Toxin-antitoxin system
Computational Modeling and Simulation of Toxin antitoxin System in Acinetobacter baumannii: HicB as a Dynamic Factor for Therapeutic Target
... antibiotics. Toxin-antitoxin system is one of the virulence agents in ...a toxin system is an ideal target for the design of new classes of antimicrobial agents against ...against ...
7
Towards Exploring Toxin-Antitoxin Systems in Geobacillus: A Screen for Type II Toxin-Antitoxin System Families in A Thermophilic Genus
... TA system Toxin-Antitoxin system TADB Toxin-Antitoxin Database UPF Uncharacterized Protein Family VapBC Virulence associated proteins BC wHTH domain winged Helix-Turn-Helix ...
35
In Silico Modeling of RelEB Type II Toxin antitoxin System in Acinetobacter baumannii as a Therapeutic Target via Antimicrobial Photodynamic Therapy
... [20-22]. Toxin-antitoxin modules are one of the virulence factor in several ...II toxin-antitoxin system in ...protein toxin RelE and protein antitoxin RelB ...
6
The phage growth limitation system in Streptomyces coelicolor A(3)2 is a toxin/antitoxin system, comprising enzymes with DNA methyltransferase, protein kinase and ATPase activity
... limitation system of Streptomyces coelicolor A3(2) is an unusual bacteriophage defence ...restriction system that, in part, comprises a toxin/antitoxin system where PglX, a DNA ...
10
Stable expression plasmids for Streptomyces based on a toxin-antitoxin system
... Background: Bacteria included in the genus Streptomyces exhibit several attractive characteristics that make them adequate hosts for the heterologous expression of proteins. One of them is that some of its species have a ...
10
The correlation between the presence of quorum sensing, toxin-antitoxin system genes and MIC values with ability of biofilm formation in clinical isolates of Pseudomonas aeruginosa.
... TA system consists of two genes (they are coded by the chromosomal or plasmid or both of them), one for a stable toxin and another for an unstable ...(mazF toxin and mazE anti-toxin), relBE ...
7
Reassessing the Role of the Type II MqsRA Toxin Antitoxin System in Stress Response and Biofilm Formation: mqsA Is Transcriptionally Uncoupled from mqsR
... TA system in Escherichia coli, mqsRA, has been associated with stress resistance (43, 44), biofilm formation (45, 46), and persister formation (47, ...excess antitoxin supposedly through translational ...
13
Towards Exploring Toxin-Antitoxin Systems in Geobacillus: A Screen for Type II Toxin-Antitoxin System Families in A Thermophilic Genus
... 124862 125143 WP_013523845; AbrB/MazE/SpoVT family DNA-binding domain- containing protein [ Geobacillus ]. Contig 18_127 ATGGTTTATTATTTGACAGCGGAAGAAATCAT ATTTATCCATTACACGGTCATGGAAATG[r] ...
12
ESBL-plasmids carrying toxin-antitoxin systems can be “cured” of wild-type Escherichia coli using a heat technique
... Treatment of bacteria with enhanced temperatures was per- formed to construct viable toxin-antitoxin system-containing ESBL-plasmid-“cured”-variants of wild-type ESBL-E. coli strains. Following three ...
6
The Toxin Antitoxin MazEF Drives Staphylococcus aureus Biofilm Formation, Antibiotic Tolerance, and Chronic Infection
... ABSTRACT Staphylococcus aureus is the major organism responsible for surgical im- plant infections. Antimicrobial treatment of these infections often fails, leading to ex- pensive surgical intervention and increased risk ...
15
A Toxin Involved in Salmonella Persistence Regulates Its Activity by Acetylating Its Cognate Antitoxin, a Modification Reversed by CobB Sirtuin Deacetylase
... TacAT toxin-antitoxin system of ...of antitoxin to neutralize toxin activity, as with HicAB (34), or more commonly use the toxin as a corepressor until a stoichiometric imbalance ...
14
Clostridium perfringens Epsilon Toxin Causes Selective Death of Mature Oligodendrocytes and Central Nervous System Demyelination
... The -toxin receptor is unknown. We have shown that intro- duction of the myelin and lymphocyte protein (MAL) into trans- fected cell lines renders them susceptible to -toxin binding and toxicity (K. R. ...
13
Evaluation of tetanus antitoxin titers of sera from immunized guinea pigs determined by toxin neutralization test and standardisation of enzyme-linked immunosorbent assay
... The results of this project affirm the previous observations that in vitro system of assay like ELISA are more quick, sensitive, cost effective, appropriate. Further quantifications of antibodies is an added ...
6
Clostridium difficile PCR Cycle Threshold Predicts Free Toxin
... PCR-positive toxin-positive and toxin-negative stool samples using various toxin reference ...Free toxin was detected using RMEIA alone (A), RMEIA or CCNA (B), RMEIA or ELISA (C), and RMEIA, ...
10
Effect of the Black Snake Toxin on the Gastrocnemius Sciatic Preparation
... Site of action of the toxin 1 Effect of toxin on the nerve The nerve of the gastrocnemius-sciatic preparation was immersed in toxin solution and the muscle in Ringer's solution.. The soa[r] ...
7
A CRITICAL REVIEW OF THE UNKNOWN FACTS OF BOTOX COSMETIC TOXICITY AND ITS SAFER AYURVEDIC ANTI-AGING ALTERNATIVES .......
... potent toxin. Each vial of Botox (Botulinum Toxin Type A) contains 100 U of toxin, ...the toxin is drawn into the vial by the vacuum and not squirted into it and it is not ...Botulinum ...
7
Development of an antibiotic marker-free platform for heterologous protein production in Streptomyces
... the antitoxin (yefMsl) gene under the con- trol of the xylanase promoter xysAp [35] and the Amy α-amylase or the Xys1 xylanase, respectively, under the control of pstSp promoter from ...
13
Design, expression, and testing of a bivalent subunit botulism vaccine for use in cattle
... optimize expression in the methylotrophic yeast Pichia pastoris. The synthetic genes were to be transformed and expressed in the yeast and conditions determined for effective expression of both subunits. Finally the ...
17
Identification of Toxin A Negative, Toxin B Positive Clostridium difficile by PCR
... toxins, toxin A and toxin B, which are involved in the pathogenicity of this organ- ism (3, ...15). Toxin A has been referred to as an enterotoxin in view of its fluid accumulation activity in animal ...
5
Obtention of tetanus antitoxin hyperimmune sera in equines
... At the dawn of immunology, it was observed that animals immunized with specific toxins or venoms developed an antibody response that could be beneficial to the treatment of many different diseases, from tetanus and ...
6