human toll-like receptor 9
The T Antigen Locus of Merkel Cell Polyomavirus Downregulates Human Toll-Like Receptor 9 Expression
... M erkel cell polyomavirus (MCPyV) is a small, nonenveloped, double-stranded DNA (dsDNA) polyomavirus identified by digital transcriptome subtraction (1) from Merkel cell carcinoma (MCC), a rare and aggressive form of ...
11
Tyrosine Phosphorylation and Structural Requirements Mediate Toll-Like Receptor 9 Function
... Given the potency of TNF α ’s damaging effect on host tissues, it is no surprise that this cytokine has been implicated in inflammatory disease. Rheumatoid arthritis (RA) is a disease characterized by chronic ...
119
Effects of human Toll-like receptor 1 polymorphisms on ageing
... TLR1/TLR2 heterodimers play an important role in host defense against mycobacterial infections choosing them as attractive targets since tuberculosis is increasing in developed countries with age [9-11]. Within ...
9
Differential cell reaction upon Toll-like receptor 4 and 9 activation in human alveolar and lung interstitial macrophages
... MAP Human Cytokine Kit (Milli- pore, Billerica, MA, USA) was used, containing the following cytokines: IL1b, IL1ra, IL6, IL10, IL12p40, IL- 12p70 and ...pg/ml human cytokine standard according to the ...
15
Pfaller, Christian (2010): Subversion of Toll-like receptor 7/9 signaling by Measles Virus - V holds the key. Dissertation, LMU München: Fakultät für Chemie und Pharmazie
... in human pDCs, and passaging of the virus on Vero cells (G954-V13) did not change this phenotype, although the resulting virus was highly attenuated (Druelle et ...
147
Human herpesvirus 6 infection impairs Toll like receptor signaling
... We first confirmed HHV-6 infection in DCs. We and other investigators previously reported that HHV-6 can infect human DCs and modulates the expression of vari- ous surface molecules including CD80, CD83, CD86, and ...
5
Toll like receptor 9 polymorphisms influence mother to child transmission of human immunodeficiency virus type 1
... transduction pathways, that in turn induce dendritic cell maturation and cytokine production [2]. These receptors play a central role in the activation of innate immunity [3]. A growing body of data supports a role of ...
5
Gene and protein expression of tlr 9 with lipopolysaccharide in human bronchial epithelial cells
... of Toll like receptor 9 when human bronchial epithelial cells were induced by ...recognition receptor (PRR) which plays a key role in innate ...
7
Downregulation of Toll-Like Receptor 9 Expression by Beta Human Papillomavirus 38 and Implications for Cell Cycle Control
... transformation, human cancer-associated viruses deregulate pathways linked to the host immune response, thus favoring the persistence of the infection, which is an essential condition for cancer development ...of ...
10
Toll-like receptor 9 interaction with CpG ODN – An in silico analysis approach
... Searches for reference proteins, sequence alignments and homology modelling were performed in Discovery Studio 2.5 (Accelrys Inc.). A BLAST search of the PDB indi- cated that the crystal structures of human TLR3, ...
12
Toll4 (TLR4) expression in cardiac myocytes in normal and failing myocardium
... Drosophila Toll may be relevant to the expression of innate immunity effector proteins in the ...heart. Toll, a type 1 transmem- brane protein with an extracellular leucine-rich repeat domain and an ...
11
Regulation of migration and invasion by Toll-like receptor-9 signaling network in prostate cancer
... interleukin-1 receptor-associated kinase 1 (IRAK) and TNF receptor-associated factor 6 (TRAF6) to activate the IFN regulatory factor 7 (IRF7), resulting in expression of IFN-alpha, or to activate the IκB ...
11
Inhibition of Toll-Like Receptor 7- and 9-Mediated Alpha/Beta Interferon Production in Human Plasmacytoid Dendritic Cells by Respiratory Syncytial Virus and Measles Virus
... Nonactivated cells were virtually not permissive for infection with either RSV strain or MeV. Only after activation of T cells with phytohemagglutinin and of B cells or monocytes with lipopolysaccharide could infection ...
9
Human lung cancer cells express functionally active Toll-like receptor 9
... out like described above using primers targeting human MCP-1 (forward: AAAG- CACCAGTCAACTGGAC; reverse: AGCGCTTGGTGATGT- GCTTT) resulting in a 149 bp PCR-product and GAPDH (forward: AGAACGGGAAGCTTGTCATC; ...
10
Association between toll-like receptors 9 (TLR9) gene polymorphism and risk of pulmonary tuberculosis: meta-analysis
... ‘toll like receptor 9, SNP, lung tuberculosis’, ‘toll like receptor 9, snp, pulmonary tuberculosis’, ‘toll like receptor 9, ...
10
DNA like class R inhibitory oligonucleotides (INH ODNs) preferentially block autoantigen induced B cell and dendritic cell activation in vitro and autoantibody production in lupus prone MRL Faslpr/lprmice in vivo
... We have recently developed a new class of inhibitory ODNs that we named class R ('restricted') INH-ODNs [38]. We show that these dsDNA-like analogues carrying the canonical TLR9- inhibitory sequence [39,40] are ...
16
Posttranslational Modification of HOIP Blocks Toll Like Receptor 4 Mediated Linear Ubiquitin Chain Formation
... alter the intrinsic enzymatic activity of HOIP (see Fig. S1F in the supplemental material). These experiments collectively demon- strate that HOIP is ubiquitinated at the K1056 by multiple types of ubiquitin chains and ...
12
Toll like receptor downstream signaling
... major domains characterized by leucine-rich repeats (LRR domain) and Toll/interleukin-1 receptor (TIR domain) domain (Fig. 1). The first evidence of TLRs in the recognition of pathogens was reported from ...
8
Differential inhibition of human cytomegalovirus (HCMV) by toll like receptor ligands mediated by interferon beta in human foreskin fibroblasts and cervical tissue
... that human NK cells can sup- press HCMV through secretion of IFNβ, and NK cells can be stimulated through certain TLR including TLR2 ...and human fibroblasts have all been shown to secrete IFNβ in response ...
10
Toll Like Receptor 3 Signaling via TRIF Contributes to a Protective Innate Immune Response to Severe Acute Respiratory Syndrome Coronavirus Infection
... IMPORTANCE Toll-like receptors are a family of sensor proteins that enable the immune system to differentiate between “self” and ...in human populations, but no approved therapeutic treatments or ...
14