Toxin-antitoxin (TA)
Reassessing the Role of the Type II MqsRA Toxin Antitoxin System in Stress Response and Biofilm Formation: mqsA Is Transcriptionally Uncoupled from mqsR
... chromosomal TA system in Escherichia coli, mqsRA, has been associated with stress resistance (43, 44), biofilm formation (45, 46), and persister formation (47, ...most TA operons adopt a ...
13
The correlation between the presence of quorum sensing, toxin-antitoxin system genes and MIC values with ability of biofilm formation in clinical isolates of Pseudomonas aeruginosa.
... and toxin-antitoxin (TA) systems. QS and TA are two systems that have important roles in biofilm ...and TA genes among clinical isolates of ...
7
Functional Genomics of Stress Response in the Hyperthermophilic Crenarchaeon Sufolobus solfataricus and Role of vapBC Toxin-Antitoxin Loci in RNA Management.
... (antitoxin). TA function appears to be fairly consistent across prokaryotic biology (Pandey et ...only TA systems (Gerdes et ...co-expressed antitoxin is present to bind the toxin, the ...
151
Towards Exploring Toxin-Antitoxin Systems in Geobacillus: A Screen for Type II Toxin-Antitoxin System Families in A Thermophilic Genus
... T TA system Toxin-Antitoxin system TADB Toxin-Antitoxin Database UPF Uncharacterized Protein Family VapBC Virulence associated proteins BC wHTH domain winged Helix-Turn-Helix domain XRE ...
35
Stable expression plasmids for Streptomyces based on a toxin-antitoxin system
... (anti- toxin) under the control of the strong Streptomyces xysAp promoter ...complete toxin-antitoxin operon, pKC796-TA, generating strain ΔTA-pKC796-TA(pGM160- YefMsl ts ), which were ...
10
Reassessing the Role of Type II Toxin Antitoxin Systems in Formation of Escherichia coli Type II Persister Cells
... of toxin- antitoxin transcription. Stochastic activation of TA modules in type II persister cells became the cornerstone of the model linking the rise in (p)ppGpp levels with the activation of ...
14
The Toxin Antitoxin MazEF Drives Staphylococcus aureus Biofilm Formation, Antibiotic Tolerance, and Chronic Infection
... that toxin-antitoxin (TA) systems play an important role in these ...processes. Toxin-antitoxin systems encode a stable toxin protein capable of interfering with vital cellular ...
15
The toxic guardians — multiple toxin-antitoxin systems provide stability, avoid deletions and maintain virulence genes of Pseudomonas syringae virulence plasmids
... that TA systems are frequently found in plasmids of ...conditions. TA systems have been involved in a disparity of func- tions including, among others, the stabilization of plas- mids and other mobile ...
17
Computational Modeling and Simulation of Toxin antitoxin System in Acinetobacter baumannii: HicB as a Dynamic Factor for Therapeutic Target
... antibiotics. Toxin-antitoxin system is one of the virulence agents in ...a toxin system is an ideal target for the design of new classes of antimicrobial agents against ...against toxin system ...
7
TOXIN–ANTITOXIN SYSTEMS AND THEIR ROLE IN MAINTAINING THE PATHOGENIC POTENTIAL OF CAUSATIVE AGENTS OF SAPRONOSES
... Taking into account the lack of TAS genetic modules in mammals, including humans, new technological strategies can be aimed at invention of effective and highly specific biochemical modulators of ...
17
ESBL-plasmids carrying toxin-antitoxin systems can be “cured” of wild-type Escherichia coli using a heat technique
... for toxin-antitoxin ...ESBL-plasmid-encoded toxin-antitoxin system, includ- ing hok/sok, srnB/C, vagC/D and pemI/K, which were encoded on plasmids of replicon types FIA or FIB carrying bla ...
6
In Silico Modeling of RelEB Type II Toxin antitoxin System in Acinetobacter baumannii as a Therapeutic Target via Antimicrobial Photodynamic Therapy
... II toxin-antitoxin systems (RelEB) are the particular type of toxin-antitoxin modules which take part in different kinds of cellular actions in ...an antitoxin protein associated with ...
6
The phage growth limitation system in Streptomyces coelicolor A(3)2 is a toxin/antitoxin system, comprising enzymes with DNA methyltransferase, protein kinase and ATPase activity
... The phage growth limitation system of Streptomyces coelicolor A3(2) is an unusual bacteriophage defence mechanism. Progeny ϕC31 phage from an initial infection are thought to be modified such that subsequent infections ...
10
RASTA Bacteria: a web based tool for identifying toxin antitoxin loci in prokaryotes
... detectable TA genes from the three obligate host-associated organisms tested ...single TA locus in Bacillus ...new TA pairs with high confidence (yfeD/yfeC, yafN/yafO, ygjN/ygjM and ...solitary ...
14
Toxin-antitoxin Systems: Classification, Biological Function and Application in Biotechnology
... of TA systems in biofilm ...five TA systems were deleted (ΔmazEmazF, ΔrelBrelE, ΔyefMyoeB ΔdinJyafQ, ΔchpBIchpBK), biofilm formation was reduced during the first 8 hours but then recovered to normal levels ...
7
Toxin Inactivation in Toxin/Antitoxin Systems
... with TA toxin activity by identifying what mutations take place in bacteria to inactivate toxins, for cases in which antitoxins do not function or are not present, such as after horizontal gene ...each ...
21
Towards Exploring Toxin-Antitoxin Systems in Geobacillus: A Screen for Type II Toxin-Antitoxin System Families in A Thermophilic Genus
... 124862 125143 WP_013523845; AbrB/MazE/SpoVT family DNA-binding domain- containing protein [ Geobacillus ]. Contig 18_127 ATGGTTTATTATTTGACAGCGGAAGAAATCAT ATTTATCCATTACACGGTCATGGAAATG[r] ...
12
A Toxin Involved in Salmonella Persistence Regulates Its Activity by Acetylating Its Cognate Antitoxin, a Modification Reversed by CobB Sirtuin Deacetylase
... TacAT toxin-antitoxin system of ...II TA systems that use transcriptional regulation to either replenish pools of antitoxin to neutralize toxin activity, as with HicAB (34), or more ...
14
The <em>mazEF </em>toxin–antitoxin system as an attractive target in clinical isolates of <em>Enterococcus faecium</em> and <em>Enterococcus faecalis</em>
... The toxin–antitoxin (TA) system is a regulatory system where two sets of genes encode the toxin and its corresponding ...of TA systems in independently isolated clinical isolates of ...
9
Evaluation of tetanus antitoxin titers of sera from immunized guinea pigs determined by toxin neutralization test and standardisation of enzyme-linked immunosorbent assay
... hours. Tetanus Toxoid shall elute in this mixture and is tested for Lf that is contributed by adsorbed tetanus toxoid in the sample. 10 ml of the sample was taken in another test tube and label it as Total, add 10.0 g of ...
6