nucleoside 5′-diphosphate kinase
SwoHp, a Nucleoside Diphosphate Kinase, Is Essential in Aspergillus nidulans
... were 5⬘-CGGGATCCCGATGACTAAGGAAAAAAGCGGCCGCAAAACTAATT CTGAGCAGACGTAAGTGCAT and 5⬘-ACATGCATGCATGTTTATTCCT ...primers 5⬘-CGGGATCCCGATGACT and 5⬘-GTTGG ...
9
Crystallographic and Biochemical Analysis of Rotavirus NSP2 with Nucleotides Reveals a Nucleoside Diphosphate Kinase-Like Activity
... NDP kinase (Dictyostelium discoideum), shown in rainbow colors from N- to C-terminal residues, with a bound nucleotide (PDB file ...NDP kinase structure ...
13
Sequence-based prediction of permissive stretches for internal protein tagging and knockdown
... Adenylate kinase; ADP: Adenosine diphosphate; AMP: Adenosine monophosphate; ASA: Absolute surface area; aTc: Anhydrotetracycline; ATP: Adenosine triphosphate; Bla: β -lactamase; CFX: Cell-free extract; CoS- ...
17
Nm23/nucleoside diphosphate kinase-A as a potent prognostic marker in invasive pancreatic ductal carcinoma identified by proteomic analysis of laser micro-dissected formalin-fixed paraffin-embedded tissue
... To confirm the association between Nm23/NDPK-A and the prognosis of invasive pancreatic ductal carcinoma, we immunohistochemically analyzed a 96-case cohort (62 men, 34 women; mean age, 64 years). Baseline ...
11
Escherichia coli Strains (ndk) Lacking Nucleoside Diphosphate Kinase Are Powerful Mutators for Base Substitutions and Frameshifts in Mismatch-Repair-Deficient Strains
... 1534 5⬘ AGCTGTCTCAG 3⬘ ...TCGACAGAGTC 5⬘ normal mutation rate, have played an important role 1538 5⬘ TAAACTGAGAC 3⬘ in the elucidation of DNA repair systems and the charac- 3⬘ ATTTGACTCTG 5⬘ ...
10
Sharma, Rita (2006): Phosphorylation of chloroplast preproteins and the characterisation of nucleoside diphosphate kinase 2. Dissertation, LMU München: Fakultät für Biologie
... all of them applied this technique for the transfer of the DNA and then the propagation of these protoplasts to obtain transformed plants (Schnorf et al., 1991). Our purpose of using the microinjection technique diverged ...
100
Role of Interaction and Nucleoside Diphosphate Kinase B in Regulation of the Cystic Fibrosis Transmembrane Conductance Regulator Function by cAMP-Dependent Protein Kinase A
... The CFTR fragment comprising the CFTR domains, nucleotide binding domain 1 (NBD1 domain—351 (TRQ>>) to 727 (GIEED)), R-domain -635 (NLQ>>) to 837 (FFDDM)) and nucleotide binding domain 2 (NBD2, 1151 ...
25
Involvement of nucleoside diphosphate kinase b and elongation factor 2 in Leishmania braziliensis antimony resistance phenotype
... Leishmaniasis refers to a disease complex caused by protozoan Leishmania parasites which are transmitted to humans by the bite of infected female phlebotomine sandflies. According to the World Health Organization (WHO), ...
12
Role of Binding and Nucleoside Diphosphate Kinase A in the Regulation of the Cystic Fibrosis Transmembrane Conductance Regulator by AMP-activated Protein Kinase
... Interference of CFTR-AMPK Binding by CFTR-1420-57 Peptide—Previous studies led us to propose that the interaction of AMPK with CFTR may help target AMPK and other proteins to CFTR in epithelial cells (15). These ...
15
CSGID solves structures and identifies phenotypes for five enzymes in Toxoplasma gondii
... (PGMII), nucleoside diphosphate kinase (NDK), ribulose phosphate 3-epimerase (RPE), ribose-5-phosphate isomerase (RPI), and ornithine aminotransferase (OAT) were structurally ...
21
Dissecting the Unique Nucleotide Specificity of Mimivirus Nucleoside Diphosphate Kinase
... virus-encoded nucleoside diphosphate kinase (NDK), an enzyme that is central to the synthesis of RNA and DNA, ubiquitous in cellular organisms, and well conserved among the three domains of ...
9
Identification of a nucleoside analog active against adenosine kinase–expressing plasma cell malignancies
... purine nucleoside biosynthesis, we can postulate a model whereby enhanced ADK expression levels in sensitive cells effectively carry out rapid drug activation, enabling it to reach its “true” target(s) within the ...
16
Phosphatidic acid: biosynthesis, pharmacokinetics, mechanisms of action and effect on strength and body composition in resistance-trained individuals
... A third pathway which generates PA utilizes diacylglyc- erol (DAG) as its substrate. DAG can emanate from stored fat as triacylglycerol, as well as the glycerophospholipid phosphatidylinositol (PI). In order to produce ...
9
The yin and yang functions of extracellular ATP and adenosine in tumor immunity
... Among P2Rs, P2X7R is the most potential candidate in anticancer therapy [96]. P2X7R was reported to be expressed in multiple malignant tumors, including neuroblastoma [97], melanoma [98], prostate cancer [99], lung ...
11
Reactivation of thymidine kinase-defective herpes simplex virus is enhanced by nucleoside.
... FIG. 1. HSV antigen detected after dTdR explant cultivation of drg latently infected with 3B TK 2 HSV. Viral plaques were tested with monospecific antibody to HSV glycoprotein C. Confluent monolayers of Vero cells on ...
6
Galactosemia : A Genetic Disease of Leloir Pathway Sikander Ali, Rabia Iqbal Khan, Almas Azhar
... Galactose kinase (GALK) is the member of GHMP superfamily of enzyme on the basis amino acid sequence similarity. It carries out the conversion of D-galactose to galactose-1-phosphate. Kinetic properties of this ...
9
Metabolic engineering of Escherichia coli for production of mixed isoprenoid alcohols and their derivatives
... 39 and 47 mg/L, respectively (Additional file 1: Fig. S4). However, the concentrations of FPP-derived products (farnesol, farnesal, and farnesyl acetate) of the strains NA-MBF1.1a and NA-MBF1.2a significantly increased ...
12
The UL97 gene product of human cytomegalovirus is an early-late protein with a nuclear localization but is not a nucleoside kinase.
... truncated UL97 ORFs, the expressed protein is clearly re- tained in the cytoplasm, but entry into the nucleus is not completely abolished. Schmolke et al. (25) have identified two structurally and functionally distinct ...
8
Antimicrobial studies of stem bark extract and their phytoconstituent from Semecarpus anacardium L.
... Background & Objective: To investigate the antimicrobial properties of stem bark extract of S. anacardium and their phytoconstituent using agar well diffusion and in silico docking methods. Methodology: In vitro ...
10
Reinvestigation of cadmium diphosphate
... Bond-valence sums (Brown, 2002) were computed at the end of the refinement using the softBV applet (Adams, 2004): Cd1 (six neighbours) 1.80 v.u., Cd2 (six) 2.12 v.u., P1 (four) 4.91 v.u. and P2 (four) 4.95 v.u., and a ...
9