microRNA-146a
MicroRNA-146a protects against myocardial ischaemia reperfusion injury by targeting Med1
... in microRNA-146a deficient mice that experienced myocardial ischaemia re- perfusion was accompanied by an amplified ratio of Bax/Bcl2 and increased cleaved ...of microRNA-146a in ...
13
Original Article The occurrence of cervical cancer in Uygur women in Xinjiang Uygur Autonomous Region is correlated to microRNA-146a and ethnic factor
... Abstract: Aims: The present study is to investigate the effect of microRNA-146a (miR-146a) and ethnic factor in the occurrence of cervical cancer in Uygur women in Xinjiang Uygur Autonomous Region. ...
8
Original Article microRNA-146a relieves smoking relative chronic obstructive pulmonary disease through targeting ATG12
... Abstract: Tobacco smoke is a primary risk factor of chronic obstructive pulmonary disease (COPD) through exac- erbating local inflammation and oxidative stress response and impairing autophagy in the lung. ...
14
Involvement of microRNA-146a in diabetic peripheral neuropathy through the regulation of inflammation
... a pivotal role in numerous biological processes such as cell proliferation, apoptosis, differentiation and metabolism, by mainly pairing with target-specific bases and causing target mRNA degradation or inhibiting its ...
7
<p>MicroRNA-146a as a Prognostic Biomarker for Esophageal Squamous Cell Carcinoma</p>
... Results: The results revealed a reduction of miR-146a expression in 50% of cancerous tissue when compared with adjacent normal regions (P-value=0.127). COX-2 expression in 80% of ESCC patients was higher than in ...
8
MicroRNA-146a constrains multiple parameters of intestinal immunity and increases susceptibility to DSS colitis
... of microRNA-146a (miR-146a) in regulating intestinal immunity and barrier function and found that this miRNA is expressed in a variety of gut tissues in adult ...
17
Original Article MicroRNA-146a-5p inhibits recruitment of macrophages and protects nucleus pulposus cells from TNF-α-induced apoptosis by targeting TRAF6
... Abstract: Intervertebral disc degeneration (IDD) is associated with lower back pain and plays an important role in the development of spinal disc herniation. In this study, we aimed to analyze expression and function of ...
10
Original Article MicroRNA-146a improves sensitivity of cervical cancer cells to cisplatin by inhibiting proliferation
... Improve the sensitivity of chemotherapy drugs in cancer treatment was an effective way to decrease side effect of chemotherapy drugs. Studies have demonstrated microRNAs are associated with carcinogenesis and cancer ...
9
MicroRNA 146a is a therapeutic target and biomarker for peripartum cardiomyopathy
... of microRNA-146a (miR-146a) in ECs. miR-146a promoted endothelial injury and, in a paracrine manner via miR- 146a–loaded endothelial exosomes, reduced cardiomyocyte meta- bolic ...miR- ...
13
Upregulation of MicroRNA 146a by Hepatitis B Virus X Protein Contributes to Hepatitis Development by Downregulating Complement Factor H
... study, microRNA-146a (miR-146a), an innate immunity-related miRNA, and complement factor H (CFH), an important nega- tive regulator of the alternative pathway of complement activation, were ...
11
Original Article MicroRNA-21 and microRNA-146a identification in stool and its clinical significance in colorectal neoplasms
... of microRNA-21 (miRNA-21) and microRNA-146a (miRNA-146a) were investigated by quantitate real-time polymerase chain reaction (qRT-PCR) from the tissues of colorectal carcinoma (CRC), ...
9
MicroRNA 146a expresses in interleukin 17 producing T cells in rheumatoid arthritis patients
... developmental stage-specific expression pattern and have been reported to be associated with human dis- eases such as cancer, leukemia, and viral infection [22,23]. These findings suggest their potential as a novel ...
11
Original Article MicroRNA-21 and microRNA-146a negatively regulate the secondary inflammatory response of microglia after intracerebral hemorrhage
... miR-21 and miR-146a in microglia by adenovi- rus infection, and found miR-21 and miR-146a can both attenuate the expression of IL-1β, IL-6, IL-8, IRAK1, MMP-9 and TNF-α and incre- ase the expression of ...
9
microRNA 146a Promotes Growth of Acute Leukemia Cells by Downregulating Ciliary Neurotrophic Factor Receptor and Activating JAK2/STAT3 Signaling
... In conclusion, our work confirmed that miR-146a is highly expressed and CNTFR is lowly expressed in ALL and AML pe- diatric patients. In addition, we further demonstrated that miR-146a promotes cell ...
11
Chronic constriction injury-induced microRNA-146a-5p alleviates neuropathic pain through suppression of IRAK1/TRAF6 signaling pathway
... Several reports showed some miRNAs participate in the development of neuropathic pain and affect neuro- pathic pain by regulating protein level in the pain pro- gress [19, 32–34]. The proposed possible mechanism ...
12
<p>The expression of microRNA 146a in patients with ischemic stroke: an observational study</p>
... of microRNA (miRNA) 146a in patients with ischemic stroke and its correlation with patients ’ ...miRNA 146a expression between patients with ischemic stroke and control group ...miRNA 146a was ...
6
MS2 VLP-based delivery of microRNA-146a inhibits autoantibody production in lupus-prone mice
... (pre-miR146a) or a nonsense oligonucleotide (mutated pre-miR-146a RNA, CUGCAGAAGGUCAC CCAG- GGUAACGUUGACCUUGGUGUUGCUCUAG CAGCG- GCCAGGUCGACAGC), which was used as the control, were inserted into a prokaryotic ...
11
MicroRNA-146a regulates ICOS–ICOSL signalling to limit accumulation of T follicular helper cells and germinal centres
... Next we assessed by flow cytometry whether the proteins encoded by these putative RNA targets were upregulated in miR-146a-deficient T cells. STAT1, a validated target of miR-146a in Tregs 24 and an important ...
14
Original Article Expression and clinical significance of microRNA 146a in peripheral blood mononuclear cells from type 2 diabetic neuropathy patients
... that decreased miR-146a levels cannot inhibit NF-κB activity and are involved in the pathogenesis of DPN. However, Yousefzadeh et al. [18] found increased expression levels of miR-146a, IRAK, TRAF6, and ...
9
Cryptotanshinone Suppresses Non-Small Cell Lung Cancer via microRNA-146a-5p/EGFR Axis
... In previous studies, non-coding RNAs related signaling pathways in the antitumor efficacy of tanshinones were found. It has been proved that miR-137 and miR-32a could be upregulated by tanshinones in NSCLC [29, 30]. Ren ...
8