Toxin Antitoxin
The Toxin Antitoxin MazEF Drives Staphylococcus aureus Biofilm Formation, Antibiotic Tolerance, and Chronic Infection
... ABSTRACT Staphylococcus aureus is the major organism responsible for surgical im- plant infections. Antimicrobial treatment of these infections often fails, leading to ex- pensive surgical intervention and increased risk ...
15
TOXIN–ANTITOXIN SYSTEMS AND THEIR ROLE IN MAINTAINING THE PATHOGENIC POTENTIAL OF CAUSATIVE AGENTS OF SAPRONOSES
... bacterial toxin– antitoxin systems in recent years has made it possible to identify a number of complicated regulatory molecular mechanisms responsible for maintaining the pathogenic potential of resistant ...
17
ESBL-plasmids carrying toxin-antitoxin systems can be “cured” of wild-type Escherichia coli using a heat technique
... for toxin-antitoxin ...ESBL-plasmid-encoded toxin-antitoxin system, includ- ing hok/sok, srnB/C, vagC/D and pemI/K, which were encoded on plasmids of replicon types FIA or FIB carrying bla ...
6
Stable expression plasmids for Streptomyces based on a toxin-antitoxin system
... Background: Bacteria included in the genus Streptomyces exhibit several attractive characteristics that make them adequate hosts for the heterologous expression of proteins. One of them is that some of its species have a ...
10
Computational Modeling and Simulation of Toxin antitoxin System in Acinetobacter baumannii: HicB as a Dynamic Factor for Therapeutic Target
... II toxin-antitoxin modules which first identified in Haemophilus influenza as a bicistronic locus which is related closely to the pilus gene cluster ...HicA toxin in Escherichia coli inhibits the ...
7
Reassessing the Role of Type II Toxin Antitoxin Systems in Formation of Escherichia coli Type II Persister Cells
... II toxin-antitoxin (TA) systems were assumed to play a key role in the for- mation of persister cells in Escherichia coli based on the observation that successive deletions of TA systems decreased ...
14
Reassessing the Role of the Type II MqsRA Toxin Antitoxin System in Stress Response and Biofilm Formation: mqsA Is Transcriptionally Uncoupled from mqsR
... The idea that toxin-antitoxin systems respond to stress and regulate biological processes is not recent (24, 25, 74). For example, many TA systems in E. coli have been shown to be transcriptionally ...
13
The toxic guardians — multiple toxin-antitoxin systems provide stability, avoid deletions and maintain virulence genes of Pseudomonas syringae virulence plasmids
... include toxin-antitoxin (TA) systems and, less prominently, restriction modification loci; these systems ensure plasmid maintenance by inhibiting cell ...
17
Functional Genomics of Stress Response in the Hyperthermophilic Crenarchaeon Sufolobus solfataricus and Role of vapBC Toxin-Antitoxin Loci in RNA Management.
... co-expressed antitoxin is present to bind the toxin, the interaction between both proteins will inhibit the toxin’s activity (Figure ...cognate toxin, in that their susceptibility to intracellular ...
151
In Silico Modeling of RelEB Type II Toxin antitoxin System in Acinetobacter baumannii as a Therapeutic Target via Antimicrobial Photodynamic Therapy
... [20-22]. Toxin-antitoxin modules are one of the virulence factor in several ...II toxin-antitoxin system in ...protein toxin RelE and protein antitoxin RelB ...
6
The phage growth limitation system in Streptomyces coelicolor A(3)2 is a toxin/antitoxin system, comprising enzymes with DNA methyltransferase, protein kinase and ATPase activity
... The phage growth limitation system of Streptomyces coelicolor A3(2) is an unusual bacteriophage defence mechanism. Progeny ϕC31 phage from an initial infection are thought to be modified such that subsequent infections ...
10
The correlation between the presence of quorum sensing, toxin-antitoxin system genes and MIC values with ability of biofilm formation in clinical isolates of Pseudomonas aeruginosa.
... Introduction: Pseudomonas aeruginosa is a Gram-negative bacterium that considered as important opportunistic human pathogen. One of the mechanisms that help bacteria to tolerate survival in adverse conditions and ...
7
Towards Exploring Toxin-Antitoxin Systems in Geobacillus: A Screen for Type II Toxin-Antitoxin System Families in A Thermophilic Genus
... system Toxin-Antitoxin system TADB Toxin-Antitoxin Database UPF Uncharacterized Protein Family VapBC Virulence associated proteins BC wHTH domain winged Helix-Turn-Helix domain XRE Xenobiotic ...
35
RASTA Bacteria: a web based tool for identifying toxin antitoxin loci in prokaryotes
... some toxin motifs pair with antitoxin motifs, or more simply toxins/antitoxins of a given family sometimes demonstrate similarity with those of another fam- ily ...
14
Toxin-antitoxin Systems: Classification, Biological Function and Application in Biotechnology
... the antitoxin is a small molecule called ...the toxin and this results in inhibition of the translation of antitoxin mRNA by degradation via RNase III or by hiding of the Shine-Dalgarno sequence ...
7
Toxin Inactivation in Toxin/Antitoxin Systems
... regulation, toxin MqsR disrupts the MqsA-DNA complex to activate transcription [16] ...when toxin GhoT is produced, which results from membrane damage and reduces ATP [21] ...system toxin (many ...
21
Towards Exploring Toxin-Antitoxin Systems in Geobacillus: A Screen for Type II Toxin-Antitoxin System Families in A Thermophilic Genus
... 124862 125143 WP_013523845; AbrB/MazE/SpoVT family DNA-binding domain- containing protein [ Geobacillus ]. Contig 18_127 ATGGTTTATTATTTGACAGCGGAAGAAATCAT ATTTATCCATTACACGGTCATGGAAATG[r] ...
12
A Toxin Involved in Salmonella Persistence Regulates Its Activity by Acetylating Its Cognate Antitoxin, a Modification Reversed by CobB Sirtuin Deacetylase
... TacT acetylates residue K44 of TacA. As shown by others, TacA copurified with TacT, forming a complex. TacA and TacT proteins were synthesized from a vector containing the coding sequences for both proteins. ...
14
The <em>mazEF </em>toxin–antitoxin system as an attractive target in clinical isolates of <em>Enterococcus faecium</em> and <em>Enterococcus faecalis</em>
... Abstract: The toxin–antitoxin (TA) system is a regulatory system where two sets of genes encode the toxin and its corresponding antitoxin. In this study, the prevalence of TA systems in ...
9
Hidden States within Disordered Regions of the CcdA Antitoxin Protein
... Bacterial toxin-antitoxin (TA) modules regulate cell death and quiescence in nearly all free- living ...an antitoxin inhibits its cognate protein toxin, thereby preventing the toxin ...
33