Haemophilus influenza
The Interaction Between Recombinant Protein F Derived from Nontypeable Haemophilus influenza and Lipoprotein(a)
... [12] Su YC, Jalalvand F, Mörgelin M, et al. Haemophilus influenza acquires vitronectin via the ubiquitous protein F to subvert host innate immunity[J]. Molecular Microbiology, 2013, 87 (6); 1245–1266. [13] ...
6
Impact of the introduction of new vaccines and vaccine wastage rate on the cost-effectiveness of routine EPI: lessons from a descriptive study in a Cameroonian health district
... BCG: Bacille Calmette-Guerrin; DPT: Diphtheria, pertussis and tetanus vaccine; DPT-HB-Hib: Diphtheria, pertussis, tetanus, hepatitis B and Haemophilus influenza type b vaccine (Pentavale[r] ...
8
Purification and characterization of a pilin specific for Brazilian purpuric fever associated Haemophilus influenzae biogroup aegyptius (H aegyptius) strains
... Purification and Characterization of a Pilin Specific for Brazilian Purpuric Fever-Associated Haemophilus influenza Biogroup Aegyptius H.. Department of Pathology and Laboratory Medicine[r] ...
8
Influence of growth medium and supplement on growth of Haemophilus influenzae and on antibacterial activity of several antibiotics
... In the present study, five non-jp-lactamase- and five JP-lactamase-producing strains of Haemophilus influenza were used to determine whether three different growth media, Mueller-Hinton [r] ...
6
Comparison of lipopolysaccharides from Brazilian purpuric fever isolates and conjunctivitis isolates of Haemophilus influenzae biogroup aegyptius Brazilian Purpuric Fever Study Group
... Comparison of Lipopolysaccharides from Brazilian Purpuric Fever Isolates and Conjunctivitis Isolates of Haemophilus influenza Biogroup Aegyptius STUDY GROUPt Departments of Microbiologyl[r] ...
6
immunization schedule and im- prove vaccines.
... MMRV, measles, mumps, rubella, varicella vaccine; DiP, diph- thena, tetanus, pertussis vaccine; OPV, oral poliovaccine; CII, Childhood Immunization Initiative; Hib, Haemophilus influenza[r] ...
5
Development of serum antibodies of the immunoglobulin G class and subclasses against the capsular polysaccharide of Haemophilus influenzae type b in children and adults with invasive infections
... The development of total immunoglobulin G IgG antibodies and antibodies of the four IgG subclasses in serum against Haemophilus influenza type b capsular polysaccharide CPS was studied i[r] ...
5
Serum antibody response to capsular polysaccharide, outer membrane, and lipooligosaccharide in children with invasive Haemophilus influenzae type b infections
... Serum antibodies against capsular polysaccharide CPS, outer membrane OM, and lipooligosaccharide LOS from Haemophilus influenza type b were measured by enzyme-linked immunosorbent assay [r] ...
5
A Study of microbiological profile in obstructive pulmonary disease in a tertiary care hospital Thanjavur
... The commonest organism in the respiratory samples in COPD patients were gram negative bacteria 86% as compared to gram positive bacteria 14%. Among gram negative organisms Klebsiella pneumoniae 43% was the most commonly ...
154
Turnover of nontypable Haemophilus influenzae in the nasopharynges of healthy children
... The nasopharyngeal Haemophilus influenza flora of healthy children in a day care center was analyzed by repeated sampling during 4 winter months.. The average carrier rate was 39%, but 7[r] ...
5
Infections caused by Klebsiella ozaenae: a changing disease spectrum
... 50 Chronic nasal conges- Mucopurulent nasal Radiographic evidence Nasal discharge tion no of maxillary sinusitis Klebsiella ozaenae discharge; atrophic changes Haemophilus influenza Stre[r] ...
6
Case report of congenital asplenia presenting with Haemophilus influenzae type a (Hia) sepsis: an emerging pediatric infection in Minnesota
... The rationale for our conclusions in this case stems from observations regarding the recent emergence of invasive Hia disease in children, suggesting that this strain may be filling an ecological niche left by the ...
5
Haemophilus influenzae Vaccine
... Cochi SL, Broome CV, Hightower AW: Immunization of US Children with Hemophilus influenzae type b polysaccharide vaccine: A cost-effectiveness model of strategy assessment. JAMA 1985;253:[r] ...
5
Haemophilus ducreyi Hfq Contributes to Virulence Gene Regulation as Cells Enter Stationary Phase
... ABSTRACT To adapt to stresses encountered in stationary phase, Gram-negative bacteria utilize the alternative sigma factor RpoS. However, some species lack RpoS; thus, it is unclear how stationary-phase adaptation is ...
13
A high throughput serum bactericidal assay for antibodies to Haemophilus influenzae type b
... Background: The protective capacities of antibodies induced with Haemophilus influenzae type b (Hib) vaccines can be directly assessed in vitro with a Hib-specific serum bactericidal assay (SBA). However, the ...
7
Dual RNA seq of Nontypeable Haemophilus influenzae and Host Cell Transcriptomes Reveals Novel Insights into Host Pathogen Cross Talk
... Transcriptome signatures highlight progression of infec- tion. (i) Bacterial stress response elements are activated at late stages of infection. Under the experimental conditions used, we observed an increased number of ...
14
Advanced biosensors for detection of pathogens related to livestock and poultry
... A broad of traditional serological diagnostic methods like haemagglutination (HA) test, Hemagglutination‑ inhibition (HI) test, neutralization (NT) and ELISA test are available as well as those based on virus propagation ...
22
Pharyngeal Colonization Dynamics of Haemophilus influenzae and Haemophilus haemolyticus in Healthy Adult Carriers
... (10). Briefly, a DNA probe specific for the conserved -core region of iga was PCR amplified from H. influenzae type b strain Eagan as previously described (59) using -core domain primers (BF1, GCAGAATTCAAAGCACAATTTG ...
12
Generation of DelNS1 Influenza Viruses: a Strategy for Optimizing Live Attenuated Influenza Vaccines
... Generation of DelNS1 Influenza Viruses a Strategy for Optimizing Live Attenuated Influenza Vaccines Generation of DelNS1 Influenza Viruses a Strategy for Optimizing Live Attenuated Influenza Vaccines[.] ...
20
An investigation of the inhibition of non typeable Haemophilus influenzae, by substances secreted by Haemophilus haemolyticus
... Co-culture assays on solidified media, as used in this study, have been used extensively for the screening of microorganisms including, Haemophilus spp., for production of antimicrobial substances (LiPuma et al., ...
157