miR-135b
<p>CircLARP4 Suppresses Cell Proliferation, Invasion and Glycolysis and Promotes Apoptosis in Non-Small Cell Lung Cancer by Targeting miR-135b</p>
... and miR-135b was explored by RIP assay using the Magna RIP RNA-binding Protein Immunoprecipitation kit ...and miR-135b were examined using ...
12
miR-135b suppresses tumorigenesis in glioblastoma stem-like cells impairing proliferation, migration and self-renewal
... that miR-135b expression is coupled to a significant decrease in the expression of SDC4 and β 1 integrin transcripts, along with other ligands and receptors of the ...
16
Original Article Effect of miR-135b inhibitor on biological characteristics of osteosarcoma cells through up-regulating PPM1A
... that miR-135b played an important role in human physiologic and patho- logic processes: miR-135b could directly regu- late the bone marrow mesenchymal stem cells to inhibit the formation of ...
11
miR-135b-5p inhibits LPS-induced TNF aproduction via silencing AMPK phosphatase Ppm1e
... by miR-135b-5p decreased LPS-induced ROS production and NFκB ...by miR-135b-5p were almost abolished with AMPK ...that miR-135b-5p activates AMPK to attenuate LPS-induced ROS ...
9
Original Article miR-135b-5p regulates human mesenchymal stem cell osteogenic differentiation by facilitating the Hippo signaling pathway
... of miR-222 has been shown to accelerate bone healing with the enhancement of osteogenesis [7], and miR-27a has been reported to attenu- ate adipogenesis and promote osteogenesis in steroid-induced rat BMSCs ...
9
miR-135b expression downregulates Ppm1e to activate AMPK signaling and protect osteoblastic cells from dexamethasone
... a miR-135b expressing construct (see Methods) and stably transfected it into osteoblastic ...that miR-135b was indeed over-expressed in the stable OB-6 cells after ...of ...
10
<p>Circular RNA CDR1as acts as a sponge of miR-135b-5p to suppress ovarian cancer progression</p>
... Speci fi c siRNAs were constructed by GenePharma Co., Ltd., of China. Their sequences were as follows: hsa-miR-135b-5p inhibitor: UCACAUAGGAAUGAAAAGCCAUA (anti- sense 5 ’ -3 ’ ), negative control (NC) ...
11
miR-135b-5p enhances doxorubicin-sensitivity of breast cancer cells through targeting anterior gradient 2
... as miR-342 and miR-30e, were reported in breast cancer and some miRNAs were proposed as predictive markers of drug resistance [16, 31, ...of miR-135b-5p was in parallel with up-regulation of ...
13
Serum high expression of miR-214 and miR-135b as novel predictor for myeloma bone disease development and prognosis
... For miR-135b, Schaap-Oziemlak et al. reported that miR-135b down- regulation is functionally important for full osteogenic differentiation and mineralization of human unrestricted somatic stem ...
12
MicroRNA-135b, a HSF1 target, promotes tumor invasion and metastasis by regulating RECK and EVI5 in hepatocellular carcinoma
... that miR-135b was frequently amplified and upregulated in HCC ...of miR-135b was inversely correlated with the occurrence of tumor ...addition, miR-135b promoted HCC cell ...
13
Original Article Down-regulation of microRNA-135b inhibited growth of cervical cancer cells by targeting FOXO1
... of miR-135b is in varieties of tu- mors. However, the roles of miR-135b in cervical cancer remain ...of miR-135b in cervical cancer cell lines, discussing whether it could be a ...
11
Application of serum microRNA-9-5p, 21-5p, and 223-3p combined with tumor markers in the diagnosis of non-small-cell lung cancer in Yunnan in southwestern China
... of miR-9-5p (#CD201-0142), miR-21-5p (#CD201-0092), miR-223-3p (#CD201-0099), miR-135b-5p (#CD201-0213), miR-339-5p (#CD201-0360), and miR-501-5p (#CD201- 0641) were ...
11
Screening miRNAs for early diagnosis of colorectal cancer by small RNA deep sequencing and evaluation in a Chinese patient population
... of miR-18a-5p and miR-21-3p or downregulation of miR-133a-3p in adenoma and cancer tissues may serve as an index for early screening of colorectal ...as miR-135b-5p, miR-17-5p, ...
8
Original Article MicroRNA-132 inhibits human osteosarcoma cell proliferation and migration by targeting SOX4
... of miR-132 activity in human osteosarco- ma tissues and cells. miR-132 expression was measured in human osteosarcoma tissues by quantitative real-time polymerase chain ...reaction. miR-132 mimics, ...
9
MiR-26a/miR-26b represses tongue squamous cell carcinoma progression by targeting PAK1
... 8]. MiR-26a and miR-26b make up the miR-26 family [9]. MiR-26a and miR-26b are commonly dysregulated in various can- cers, as well as involve in multiple biological processes via ...
14
miR-495 inhibits proliferation, migration, and invasion and induces apoptosis via inhibiting PBX3 in melanoma cells
... of miR-495 in melanoma ...for mir-495. (B) mir-495 targeted the wild-type but not the mutant 3′UTr of ...of mir-495 repressed PBX3 mrna expression level (left) and protein level (middle and ...
12
Loss of has-miR-337-3p expression is associated with lymph node metastasis of human gastric cancer
... The oligonucleotides were synthesized by GenePharma (GenePharma, Shanghai, China) and hsa-miR-134 and hsa-miR-337-3p mimics and inhibitors were purchased from Ambion (Austin, TX). miRNA mimics and ...
9
The PTTG1-targeting miRNAs miR-329, miR-300, miR-381, and miR-655 inhibit pituitary tumor cell tumorigenesis and are involved in a p53/PTTG1 regulation feedback loop
... between miR-329, miR-300, miR-381 and miR-655 and the mRNA of ...the miR-329, miR- 300, miR-381 and miR-655 sequences were synthesized (Figure ...and ...
15
Investigating the mechanism of hepatocellular carcinoma progression by constructing genetic and epigenetic networks using NGS data identification and big database mining method
... and mir-590) to their target genes may contribute to perturbation of the MAPK pathway and the TGF-β pathway, resulting in the aberrant regulation of TFs ...(i.e. mir-374a, mir135b, mir-21, let-7a, ...
21
Original Article A three-miRNA signature as a potential biomarker for the diagnosis of glioma
... This study focuses on the observation of dereg- ulated miRNA expression in plasma samples from glioma patients. Our results demonstrate that miRNAs circulating in peripheral blood may serve as novel biomarkers for the ...
10