina
... of rotavirus in stool samples may be considered the gold standard method ...of group A rotavirus in stool samples, with RT-PCR as the standard method, was ...detect rotavirus in stool samples ...
8
Partial characterization of a bovine group A rotavirus with a short genome electropherotype
... The genome electropherotype of the ID isolate was distinctly different from the genome electropherotypes produced by the bovine group A rotavirus with a typical long pattern, the human g[r] ...
6
Functional studies of the group A rotavirus non structural protein NSP4
... The aim of the experiments described in this chapter was to study the potential function of the cytoplasmic extrusions seen in virus-infected cells. Through the use of impermeable Cell Tracker dyes for imaging of ...
248
Characterization of a Novel P[25],G11 Human Group A Rotavirus
... and rotavirus antigen ...for rotavirus antigen by a VP6-specific enzyme-linked immunosorbent assay and was negative for the common en- teric pathogens Vibrio, Shigella, and ...
5
Seroepidemiology of group A rotavirus in suburban São Paulo, Brazil
... with rotavirus in infants can occur very rapidly after birth, sometimes within the first few days ...of rotavirus epidemiology have concentrated on clinical and, less frequently, on sub-clinical, disease in ...
9
Prevalence of group A rotavirus genotype G1P[8] in Chennai, South India
... to rotavirus in Chennai, South India. Rotavirus was detected in ...of rotavirus strains was observed indicating a broad range of rotavirus strains in ...all rotavirus genotypes and was ...
5
Identification of group A rotavirus gene 4 types by polymerase chain reaction
... The DNA was subsequently used as a template in the gene 4 typing PCR second amplification by using a cocktail of one plus-sense consensus primer and four one for each gene 4 type genetic[r] ...
9
Diversity of group A rotavirus on a UK pig farm
... Group A rotaviruses (GARV) are a significant cause of enteritis in young pigs. The aim of this study was to extend our understanding of the molecular epidemiology of porcine GARV in the UK by investigating the ...
7
Great Diversity of Group A Rotavirus Strains and High Prevalence of Mixed Rotavirus Infections in India
... of rotavirus strains and a high prevalence of the uncommon serotype G9 in a small survey of rotavirus strains collected from six centers in ...of rotavirus strains and the high prevalence of mixed ...
6
Isolation of an avianlike group A rotavirus from a calf with diarrhea
... None of the genomic RNA segments from these rotaviruses of mammalian host origin showed homology with the 993/83 probe, indicating that the genetic constitution of the 993/83 strain was [r] ...
7
Genetic diversity of porcine group A rotavirus strains in the UK
... among rotavirus strains is generat- ed by genetic drift, through the accumulation of point mutations, leading to genetic lineages within genotypes and monotypes within serotypes that possess altered epitopes and ...
11
Molecular Detection of Group A Rotavirus in Children under Five in Urban and Peri-urban Arusha, Tanzania
... in Rotavirus serotypes, a binomial typing identifies ...the Rotavirus does not correlate with the severity of presentation or the seasonal patterns of the disease ...
9
Dual Infection of Gnotobiotic Calves with Bovine Strains of Group A and Porcine-Like Group C Rotaviruses Influences Pathogenesis of the Group C Rotavirus
... bovine group C rotaviruses exist in the United States, but there are no reports of their ...for group C rotaviruses by polyacrylamide gel electrophoresis, immune electron microscopy, and reverse ...
10
Download Download PDF
... of rotavirus strains with unusual G and P ...of group A rotavirus infection in children with diarrhoea and also determination of circulating rotavirus genotypes provides useful data for ...
6
Serological characterization of bovine rotaviruses isolated from dairy and beef herds in Argentina
... Characterization of 72 group A rotavirus-positive fecal samples from beef herds and 43 fecal samples from dairy herds showed a predominance of serotype 6 rotavirus in beef herds but both[r] ...
5
Development, Characterization, and Diagnostic Applications of Monoclonal Antibodies against Bovine Rotavirus
... serogroups, group A rotavirus has been studied in greatest detail, and it is the serogroup most com- monly found in cattle ...bovine rotavirus (BRV) par- ticles contain two proteins, VP4 and ...that ...
5