Toxin-antitoxin (TA) systems
Keeping the Wolves at Bay: Antitoxins of Prokaryotic Type II Toxin-Antitoxin Systems
... on toxin-antitoxin systems has indeed come a long way since they were coined as “addiction” modules that function to ensure the stable maintenance of plasmids in the absence of selection pressure by ...
20
Reassessing the Role of Type II Toxin Antitoxin Systems in Formation of Escherichia coli Type II Persister Cells
... II toxin-antitoxin systems are small modules composed of a toxic protein and an antitoxin protein counteracting the toxin ...These systems were thought to be pivotal players in ...
14
The toxic guardians — multiple toxin-antitoxin systems provide stability, avoid deletions and maintain virulence genes of Pseudomonas syringae virulence plasmids
... active toxin-antitoxin systems (TA) in both pPsv48A and ...TA systems reduced loss frequency of pPsv48A by two orders of magnitude, whereas one of the two replicons of pPsv48C likely confers ...
17
Toxin Inactivation in Toxin/Antitoxin Systems
... 12. Song, S.; Wood, T.K. Post-segregational Killing and Phage Inhibition Are Not Mediated by Cell Death Through Toxin/Antitoxin Systems. Front Microbiol 2018, 9, 814. 13. Brown, B.L.; Grigoriu, S.; ...
21
TOXIN–ANTITOXIN SYSTEMS AND THEIR ROLE IN MAINTAINING THE PATHOGENIC POTENTIAL OF CAUSATIVE AGENTS OF SAPRONOSES
... of toxin–antitoxin systems (TAS) were identified in prokaryotes, and their major role in cellular physiology, which consists in metabolism reduction under stressful conditions, was elucidated [19, ...
17
Comprehensive comparative-genomic analysis of Type 2 toxin-antitoxin systems and related mobile stress response systems in prokaryotes
... 2 toxin-antitoxin systems in ...two-component systems, we identified numerous, previously unnoticed protein families that are homologous to toxins and antitoxins of known type 2 ...of ...
38
Predictions and Computational Analysis of Novel Chromosomal Type II Toxin Antitoxin Systems in the Human Oral Microbiome
... the Toxin Antitoxin Systems. The Toxin Antitoxin Systems could be classified structurally and ...the antitoxin to the ...the antitoxin are small RNAs (Goeders & Van ...
195
ESBL-plasmids carrying toxin-antitoxin systems can be “cured” of wild-type Escherichia coli using a heat technique
... using a heat technique was performed. This method was adequate to construct viable PCVs and to our knowledge we are the first ones to describe a successful “curing” of ESBL-plasmids, which carry genes for ...
6
Towards Exploring Toxin-Antitoxin Systems in Geobacillus: A Screen for Type II Toxin-Antitoxin System Families in A Thermophilic Genus
... system Toxin-Antitoxin system TADB Toxin-Antitoxin Database UPF Uncharacterized Protein Family VapBC Virulence associated proteins BC wHTH domain winged Helix-Turn-Helix domain XRE Xenobiotic ...
35
Toxin-antitoxin systems and their role in disseminating and maintaining antimicrobial resistance
... Figure 1. The intracellular targets of TAloci. TA loci usually encode two genes: one is a stable toxin and the other one is an unstable antitoxin. The antitoxins sequester the toxins but are subjected to ...
11
Toxin-antitoxin Systems: Classification, Biological Function and Application in Biotechnology
... TA systems as a tool for studying in anti-paralysis vaccine With TA systems assays, it will be possible to characterize the amount of antitoxin, which is needed for neutralizing the ...paralysis ...
7
Type I toxin-antitoxin systems contribute to the maintenance of mobile genetic elements in Clostridioides
... Expression of the excisionase gene in cells carrying the prophage devoid of the toxin 465. genes also resulted in a moderate growth defect, suggesting that a supplementary TA system 46[r] ...
48
Identification and characterization of a family of toxin antitoxin systems related to the Enterococcus faecalis plasmid pad1 par addiction module
... In addition to the par Fst toxin, at least three other Fst-like peptides have been identified. The Orf35 protein from Lactobacillus gasseri phage QgaY (Yokoi et al., 2005) has been identified during whole-genome ...
11
Towards Exploring Toxin-Antitoxin Systems in Geobacillus: A Screen for Type II Toxin-Antitoxin System Families in A Thermophilic Genus
... 124862 125143 WP_013523845; AbrB/MazE/SpoVT family DNA-binding domain- containing protein [ Geobacillus ]. Contig 18_127 ATGGTTTATTATTTGACAGCGGAAGAAATCAT ATTTATCCATTACACGGTCATGGAAATG[r] ...
12
Diverse distribution of Toxin-Antitoxin II systems in Salmonella enterica serovars
... II Toxin-Antitoxin systems (TAs), known for their presence in virulent and antibiotic resistant bacterial strains, were recently identified in Salmonella enterica ...plasmid toxin ccdB ...
10
Identification and characterization of a toxin-antitoxin system in the pVir plasmid of Campylobacter jejuni
... Abstract Toxin-antitoxin systems are prevalent in different bacterial organisms and are encoded in the chromosomal or plasmid ...plasmid toxin-antitoxin module is to stabilize the ...
69
In Silico Modeling of RelEB Type II Toxin antitoxin System in Acinetobacter baumannii as a Therapeutic Target via Antimicrobial Photodynamic Therapy
... II toxin-antitoxin systems (RelEB) are the particular type of toxin-antitoxin modules which take part in different kinds of cellular actions in ...an antitoxin protein associated ...
6
A Toxin Involved in Salmonella Persistence Regulates Its Activity by Acetylating Its Cognate Antitoxin, a Modification Reversed by CobB Sirtuin Deacetylase
... Bacterial toxin-antitoxin systems trigger the onset of a persister state by in- hibiting essential cellular ...TacT toxin of Salmonella enterica is known to in- duce a persister state in ...
14
Reassessing the Role of the Type II MqsRA Toxin Antitoxin System in Stress Response and Biofilm Formation: mqsA Is Transcriptionally Uncoupled from mqsR
... chromosomal toxin-antitoxin systems in bacterial ...peculiar toxin-antitoxin system, as the gene encoding the toxin precedes that of the ...the antitoxin, thereby ...
13
An oxygen-sensitive toxin antitoxin system
... TA systems are based on a stable toxin that is neutralized by forming a complex with a labile antitoxin, the Hha-YbaJ system is based on the chemical inactivation of the toxin caused by ...