Oil Red O staining
Original Article Comparison of the characteristics of human gingival fibroblasts isolated by tissue explants and by enzyme digestion methods
... assay. Oil red O staining and alizarin red staining were performed to identify the adipogenic and osteogenic differentiation of hGFs and the differentiation capacity was ...
7
Impaired autophagy triggered by HDAC9 in mesenchymal stem cells accelerates bone mass loss
... GCCCAGTTTTTG-3′; reverse sequence—5′-AATT- CAAAAACTGGGCACAAAATTCTGAACACTCGAGT GTTCAGAATTTTGTGCCCAG-3′. The shHDAC9 lentivirus was packaged by co-transfecting shHDAC9 lentiviral vector with two packaging systems (pMD2.G ...
16
Advanced glycation end products (AGEs) increase renal lipid accumulation: a pathogenic factor of diabetic nephropathy (DN)
... increased Oil Red O staining and intracellular cholesterol ester (CE) in HK-2 cells; Anti-RAGE (AGEs receptor) reduced lipid droplets and the CE ...strong staining of Oil ...
9
Investigating mechanisms underpinning the detrimental impact of a high-fat diet in the developing and adult hypermuscular myostatin null mouse
... e Representative histological images of liver fat contents by Oil Red O staining from wild type (WT) and myostatin null (Mstn − / − ) male mice subjected to a normal (ND) or high-fat (HF[r] ...
21
MicroRNA-613 represses lipogenesis in HepG2 cells by downregulating LXRα
... -UTR. Oil Red O staining revealed that miR-613 reduced LXRα-induced lipid droplet accu- mulation in HepG2 cells, which was also attenuated by ec- topic expression of ...
9
Bioassay guided isolation of active anti adipogenic compound from royal jelly and the study of possible mechanisms
... with Oil Red O staining and TG content assay on 3 T3-L1 adipocytes, further study was carried out in molecular level for the expression of adipogenic transcription factors such as PPAR γ , ...
14
Europium Fluorescence to Visualize N Butyl 2 Cyanoacrylate in Embolized Vessels of an Arteriovenous Malformation Swine Model
... europium staining allows for better characterization of the Lipiodol-NBCA mixture be- havior after embolization compared with Oil-Red- O ...
7
Original Article Systemically transplanted human gingiva-derived mesenchymal stem cells contributing to bone tissue regeneration
... by Oil Red O staining, which indicated GMSCs could differ- entiate into adipocytes (Figure ...Alizarin Red S staining (Figure ...blue staining (Figure 1I). Whereas, no ...
8
Adipocytes promote tumor progression and induce PD-L1 expression via TNF-α/IL-6 signaling
... 3 Conditional media of 3T3‑L1 adipocytes induced PD‑L1 expression on HepG2 and B16‑F1 cells.. a Oil‑red O staining and quantification of lipids in 3T3‑L1 preadipocytes and adipocytes[r] ...
9
Targeted regulation of fibroblast state by CRISPR-mediated CEBPA expression
... Methods: Lung fibroblast CEBPA expression, pro-fibrotic and lipofibroblast gene expression were assessed by qRT- PCR. CEBPA gain and loss of function experiments were carried out to evaluate the role of CEBPA in human ...
12
Cannabidiol exerts sebostatic and antiinflammatory effects on human sebocytes
... Figure 2. CBD exerts sebostatic effects in vitro and under “in vivo–like” circumstances. (A) CyQUANT proliferation assay after 72-hour treatments. *P < 0.05, ***P < 0.001 compared with the 72-hour vehicle control. ...
13
Oleuropein as an inhibitor of peroxisome proliferator-activated receptor gamma
... from Oil Red O staining showed that oleuropein reduced total lipid content in a dose-dependent manner, in the same extent as in the absence of catalase ...
8
MD 1, a poly herbal formulation indicated in diabetes mellitus ameliorates glucose uptake and inhibits adipogenesis – an in vitro study
... HAEF inhibited lipid accumulation and down regulated the mRNA expression of adipogenic transcription factors Adipogenesis is a complex process controlled by several harmones, adipokines and growth factors. MD-1 effect on ...
11
Oil Red O (ORO) reagent for detection of latent fingermarks: a review
... Oil Red O (ORO) is a lipophilic ...biological staining techniques since the late 1920s to stain lipid material in tissue sections (Beaudoin 2004; French 1926; Proescher ...
7
Augmented atherogenesis in LDL receptor deficient mice lacking both macrophage ABCA1and ApoE
... in oil red-O stained cryostat sections of the aortic root and whole aortic arches were quantified using the Leica image analysis system, consisting of a Leica DMRE microscope coupled to a video ...
9
Extract Ethyl Acetate Red Fruit (Pandanus Conoideus Lam.) as a Counterstain in Gram Staining Technique
... Microbiology is one of the basic branches of medical science (Basic Medical Science) who studied the life of microorganisms are bacteria that can cause disease in humans and animals. Bacteria have unique characteristics ...
5
Checklist of Amphibians and Reptiles at the Malaysian Palm Oil Board Research Station, Kluang, Johor
... were observed in five survey sites. H. glandulosa and M. heymonsi were found to be highly abundant in the riparian areas of the plantation (survey sites 2, 4 and 5), evidenced by numerous large calling groups of both ...
7
Composite resin susceptibility to red wine staining after water sorption
... Baseline$ color$ measurement$ was$ determined$ according$ to$ the$ CIE$ L*a*b*$ color$ scale$ (Commission$ Internationale$ de$ I’Eclairage)$relative$ to$ the$standard$illuminant$ ...
6
Inferior Olivary nucleus degeneration does not lessen tremor in essential tremor
... On microscopic examination (J.P.G.V.), there were Alzheimer’s disease neuropathological changes, with paren- chymal amyloid burden of deposits = A2, Braak & Braak stage for neurofibrillary tangles of Alzheimer = ...
10
Anti Cutaneous Aging Effect of Red Djulis
... of red djulis extracts in fibroblasts with or without red djulis extract treatment: (a) Collagen immunofluorescence staining (b) collagen secretion of red djulis extracts treatment and (c) ...
20