NZB/W
Therapeutic impact of the ethyl acetate extract of Tripterygium wilfordiiHook F on nephritis in NZB/W F1 mice
... the NZB/W F1 mouse or an indirect effect by inhibiting the production of cytokines and/or inflammatory mediators is currently ...the NZB/ W F1 mice or in ...in NZB/ W F1 ...
11
Activation of natural killer T cells in NZB/W mice induces Th1 type immune responses exacerbating lupus
... adult NZB/W mice as judged by ear- lier onset of proteinuria and mortality than that which occurred in PBS/vehicle–treated ...adult NZB/W mice with this αGalCer regimen contributes to IFN- γ ...
13
Increased expression of Matrix Metalloproteinase 9 in liver from NZB/W F1 mice received antibody against human parvovirus B19 VP1 unique region protein
... APS-like syndrome is recognized as a striking analogy between the clinical features and hematologic findings in patients with SLE or B19 infection [7-11]. APS is charac- terized by raised titers of circulating APhL that ...
9
Sex-specific effects of LiCl treatment on preservation of renal function and extended life-span in murine models of SLE: perspective on insights into the potential basis for survivorship in NZB/W female mice
... Subsequent studies indicated that there was an age dependence for the effectiveness of LiCl treatment in female NZB/W mice. The optimal time to initiate treat- ment was found to be 6–8 weeks of age, when ...
10
Germline deletion of β2 microglobulin or CD1d reduces anti phospholipid antibody, but increases autoantibodies against non phospholipid antigens in the NZB/W F1 model of lupus
... To investigate the role of b2m in the pathogenesis of diverse manifestations of lupus, we generated N12 b2m +/- NZB and N14 b2m +/- NZW mice and intercrossed them to generate the final b2m° BWF1 mice. As shown in ...
11
Altered X-chromosome inactivation in T cells may promote sex-biased autoimmune diseases
... from NZB/W F1 mice at 3 stages: predisease, early-stage disease, and late-stage as assessed by proteinuria ...female NZB/W F1 mice, and we used age-matched WT mice (BALB/c and C57BL/6 strains) ...
20
Nanogel based delivery of mycophenolic acid ameliorates systemic lupus erythematosus in mice
... MPA-loaded nanogels enhance survival of lupus-prone NZB/W F1 mice. The in vivo efficacy of nanogels was tested in female New Zealand black/New Zealand white (NZB/W F1) mice, which develop ...
10
Early treatment with hydroxychloroquine prevents the development of endothelial dysfunction in a murine model of systemic lupus erythematosus
... 15), NZB/W F1 mice with untreated SLE (NZ; n = 30), control treated with HCQ (Ctrl-HCQ; n = 30), and NZB/W F1 mice with SLE treated with HCQ (NZ-HCQ, N = ...
9
Mesangial cells of lupus prone mice are sensitive to chemokine production
... of NZB/W mice. DBA/W mice do not spontaneously develop autoim- mune disease; mice were monitored throughout their lifespan and show no proteinuria or detectable anti-double-stranded DNA or anti-DNA ...
10
SLE Complex cytokine effects in a complex autoimmune disease: tumor necrosis factor in systemic lupus erythematosus
... Understanding how the immune system integrates the pleiotropic properties of TNF is a challenge, particularly so in diseases like SLE. TNF is both a proinflammatory cytokine and an immunoregulatory cytokine. TNF has dif- ...
6
Sex differences in the expression of lupus-associated miRNAs in splenocytes from lupus-prone NZB/WF1 mice
... of anti-dsDNA autoantibodies by 18 wks of age. Auto- antibodies against dsDNA in the first cohort of female mice continued to increase by 23 wks of age when the mice were terminated (Figure 2B). In the second cohort of ...
13
Interleukin 6 promotes murine lupus in NZB/NZW F1 mice
... inhibited IL-6 in lupus-prone NZB/NZW F1(B/W) mice by chronic administration of a rat mAb to mouse IL-6. Anti-IL-6 alone elicited an anti-rat response that blocked its biologic effects. To circumvent this ...
8
Search for triboson W±W±W∓ production in pp collisions at √s=8 TeV with the ATLAS detector
... S. J. Sekula 42 , D. M. Seliverstov 124,* , N. Semprini-Cesari 22a,22b , C. Serfon 120 , L. Serin 118 , L. Serkin 168a,168b , M. Sessa 135a,135b , R. Seuster 173 , H. Severini 114 , T. Sfiligoj 77 , F. Sforza 32 , A. ...
28
Elevated Generation of Reactive Oxygen/Nitrogen Species in Hantavirus Cardiopulmonary Syndrome
... in NZB mice, we wished to determine whether RONS blockade would improve morbidity and mortality in LCMV-13-infected ...LCMV-13-infected NZB mice. NZB mice were sacrificed at ...
13
Diagnoza partycypacji w kulturze w województwie podlaskim
... partycypacji w kulturze jest wiedza na temat dostępnych instytucji ...te w ogóle mają ...jest w świadomości lokalnej czy re - gionalnej. Dzięki temu każda z ujętych w badaniu instytucji, może ...
188
Increased renal thromboxane production in murine lupus nephritis
... and NZB X NZW F1 hybrid mice as renal function deteriorated and renal pathologic events progressed; (b) there were no consistent increases in the levels of two other cyclooxygenase metabolites, PGE2 or 6 keto PGF1 ...
9
Characterization of a molecularly cloned retroviral sequence associated with Fv-4 resistance.
... Nucleotide and deduced amino acid retroviral sequences of pFv4 are aligned with corresponding sequences of AKV623 ecotropic 13, 25 and reported NZB IU6 xenotropic 33 MuLV sequences.. Nuc[r] ...
10
The NXSM recombinant inbred strains of mice: genetic profile for 58 loci including the Mtv proviral loci.
... allele. Dots denote each proviral fragment common to all three strains. Triangles mark fragments unique to the NZB/ BINJ strain. Sizes of fragments are given at the left of ea[r] ...
16
The P2X7receptor is a candidate product of murine and human lupus susceptibility loci: a hypothesis and comparison of murine allelic products
... the NZB mouse genomic sequence encompassing the T1352C polymorphism [9] was per- formed using the forward and reverse primers CCT- GTCTAGGCTGTCCCTAT and GCTTATGGAAGAGCTTGGAG for 30 ...
8
Generation of Antibodies against Bovine Recombinant Prion Protein in Various Strains of Mice
... In this communication, the development of antibodies against recombinant bovine prion protein (brecPrP) in four strains of mice (BALB/c, ND4, SJL, and NZB/NZW F 1 ) is.. described.[r] ...
8