heat shock protein 47

Top PDF heat shock protein 47:

Pirfenidone inhibits TGF-β1-induced over-expression of collagen type I and heat shock protein 47 in A549 cells

Pirfenidone inhibits TGF-β1-induced over-expression of collagen type I and heat shock protein 47 in A549 cells

We first determined the time course of the TGF-β1 (5 ng/ml) effect on the mRNA expression of collagen type I and HSP47 in A549 cells. The response of colla- gen type I to 5 ng/ml of TGF-β1 was maximal after 6, 12, 24 and 72 h of incubation (Figure 1a). TGF-β1 at 5 and 10 ng/ml also significantly increased the expression of collagen type I mRNA after 6 h of incubation (Figure 1b). The response of HSP47 to 5 ng/ml TGF-β1 was maximal after 48 and 72 h of incubation (Figure 1c). Figure 1d shows that TGF-β1 at 5 and 10 ng/ml sig- nificantly increased HSP47 mRNA expression compared with untreated controls after 48 h. We next examined the effects of TGF-β1 on collagen type I and HSP47 protein expression in A549 cells using immunocyto- chemical staining. We found that 1, 5 and 10 ng/ml of TGF-β1 increased the number of cells that were
Show more

9 Read more

Original Article Role of heat shock protein 47 in epithelial-mesenchymal transition of retinal pigment epithelial cells stimulated by TGF-β2

Original Article Role of heat shock protein 47 in epithelial-mesenchymal transition of retinal pigment epithelial cells stimulated by TGF-β2

Proteins were extracted from ARPE-19 cells and homogenized in lysis buffer containing a cock- tail of protease inhibitors. Protein concentra- tions were measured by the BCA protein assay (Millipore, USA). Blots were probed overnight at 4°C with the following primary antibodies: anti- HSP47 (1:500 dilution), anti-αSMA (1:400 dilu- tion), anti-FN (1:400 dilution), anti-collagen type I (1:1,000), and anti-GAPDH (1:1,000), after being transfered onto the nitrocellulose membranes. Following washing, the HRP- conjugated secondary antibody was added to the membranes for 2 h at room temperature
Show more

7 Read more

Serum heat shock protein 47 levels in patients with drug-induced lung disease

Serum heat shock protein 47 levels in patients with drug-induced lung disease

We recently reported that the expression of HSP47 in autopsied DAD lung specimens of patients with acute ex- acerbation of IPF was greater than that in usual interstitial pneumonia lung specimens of patients with stable IPF [19]. The present study also demonstrated that the expres- sion of HSP47 was also markedly increased in DAD autopsied lung specimens of patients with DILD. The spe- cific elevation of serum HSP47 in DILD with a DAD pattern might be due to not only the strong expression of HSP47 in lung tissues but also the distinctive characteris- tics of DAD, including severe inflammation, tissue de- struction, apoptosis and/or cell necrosis, and increased vascular permeability [25]. These changes might induce leakage of HSP47 protein into the peripheral blood.
Show more

10 Read more

Presence of heat shock protein 47-positive fibroblasts in cancer stroma is associated with increased risk of postoperative recurrence in patients with lung cancer

Presence of heat shock protein 47-positive fibroblasts in cancer stroma is associated with increased risk of postoperative recurrence in patients with lung cancer

HSP47 has also been reported to be associated with several types of cancers, including cervical, breast, pan- creatic, gastric, and colon cancer [8–11]. It is encoded by the SERPINH1 gene located on chromosome 11q13.5; this region is one of the most frequently amplified in hu- man cancer [12]. Several types of cancers are associated with abnormal protein folding, and HSP47 has been de- scribed as an important chaperone in the control and maintenance of cellular protein homeostasis [13]. Fur- thermore, HSP47 expression promotes cancer progres- sion in part by enhancing the deposition of extracellular matrix (ECM) proteins, including collagens.
Show more

8 Read more

Role of Heat Shock Protein 47 in Transdifferentiation of Human Tenon's Fibroblasts to Myofibroblasts

Role of Heat Shock Protein 47 in Transdifferentiation of Human Tenon's Fibroblasts to Myofibroblasts

Regarding expression of Hsp47 itself, our findings dif- fer from previous reports that documented increased expression of Hsp47 in various extraocular fibrotic dis- eases [12-21]. Increased expression of Hsp47 was even reported in ocular cicatrical pemphigoid [22]. However, in this in vitro study using human Tenon’ s fibroblasts, TGF-β1 increased the mRNA expression of Hsp47 but did not influence its protein expression. Data of immuno- fluorescence staining (Additional file 2) support the

5 Read more

Serum heat shock protein 47 levels are elevated in acute interstitial pneumonia

Serum heat shock protein 47 levels are elevated in acute interstitial pneumonia

Clinical courses of the various types of idiopathic inter- stitial pneumonias (IIPs) vary widely [1,2]. Although ana- lysis of a surgical lung biopsy has traditionally been the gold standard for the pathological diagnosis of IIPs and is clinically relevant for selecting appropriate treatment [1,3], it involves performance of a relatively invasive proce- dure, especially for patients with advanced IIP. Accordingly, identifying circulating markers effective for evaluating and monitoring disease activity and distinguishing the various types would improve management of IIPs. A number of serum markers suggestive of interstitial lung disease have been reported, including surfactant protein (SP)-A, SP-D,
Show more

8 Read more

The expression profiles and prognostic values of HSPs family members in Head and neck cancer

The expression profiles and prognostic values of HSPs family members in Head and neck cancer

chaperones” in the development, progression, metas- tasis and drug resistance of cancers [6, 7]. Therefore, HSPs have recently been proposed as potential thera- peutic targets for tumor therapy [8]. HSPH1 (also named HSP105), a member of the HSP70 superfamily, is a component of the β-catenin degradation complex. Previous studies have demonstrated that overexpres- sion of HSPH1/HSP105 in various cancers is associ- ated with increased levels of nuclear β-catenin protein and upregulation of Wnt target genes [9].  HSPD1 is a molecular chaperone primarily localised in the mito- chondrial matrix. It has been described as a poten- tial prognostic and diagnostic biomarker for cancer. Recent studies have demonstrated that HSPD1 not only regulates the stability of survivin protein, but also regulates the mRNA expression of survivin [10]. SER- PINH1, also called heat shock protein 47 (HSP47), is a collagen specific molecular chaperone.  Several studies have confirmed that SERPINH1 participates in numer- ous steps of collagen synthesis, blocking the aggrega- tion of procollagen and inducing the hydroxylation of proline and lysine residues. Abnormal expression lev- els of SERPINH1 are frequently found in a variety of cancers, including cervical, lung and gastric cancers [11–13]. Heat shock protein A4 (HSPA4), a member of the HSP110 family, is widely expressed in a variety of organs and can be induced under different condi- tions, including carcinogenic stress [14–16]. Recent studies have indicated that knockdown of HSPA4 can significantly reduce the migration, invasion, and trans- formation activities of tumor cells [17]. Heat shock protein 90α (Hsp90α) is the major cytosolic chaper- one in eukaryotes. It is involved in cell protection and intracellular signaling transduction, controls intra- cellular homeostasis and assemblies of endoplasmic reticulum-secreted peptides, and regulates the translo- cation of proteins across the membranes of organelles after translation. Upregulated expression of Hsp90α is observed in a variety of cancer tissues, including liver, breast, and pancreatic cancers [18–20]. However, there is limited understanding of the underlying mechanisms and the unique roles of these genes in HNSC.
Show more

12 Read more

Antisense oligonucleotide inhibition of Heat Shock Protein (HSP) 47 improves bleomycin-induced pulmonary fibrosis in rats

Antisense oligonucleotide inhibition of Heat Shock Protein (HSP) 47 improves bleomycin-induced pulmonary fibrosis in rats

The lungs were obtained from animals after 14 and 28 days after a 10 unit/kg bleomycin or bleomycin + anti- sense oligonucleotide administration under sevofluran anesthesia. Blood was cleared by saline perfusion via the right ventricle and lungs were homogenized with a poly- tron homogenizer (IKA Labortechnik, Staufen, Germany) in a T-PER Tissue Protein Extraction Reagent (Pierce, Rockford, IL). After homogenization, the sample was cen- trifuged at 10,000 rpm for 5 min. Supernatant was meas- ured for protein content using the BCA Protein Assay Regent (Pierce, Rockford, IL) at an absorbance of 562 nm. Electrophoresis was performed using a discontinuous Tris-glycine buffer system. Proteins were suspended in sodium dodecyl sulfate polyacrylamide gel electrophore- sis (SDS-PAGE) buffer (20 mM Tris-HCl, 0.2 M Glycine) and boiled for 1 min before loading onto 10% gels. Gels were immediately electrotransferred to polyvinilidene dif- luoride (PVDF) membranes (Millipore, Bedford, Massa- chusetts) at 60 V for 3 hrs by means of a wet transfer system (transfer buffer: 20 mM Tris-HCl, 0.2 M Glycine, 20% MeOH). Membranes were blocked with 5% nonfat dry milk in TBS/Tween buffer (25 mM Tris-HCl, 0.14 M NaCl, 2% Tween20) (Bio-Rad Lab., Hercules, CA) over- night, at 4°C. They were subsequently incubated with pre- immune serum, diluted 1:1000 in 1% nonfat dry milk, for 1 hr with gentle shaking at room temperature. Secondary antibody was also diluted in 1% nonfat dry milk (1:1000 dilution) and applied to the membrane for 1 hr at room temperature. Washing between and after antibody incu- bation steps was performed three times for 10 min each with TBS/Tween buffer. Proteins were revealed by enhanced chemiluminescence (ECL) (Amersham, Buck- inghamshire, England) and exposed to film (Hyperfilm ECL; Amersham, Buckinghamshire, England). The film was scanned and protein band concentrations quantified by integrated optical density using NIH ImageJ software (National Institute of Health, U.S.A.).
Show more

11 Read more

Nitric oxide induces heat shock protein 70 expression in vascular smooth muscle cells via activation of heat shock factor 1

Nitric oxide induces heat shock protein 70 expression in vascular smooth muscle cells via activation of heat shock factor 1

Hightower (46) has proposed that proteotoxicity is an im- portant trigger for the heat shock response. Microinjecting de- natured proteins into Xenopus laevis oocytes is sufficient to elicit the heat shock response (47, 48). Subsequent studies showed that hsp prevents aggregation of denatured proteins, resolubilizes protein aggregates that have already formed, and assists in refolding denatured proteins (49–53). The ability of hsps to retain denatured proteins in soluble form is a critical step in proteolysis of damaged proteins (49–53). Thus, hsp serves as a switching point in recognition of reversibly and irre- versibly damaged proteins. Meanwhile, accumulating evidence indicates that NO stimulates the S-nitrosylation of numerous proteins (20), by interaction with a free sulfhydryl group to form a rapidly decaying S-nitrosothiol; if a pair of such groups are in close proximity (termed vicinal thiols), NO may serve as an oxidizing agent to form a disulfide bond, producing a rela- tively persistent covalent modification (54). Such modification occurs in all iron–sulfur enzymes, which are essential for cell survival. In the present study, NO-induced HSF1 activation was completely blocked by DTT, a disulfide-reducing agent. Our results, taken together with observations by others, sup- port the conclusion that HSF activation may, in part, result from NO-induced protein damages.
Show more

10 Read more

The Heat Shock Protein Story—From Taking mTORC1,2 and Heat Shock Protein Inhibitors as Therapeutic Measures for Treating Cancers to Development of Cancer Vaccines

The Heat Shock Protein Story—From Taking mTORC1,2 and Heat Shock Protein Inhibitors as Therapeutic Measures for Treating Cancers to Development of Cancer Vaccines

Heat shock protein 90 (HSP90), together with its co-chaperones, can help over 200 nascent polypeptides to fold correctly, eventually leading to synthesis of the proper proteins for constitutive cell signaling, physiological processes, and adap- tive responses to various stresses. Now we know that this complex machi- nery/structure participates even in transcriptional regulation and chromatin re- modeling. In cancer, accumulation of mutated proteins, presence of high level of reactive oxygen species, low pH, or even the presence of an abnormal number of chromosomes (not 45 or 47, aneuploidy disease) form an unfavorable microen- vironment for the cancer cells to survive. It is obvious intuitively that an inhibi- tor of HSP90 is one class of potential drugs to be considered as a clinical meas- ure to kill cancer cells. This typical inhibitor disrupts HSP90 activity by replac- ing ATP in the N-terminal nucleotide-binding pocket. Such inhibition destabi- lizes a large number of oncoproteins, leading to blockade of tumorigenic signal- ing pathways, resulting in arrest of cancer cell proliferation, with further induc- tion of apoptosis [105]. There are over 13 such inhibitors being tested and many are used in pre- and some in clinical trials. Novobiocin, geldanamycin, 17-AAG (tanespimycin), NVP-AUY922, NVP-HSP990 are five among those potential medicines [7] [106]. The last two members (NVP-AUY922, NVP-HSP990) have shown anti-cancer effects in primary cancer cells and animal models of mela- noma, myeloma, gastric cancer, non-small-cell lung cancer (NSCLC), hepato- cellular cancer, sarcoma, and breast cancer (see review in [107]). Of interest, human cancer xenograft models ( i.e . human cancer cells being transplanted, ei- ther under the skin or injected into the specific organ) GTL-16, NCI-H1975, BT474, and MV4 were implanted subcutaneously into mice models. Standard pharmacokinetics-pharmacodynamics analysis shows that NVP-HSP990 is a potent and selective HSP90 inhibitor, inhibits growth of a range of cancer cells just stated. We would not discuss the details of these xenograft models here.
Show more

68 Read more

Anti-Vpr Activities of Heat Shock Protein 27

Anti-Vpr Activities of Heat Shock Protein 27

these cells at 43°C for 30 min. and then transfer them back to 37°C for testing at indicated time intervals. For Western blot analysis, cells were harvested and rinsed with ice-cold HEPES-buffered saline (pH 7.0), then lysed in an ice-cold cell lysis buffer: 20 mM Tris-HCl, pH7.6, 150 mM NaCl, 1 mM EDTA, 0.5% Nonidet P-40, 1 mM DTT, 5 µM Trichostatin A, 1 mM sodium orthovanadate, 1 mM PMSF, 1 mM NaF, and protease in- hibitors (Roche Applied Science, Indi- anapolis, IN, USA). Cellular lysates were prepared and the protein concentration was determined using the Pierce protein assay kit. For immunoblotting, an aliquot of total lysate proteins (30 or 50 µg) in 2× SDS-PAGE sample buffer (1:1 v/v), was electrophoresed and transferred to a ni- trocellulose membranes. The membranes were incubated with Tris-buffered saline- tween 20 (TBST) and 5% skim milk for 1 h, and were then incubated with ap- propriate primary antibody in TBST (pH 7.5) and 2% skim milk overnight. After washing, the membrane was incu- bated with secondary antibody in TBST buffer for 1 h. Protein bands were visual- ized by an ECL detection system. The Student’s t-test was used to determine the statistical significance of differences between experimental groups as indi- cated by P-values; P < 0.05 was consid- ered significant. pSM2c plasmid carrying a nucleotide sequence (5′-TGCTGTTGA CAGTGAGCGCCCACAGAGATACAC AGATATATAGTGAAGCCACAGATGTA TATATCTGTGTATCTCTGTGGATGCCT ACTGCCTCGGA-3′) that encodes a short hairpin RNA sequence (shRNA) against human HSF1 is commercially available from Open Biosystems, Inc. (Cat. No. RHS1764-9689169, Huntsville, AL, USA).
Show more

11 Read more

Heat Shock Protein 70: Roles in Multiple Sclerosis

Heat Shock Protein 70: Roles in Multiple Sclerosis

HSP play two neuroprotective roles. On the one hand, HSP prevent protein aggregation and misfolding through their chaperone activity, and on the other hand they can induce antiapoptotic mechanisms (Table 1). HSP not only ex- hibit housekeeping functions but also have an essential function in promoting cell survival following stressful or harm- ful conditions. Following conditions of cellular stress, the accumulation of un- folded or misfolded proteins triggers an HSR that promotes HSP expression with the purpose of refolding these proteins to their native state or, if that is not possi- ble, transferring the proteins to the degradative pathway (reviewed in [39–41]). On the basis of the idea that the accumulation of abnormal protein aggre- gates is a common histopathological hall- mark contributing to neuronal degenera- tion, the role of HSP in chronic
Show more

11 Read more

Heat shock factor 1 protein in heat shock factor 1 gene transfected human epidermoid A431 cells requires phosphorylation before inducing heat shock protein 70 production

Heat shock factor 1 protein in heat shock factor 1 gene transfected human epidermoid A431 cells requires phosphorylation before inducing heat shock protein 70 production

Control cells were transfected with vector alone. Expression of HSP-70, HSF1, and HSF2 genes and protein were deter- mined. We found a significant increase in the expression of the HSF1 gene, but not HSP-70 and HSF2 genes, in the HSF1 gene–transfected cells. The amount of HSF1–heat shock element complex was significantly increased in both the nucleus and cytosol in HSF1 gene–transfected cells, in- dicating increased synthesis of HSF1. The amount of HSP-72 in these cells did not change. Therefore, overexpression of HSF1 protein failed to initiate transcription of the HSP-70 gene. Subsequently, we treated the cells with 1 m M PMA (a protein kinase C stimulator), and HSP-70 mRNA and pro- tein were measured at 1 or 4 h of the treatment, respec- tively. The levels of both HSP-70 mRNA and HSP-72 pro- tein were significantly increased in nontransfected and transfected cells; the levels of HSP-72 in HSF1 gene–trans- fected cells were greater than that found in the vector-trans- fected cells. The PMA-induced increase in HSP-72 protein peaked 8 h after treatment with PMA and returned to base- line levels at 72 h. This increase was blocked by a PKC in- hibitor, staurosporine. After treatment with PMA, HSF1 translocated quickly from cytosol to nucleus. The results suggest that phosphorylation of newly synthesized HSF1 and possibly of other factors are necessary for the induction of HSP-72. Activation of PKC can cause phosphorylation of HSF1, which leads to an enhanced but transient increase in
Show more

9 Read more

Pho dynamically interacts with Spt5 to facilitate transcriptional switches at the hsp70 locus

Pho dynamically interacts with Spt5 to facilitate transcriptional switches at the hsp70 locus

Additional file 1: Figure S1. Schematic representation of the proteins involved in the silencing, activation and re-silencing of the hsp70 locus. a At optimal growth temperature, Pho, a DNA-binding PcG member, binds to promoter region of the hsp70 locus. Pho interacts with dSfmbt, which together form a recruitment platform for PRC1 to the hsp70 locus. In addition, RNA polymerase II is maintained in the paused state by NELF and Spt5, which act as pausing factors. Upon heat shock, HSF, along with P-TEFb, is recruited to chromatin and releases RNA polymerase II from the paused state. P-TEFb modifies Spt5 and converts into an elongation factor. It also modifies the CTD of RNA polymerase II to enable productive elongation. However, upon removal of the heat shock stimulus, the locus should eventually return to its paused state. Thus, hsp70 is an ideal model gene to study the eviction and recruitment of PRC1 upon activation and re-silencing, respectively. The colour code for the protein names is as fol- lows: silencing in red, pausing factors in orange and activators in green. Additional file 2: Figure S2. RNA polymerase II binding dynamics at Act42A locus during the heat shock response. a, b ChIP-qPCR measure- ments of occupancy levels of RNA polymerase II CTD and S2P form of RNA polymerase II at the Act42A locus during the heat shock response detailed in Fig. 1a. The control line represents cells that were maintained at 25 °C for the entire duration of the time course detailed in Fig. 1a. Distance of the location of the primers used from the Act42A TSS is as follows: for a and b (+ 104 bp) and has been depicted in the form of a cartoon below the data figure. Data information: In (a, b), data are presented as mean ± SEM for n = 2.
Show more

17 Read more

THERMO-TOLERANCE AND HEAT SHOCK PROTEIN OF ESCHERICHIA COLI ATCC 25922 UNDER THERMAL STRESS USING TEST CELL METHOD

THERMO-TOLERANCE AND HEAT SHOCK PROTEIN OF ESCHERICHIA COLI ATCC 25922 UNDER THERMAL STRESS USING TEST CELL METHOD

In this study, the heat resistance of E. coli ATCC 25922 in LB broth at three temperatures was obtained with test cell methods. The preheating conditions at three sub- lethal temperatures resulted in increased heat resistances of E. coli with maximum D-values after heat shock at 45 °C for 5 min. The trend of relative mRNA level after heat shock treatment was similar to that of D-values. The increased heat resistance could be eliminated by adding one-day storage of the contaminated products at room or cold temperatures. Avoiding heat shock proteins or increasing temperatures or treatment times must be considered to ensure food safety while designing effective thermal processes to control E. coli ATCC 25922 in postharvest agricultural products. Further experiments should be conducted to study the thermo-tolerance of E. coli ATCC 25922 in real foods and validate the results obtained in this study.
Show more

7 Read more

Intracellular protozoan parasites of humans: the role of molecular chaperones in development and pathogenesis

Intracellular protozoan parasites of humans: the role of molecular chaperones in development and pathogenesis

Expression of Toxoplasma gondii -specific heat shock protein 70 during in vivo. 1326[r]

42 Read more

Heat shock protein expression and apoptosis in myeloid leukaemias

Heat shock protein expression and apoptosis in myeloid leukaemias

Mehlen the of et stem cells via apoptosis al., embryonic murine In haemopoietic systems, studies of myeloid differentiation have shown that expression differentiation by is induced hsp70[r]

206 Read more

A Child  Hereditary Motor Sensory Neuropathy and Mutation of Heat Shock Protein HSPB1

A Child Hereditary Motor Sensory Neuropathy and Mutation of Heat Shock Protein HSPB1

2. D.J. Lewis-Smith, J. Duff, A. Pyle, H. Griffin, T. Polvikoski, D. Birchall, et al. Novel HSPB1 mutation causes both motor neuronopathy and distal myopathy. Neurol Genet 2016;2: e110. 3. K Maeda , R Idehara , A Hashiguchi , H Takashima. A Family with Distal Hereditary Motor Neuropathy and a K141Q Mutation of Small Heat Shock Protein HSPB1. Intern Med 2014: 53; 1655-1658. 4 .Fu L, Liang JJ. Alteration of protein-protein interactions of congenital cataract crystallin mutants. Invest Ophthalmol Vis Sci 2003; 44:1155–1159.
Show more

6 Read more

Shock the heat shock network

Shock the heat shock network

The targeting of tumors is made possible through establishing protein signatures specific for each cancer type. The recent recognition of the higher expression levels of HSP90 and its accumulation in tumor cell mitochondria has made the HSP90 network a feasible target for neu- tralization. HSP90 antagonizes the mitochondrial permeability transi- tion, blocking cytochrome c release and apoptosis. In this issue of the JCI, Kang et al. report the synthesis of Gamitrinibs, which target mito- chondrially localized HSP90, specifically killing human cancer cell lines, and provide a fresh approach for cancer treatment (see the related article beginning on page 454).
Show more

5 Read more

The Role Of Protective Heat Shock Protein 70 And Proinflammatory Heat Shock Protein 60 Toward The Functional Status Of Acute Thrombotic Ischemic Stroke

The Role Of Protective Heat Shock Protein 70 And Proinflammatory Heat Shock Protein 60 Toward The Functional Status Of Acute Thrombotic Ischemic Stroke

[5] Giffard, R.G., Han, R.Q., Emery, J.F. 2008. Regulation of Apoptotic and Inflammatory Cell Signaling in Cerebral Ischaemia-The complex Roles of Heat Shock Protein 70. Anesthesiology, 2008 August, 109(2):339-348. [6] Stetler, R.A., Gan, Y., et al. 2010. Heat Shock Protein:

7 Read more

Show all 10000 documents...