integrin β3
Activin B induces human endometrial cancer cell adhesion, migration and invasion by up-regulating integrin β3 via SMAD2/3 signaling
... were: integrin β3, 5′-GAA GGC TGG CAG GCA TTG-3′ (forward) and 5′-AAT GAT TGT CAC TAC CAA CAT GAC ACT-3′ (reverse); integrin αv, 5′- TGC CCA GCG CGT CTT C-3′ (forward) and 5′-TGG GTG GTG TTT GCT TTG ...
15
Research on the expression of integrin β3 and leukaemia inhibitory factor in the decidua of women with cesarean scar pregnancy
... of integrin β 3 in tubal epithelium of tubal pregnancy was higher than that in normal tubal epithelium, but lower than that in normal decidual ...cells. Integrin β 3 might play a role in ectopic ...of ...
8
Inhibition of integrin β3, a binding partner of kallistatin, leads to reduced viability, invasion and proliferation in NCI-H446 cells
... Integrin signals can also originate inside cells and affect receptor affinity, thereby controlling ligand binding, ini- tiating a cross talk with other receptors, and altering cell adhesion and proliferation. In ...
15
Collagen triple helix repeat containing 1 (CTHRC1) activates Integrin β3/FAK signaling and promotes metastasis in ovarian cancer
... To verify the cell motility in vitro, 24-well plates and matching upper chambers (Corning, 8μm, USA) were used. As for invasion assays, the chambers were coated with Matrigel (BD Biosciences, USA), then 8×10 4 ...
13
Chronic TGFβ stimulation promotes the metastatic potential of lung cancer cells by Snail protein stabilization through integrin β3-Akt-GSK3β signaling
... Notably, integrin β3, whose expression was markedly increased upon sustained exposure to TGFβ, was responsible for the high Akt activity as well as the increased Snail protein stability in TD ...and ...
11
Integrin β3 and CD44 levels determine the effects of the OPN-a splicing variant on lung cancer cell growth
... in integrin β3 levels might explain this discrepancy between CL1-5 and A549 ...When integrin β3 was ectopically expressed in A549 cells, OPN-a inhibited their growth, whereas OPN-a increased ...
13
Eptifibatide induced thrombocytopenia and thrombosis in humans require FcγRIIa and the integrin β3 cytoplasmic domain
... the integrin αIIbβ3 antagonist eptifibatide are rare complications caused by patient antibodies specific for ligand-occupied ...the integrin β3 cytoplasmic domain, the platelet FcγRIIa Fc receptor, ...
9
Targeting lipid metabolism to overcome EMT-associated drug resistance via integrin β3/FAK pathway and tumor-associated macrophage repolarization using legumain-activatable delivery
... and integrin β3 level (B) in A549T cells were reduced by SV, as measured by flow ...an integrin β3-binding ECM) much faster than the parent A549 ...an integrin β3-independent ...
14
PAX8 expression in high-grade serous ovarian cancer positively regulates attachment to ECM via Integrin β3
... regulates Integrin β3 gene expression Many experimental evidences demonstrated that deregu- lation of integrins or changes in their expression profile can contribute to cancer cells acquisition of ...
12
Mechanical Ventilation Augments Poly(I:C)-Induced Lung Injury via a WISP1-Integrin β3-Dependent Pathway in Mice
... and integrin β3 expression in ...that β3 and WISP1 interact in the lungs of mice exposed to both MTV and intra- tracheal ...from integrin β3 knockout ...rin β3, resulting in ...
10
Interleukin-8 promotes integrin β3 upregulation and cell invasion through PI3K/Akt pathway in hepatocellular carcinoma
... that integrin αvβ3 participated in the invasion and metastasis of HCC cells ...reduced integrin β3 expression and invasion of HCC ...that integrin β3 might participate in IL-8- mediated ...
10
Phoyunnanin E inhibits migration of non small cell lung cancer cells via suppression of epithelial to mesenchymal transition and integrin αv and integrin β3
... Metastasis has long been recognized as one of the im- portant causes of the high death rate in lung cancer cases worldwide [1]. The key molecular processes that facilitate the metastasis potential of cancer cells have ...
16
Original Article Cyclosporine A improves adhesion and invasion of mouse preimplantation embryos via upregulating integrin β3 and matrix metalloproteinase-9
... In the present study, we first observed the effect of CsA on blastocyte formation, blasto- cyte cell number and apoptosis, embryo hatch- ing. Then we evaluated the adhesion and stretching growth of hatched embryos in ...
10
The PlA2 polymorphism of integrin β3 enhances outside in signaling and adhesive functions
... dependent manner than did Pl A1 cells. Disruption of the actin cytoskeleton by cytochalasin D abolished the increased binding of Pl A2 cells. Compared with Pl A1 cells, Pl A2 cells exhibited a greater extent of ...
11
Predictive Role of αVβ3 Integrin, and VEGF in Colorectal Adenocarcinoma Progression in Iraqi Patients
... Therefore, Integrin and VEGF could be one of such mechanisms. Integrin β3 may enable VEGF to stimulate endothelial cell proliferation and capillary angiogenesis through activating VEGF receptor-2 ...
5
Integrins β1 and β3 are biomarkers of uterine condition for embryo transfer
... and β3 were created by reverse transcription of RNA using a RT-PCR kit (Fermentas; Waltham, MA, ...GGGACACAGGATCAGGTTGG; integrin β3, forward primer: GGCAAGTGTGAATGTGGCAG, reverse primer: ...
10
Expression of Lewis y antigen and integrin αv, β3 in ovarian cancer and their relationship with chemotherapeutic drug resistance
... and integrin αvβ3 in the tissue specimens of patients resistant to platinum drugs and investigated their relationship with drug ...of integrin β3 in the two groups was not significantly ...and ...
7
Structure of Adenovirus Complexed with Its Internalization Receptor, αvβ5 Integrin
... of integrin and antibody binding to the Ad RGD ...and integrin associations with Ad particles in real ...of integrin was markedly lower than that of the DAV-1 antibody for the penton ...5 ...
10
Popov, Tzvetan (2011): Characterization of human mesenchymal stem cells by the appearance of integrins and functional analysis of collagen I-binding integrins. Dissertation, LMU München: Medizinische Fakultät
... which integrin a1- and shRNA control hMSC passed was approximately 170 µm with mean speed of ...parallel integrin a2 and a11-deficient hMSC migrated to a distance of approximately 70 µm with a ve- locity of ...
110
Original Article Integrin subunits αV and β3 promote the osteogenic differentiation of umbilical cord blood mesenchymal stem cells
... this integrin receptor participates in diverse biologic processes such as cell migration, tu- mor invasion, bone resorption, angiogenesis, and the immune response ...and β3 on the osteogenic differentiation ...
9