Plasmodium vivax
A Novel Erythrocyte Binding Protein of Plasmodium vivax Suggests an Alternate Invasion Pathway into Duffy Positive Reticulocytes
... parasites. Plasmodium vivax has the distinctive characteristic of invading reticulocytes, with a particular preference for reticulo- cytes expressing the surface Duffy blood group antigen, and ...P. ...
5
Analytical Study of Plasmodium Vivax
... Abstract: Protein sequence of plasmodium vivax was found from genpept data base (ACCESSION NO.-P22290) .We use P2290 to predict its amino acid, atomic, PEAST region, solvent accessibility, molecular mass, ...
7
Imported Plasmodium vivax malaria with severe thrombocytopaenia: can it be severe malaria or not?
... P. vivax infection with schizonts, gametocytes and ring forms being detected and a very low parasitaemia ...%). Plasmodium vivax monoinfection was subsequently confirmed by DNA polymerase chain ...
9
Plasmodium vivax: who cares?
... consequence, Plasmodium vivax, which has long been neglected and mistakenly considered inconsequential, is now entering into the strategic debates taking place on malaria epidemiology and control, drug ...
18
Assessment of drug resistance associated genetic diversity in Mauritanian isolates of Plasmodium vivax reveals limited polymorphism
... Both Plasmodium falciparum and Plasmodium vivax are endemic in Mauritania with approximately 300,000 malaria cases reported in 2017 ...P. vivax has been shown to be the main causative species ...
7
Sequence conservation of Plasmodium vivax glutamate dehydrogenase among Korean isolates and its application in seroepidemiology
... Plasmodium vivax has been prevalent in Korea for a long ...of vivax malaria rap- idly decreased during the 1960s and 1970s ...P. vivax have been tested for use as antigens for serodiagnosis, ...
11
Demographic and clinical profiles of Plasmodium falciparum and Plasmodium vivax patients at a tertiary care centre in southwestern India
... for Plasmodium falciparum and Plasmodium vivax, posing challenges for malaria control and elimination planning because the two parasite spe- cies may differ in mosquito vectors, spatial distributions ...
11
Genetic diversity of Plasmodium vivax and Plasmodium falciparum in Honduras
... of Plasmodium vivax and Plasmodium falciparum from endemic areas in ...P. vivax, and msp-1 and msp-2 for ...within Plasmodium isolates from ...P. vivax isolates while pvama-1 was ...
10
Pharmaceutical services for endemic situations in the Brazilian Amazon: organization of services and prescribing practices for Plasmodium vivax and Plasmodium falciparum non complicated malaria in high risk municipalities
... The PNCM ’ s adopted control rationale focuses on early diagnosis and adequate treatment, while also favouring prevention strategies. All malaria actions are under the responsibility of the Brazilian government. After ...
9
The anaemia of Plasmodium vivax malaria
... of vivax malaria, at least in the acute phase, can be explained by re- moval of uninfected red cells in response to immune system activation, the magnitude of the immune response (of which intensity of symptoms ...
14
High prevalence of very low Plasmodium falciparum and Plasmodium vivax parasitaemia carriers in the Peruvian Amazon: insights into local and occupational mobility related transmission
... P. vivax trans- mission must address the interruption of transmission at the local level on subpatent parasitemics as well as hyp- nozoite ...P. vivax within Anophelines ...
15
A novel method for extracting nucleic acids from dried blood spots for ultrasensitive detection of low density Plasmodium falciparum and Plasmodium vivax infections
... have no visible evidence of fungal contamination in any instance. 903 Protein Saver cards, therefore, can be used to prevent fungal growth for sample collection during the rainy season (and in this instance it also ...
11
Absence of Plasmodium inui and Plasmodium cynomolgi, but detection of Plasmodium knowlesi and Plasmodium vivax infections in asymptomatic humans in the Betong division of Sarawak, Malaysian Borneo
... P. vivax infected samples by nested reverse transcription PCR (182/1005) or nested PCR (24/1005) was attributed to the amount of template used in the assay which was DNA or RNA extracted from whole blood samples ...
11
High rates of asymptomatic, sub-microscopic Plasmodium vivax infection and disappearing Plasmodium falciparum malaria in an area of low transmission in Solomon Islands
... P. vivax and ...P. vivax and ...P. vivax and ...P. vivax remains firmly endemic, with high rates of sub-microscopic, afebrile and genetically diverse ...P. vivax compared to ...P. ...
18
Microscopic and molecular evidence of the presence of asymptomatic Plasmodium falciparum and Plasmodium vivax infections in an area with low, seasonal and unstable malaria transmission in Ethiopia
... different Plasmodium species were identified by microscopy and species-specific nested-PCR ...P. vivax , primers for primary PCR (outer): CGCCATTATAGCCCTGAGCA and TCTC ACGTCGATGAGGGACT ...
10
Prevalence of drug resistance associated mutations in Plasmodium vivax against sulphadoxine pyrimethamine in southern Pakistan
... It is underlined that the aim of the study was to pro- vide molecular epidemiological data on frequency distri- bution of pvdhfr-pvdhps haplotypes so that data on prevalent SP resistant alleles could be reported. Neither ...
9
Comparison of three molecular methods for the detection and speciation of Plasmodium vivax and Plasmodium falciparum
... The samples for this study were collected between the months of March and October 2006 from volunteers seek- ing care at malaria clinics in Pong Nam Ron, Chanthaburi Province, near the Thailand-Cambodia border and Suan- ...
7
Chloroquine efficacy for Plasmodium vivax malaria treatment in southern Ethiopia
... The study was conducted in Southern Ethiopia, at health centres located in Shele in Arba Minch Zuria district, Guba in Halaba district, Batu in Adami Tulu Jido Kom- bolcha district and Shone in Eastern Badawacho district ...
8
Genetic diversity and natural selection of Plasmodium vivax multi drug resistant gene (pvmdr1) in Mesoamerica
... P. vivax has been at some extent circulating in the American ...P. vivax [46, ...P. vivax in the Mesoamerican region comparing to other sites of America and ...P. vivax mdr1 at different sites ...
11
AN EFFICIENT INFORMATION RETRIEVAL SYSTEM USING QUERY EXPANSION AND DOCUMENT RANKING
... the plasmodium falciparum, plasmodium vivax, plasmodium ovale and plasmodium malaria have not been able to provide significant separation for each class in the malaria ...
7