The cGAS-STING pathway
Activating cGAS-STING pathway for the optimal effect of cancer immunotherapy
... Activated cGAS-STING pathway and its downstream sig- nals boost the whole cancer-immunity cycle by enhancing cross-presentation and immune-killing ...Therefore, cGAS-STING agonist is an ...
12
miR29a and miR378b Influence CpG-Stimulated Dendritic Cells and Regulate cGAS STING Pathway
... 5. Conclusions In summary, we describe an interaction between miRNAs and CpG, promoting the activation of BMDCs. Firstly, we selected six miRNAs whose expression levels were altered by CpG in BMDCs. Secondly, we found ...
19
African Swine Fever Virus Armenia/07 Virulent Strain Controls Interferon Beta Production through the cGAS-STING Pathway
... the cGAS-STING pathway by impairing STING activation during infec- ...the cGAS-STING pathway is efficiently activated during NH/P68 at- tenuated strain infection, leading ...
17
Interaction between susceptibility loci in cGAS-STING pathway, MHC gene and HPV infection on the risk of cervical precancerous lesions in Chinese population
... The cGAS- STING pathway in innate immunity plays an important role in protecting against HPV ...of cGAS, STING and MHC polymorphisms on susceptibility to cervical precancerous lesions, ...
11
<p>The cGAS/STING pathway: a sensor of senescence-associated DNA damage and trigger of inflammation in early age-related macular degeneration</p>
... that cGAS responded to mitochondrial damage-induced in fl ammasome activation and thus played an important role in the regulation of geographic ...the cGAS/STING pathway in the development of ...
7
cGAS-STING Signaling Regulates Initial Innate Control of Cytomegalovirus Infection
... a cGAS/STING/IRF3 pathway. Disruption of STING expression by CRISPRs revealed an essential role in eliciting IFN-I responses and restricting CMV ...mice, STING is necessary for the ...
9
Knockout of cGAS and STING Rescues Virus Infection of Plasmid DNA-Transfected Cells
... if cGAS/STING knockout rescues the infection efficiency of plasmid DNA-transfected cells, we again performed transfection/infection ...the cGAS/STING pathway, and the resulting ...
5
cGAS/STING axis mediates a topoisomerase II inhibitor–induced tumor immunogenicity
... As STING expression is often dysregulated in human cancers (42), an immunohistochemical test of intratumoral STING expression may help predict patient response to such combination ...IFN-I pathway ...
14
Herpes Simplex Virus 1 Tegument Protein VP22 Abrogates cGAS/STING-Mediated Antiviral Innate Immunity
... Several evidences suggest that VP22 inhibits IFN-  activation by the cGAS/STING pathway. First, ectopic expression of VP22 could significantly inhibit the activation of the IFN-  promoter. VP22 ...
11
Human Cytomegalovirus Tegument Protein pp65 (pUL83) Dampens Type I Interferon Production by Inactivating the DNA Sensor cGAS without Affecting STING
... IFI16/cGAS/STING pathway affected the secretion of IFN- , we performed an ELISA specific for IFN- using supernatants obtained from HFFs permanently depleted of IFI16, cGAS, or STING, ...
18
Brain immune cells undergo cgas/sting-dependent apoptosis during herpes simplex virus type 1 infection to limit type I IFN production
... this, cGAS-dependent apoptosis was most abundant in areas with a high viral ...a cGAS-depen- dent manner as an immediate response to sensing viral ...the cGAS/STING pathway may drive ...
17
<p>Epigallocatechin-3-Gallate Protects H<sub>2</sub>O<sub>2</sub>-Induced Nucleus Pulposus Cell Apoptosis and Inflammation by Inhibiting cGAS/Sting/NLRP3 Activation</p>
... ammasome pathway, was up-regulated in IVD sam- ples from IDD ...between cGAS and Sting expression and NLRP3 levels in IDD cases and that provide us evidence of the potential regulation effect of ...
10
Cgas And Sting Mrnas Are Transcriptionally Suppressed
... and sting mrnas are suppressed in head of aids kaposi sarcoma with nucleic acid biosynthesis and prospective studies of ...to sting are suppressed in the conditioned media derived from all cases, ...
26
Adenovirus Detection by the cGAS/STING/TBK1 DNA Sensing Cascade
... the cGAS/STING/TBK1/IRF3 ...the STING/TBK1/cGAS pathway in human cell lines needs to be fully ...and cGAS signaling cascades are equally available, the determinants guiding use ...
8
Herpes Simplex Virus 1 Abrogates the cGAS/STING-Mediated Cytosolic DNA-Sensing Pathway via Its Virion Host Shutoff Protein, UL41
... DNA-sensing pathway by degrading cGAS via its RNase ...the cGAS/STING-mediated cellular DNA-sensing pathway by selectively degrading cGAS ...endogenous cGAS could ...
9
Diminished Innate Antiviral Response to Adenovirus Vectors in cGAS/STING-Deficient Mice Minimally Impacts Adaptive Immunity
... both cGAS and STING knockout ...AdV-treated cGAS ⫺/⫺ or STING ⫺/⫺ ...for cGAS ⫺/⫺ and STING ⫺/⫺ ...in cGAS ⫺/⫺ or STING ⫺/⫺ BMDCs would be TBK1 activation of a ...
13
Conservation of the STING-Mediated Cytosolic DNA Sensing Pathway in Zebrafish
... zebrafish cGAS was dispensable for sensing HSV-1 in ...brafish cGAS ortholog does not necessarily have detectable se- quential identity to its mammalian ...the cGAS functional counterpart at all. ...
11
Rocaglamide promotes the infiltration and antitumor immunity of NK cells by activating cgas-sting signaling in non-small cell lung cancer
... The cGAS-STING signaling plays an important role in innate antitumor immunity, and it is an attractive anti-cancer immunotherapeutic drug target ...by cGAS, leading to activation of STING, ...
14
Evasion of the STING DNA-Sensing Pathway by VP11/12 of Herpes Simplex Virus 1
... sensor STING as a broad antimicrobial factor that restricts HSV by activating type I interferon (IFN) and proinflammatory responses upon sensing of foreign DNA, or noncanonical cyclic dinucleotides, which are ...
17
Emerging Alphaviruses Are Sensitive to Cellular States Induced by a Novel Small-Molecule Agonist of the STING Pathway
... for DDX41, TGGAGGAGTCGGAACCCGAA; for IFI16, TATACCAACGCTTGAAGACC; and for cGAS, GAACTTT CCCGCCTTAGGCA. Lentivirus was made by transfecting the lentivector along with a packaging plasmid (psPAX2; AddGene) and a ...
19