Min/+ mouse
The pro-apoptotic K-Ras 4A proto-oncoprotein does not affect tumorigenesis in the Apc Min/+mouse small intestine
... 3 min, then 45 cycles of 95°C for 15 sec and 60°C for 1 ...used: mouse β -actin upstream primer (5'-AAGCTGTGCTATGTT- GCTCTAGACT-3'), and downstream primer (5'-CACT- TCATGATGGAATTGAATGTAG-3'); mouse ...
9
Paracrine cyclooxygenase-2 activity by macrophages drives colorectal adenoma progression in the Apc Min/+ mouse model of intestinal tumorigenesis
... mouse colonic tumour. Greater than 90% of Cox-2-positive stromal cells exhibit F4/80 positivity (closed arrows) but are only a subset of the total intra-tumoral F4/80 macrophage population (asterisks) in ...
14
The Effect Of Emphasizing Key Vocabulary On Student Achievement With English Learners
... Colorectal cancer (CRC) is the third leading cause of cancer death in both men and women. Approximately 140,000 people in the US will be diagnosed with the disease in 2018 and over 50,000 will die from it (Siegel et al., ...
83
Depression Among Pregnant Latinas In South Carolina
... Apc Min/+ mouse model for studying gut diseases and their association with microbiota often report significant changes in microbiome profiles of the large intestine, but also report that differences in the ...
199
Relationships Between Prior Experiences, Current Teaching Contexts, and Novice Teachers' Use of Concrete Representation for Mathematics Instruction
... Apc Min/+ mouse A) Total tumor number in the intestine B) Tumor distribution according to tumor size in the ...Apc Min/+ ...Apc Min/+ ...Apc Min/+ $ - denotes different from all the ...
246
The TLR3/TICAM-1 signal constitutively controls spontaneous polyposis through suppression of c-Myc in Apc Min/+ mice
... which can activate TLR3 in the intestine [8]. TLR3 is expressed in mucosal epithelial cells and myeloid cells, which may sample the bacterial by-products of dsRNAs via phagocytosis [9]. TLR3 couples with the adaptor ...
9
Apc-related models of intestinal neoplasia: a brief review for pathologists
... Apc-related mouse models have been engi- neered to contain germline mutations in Apc that lead to expression of a truncated Apc protein; in most of these models, only heterozygotes are viable, as homo- zygosity is ...
9
Transport of incoming influenza virus nucleocapsids into the nucleus.
... To determine whether the antibodies blocked nuclear import of the viral proteins, the cells were fixed 45 min after internalization and double stained with FITC goat anti-mouse antibody [r] ...
13
Mechanism of inhibitory effect of atorvastatin on resistin expression induced by tumor necrosis factor-α in macrophages
... for mouse resistin was: for- ward, 5'-d(GTACCCACGGGATGAAGAACC)-3'; reverse, ...10 min at 95°C followed by an amplification phase as detailed below: denaturation at 95°C for 10 sec; annealing at 55°C for 5 ...
12
Novel metal allergy patch test using metal nanoballs
... In vivo Ni-permeation test designed for mouse skin C57BL/6 mice (45–75 weeks old) were used in this study. All animal protocols were approved by the Animal Ethics Review Board of the Dental Hospital of Nihon ...
6
Protective Mechanisms of Hypothermia in Liver Surgery and Transplantation
... a mouse model of 90-min left liver lobe ischemia, hypothermia (4°C to 32°C) reduced I/R injury, as evidenced by improved microcirculatory perfusion, a drop in plasma ALT/AST and less hepatocellular necrosis ...
14
s41598-018-33053-2.pdf
... We have developed a murine nose-only aerosol delivery system to aerosolize ultra-small volumes (10 µ l/min or less) by modifying a commercial ultrasonic aerosol generator (Aeroneb). We reduced the duty cycle of ...
12
A novel virus binding assay using confocal microscopy: demonstration that the intracellular and extracellular vaccinia virions bind to different cellular receptors.
... 10 min at 378C, all the FITC fluorescence was clustered, indicating capping of MAb B2-reactive receptor ...irrelevant mouse IgM MAb as the pri- mary antibody ...
10
Min sum 2 paths problems
... the min-sum 2 edge-disjoint paths problem by showing that if, on the same input instance, we execute an algorithm for min-sum 2 edge-disjoint problem and an algorithm that works if (ii) holds, then the best ...
17
Analysis of Cripto expression during mouse cardiac myocyte differentiation
... the mouse Cripto gene and the lineage of Cripto-expressing cells, focusing on its relationship with cardiac myocyte ...The mouse Cripto gene is initially expressed at late head fold (LHF) stages in the ...
6
Min(d)ing the Telecommunications Infrastructure
... A distinguishing feature of the electronic superhighway is or will be, äs I noted above, Integration. The Integration which the electronic superhighway bringe occurs on the level of tele[r] ...
16
On a difference equation with min max response
... We investigate the global behavior of the (positive) solutions of the difference equation x n+1 = α n + F(x n ,...,x n−k ), n = 0, 1,..., where (α n ) is a sequence of positive reals and F is a min-max function in ...
12
Predictive Models for Min-Entropy Estimation
... for min-entropy: If p ∗ is the probability of predicting the next sample using the best possible predictor, then H = − log 2 (p ∗ ) is the min-entropy of the next ...
20
Comparative Evaluation of subarachnoid block with low dose bupivacaine and fentanyl Vs Low dose bupivacaine and Sufentanil in patients undergoing inguinal surgeries
... Assessed by loss of sharp sensation to pin prick using 23 G sterile needle bilaterally. The assessment was started immediately after turning the patient to supine position and continued every 20 seconds till loss of pin ...
85
Optimized Load balancing in cloud computing using hybrid approach of Round Robin and Min-Min scheduling
... with Min-Min scheduling approach has been used for load balancing and by analyzing various performance evaluation parameters we can conclude that proposed approach provide better results in terms of overall ...
6