Uncoupling protein 2 gene
Uncoupling protein 2 gene polymorphisms are associated with obesity
... UCP2 gene single nucleotide polymorphisms (SNPs) G(−866)A in the promoter region (rs659366) and Ala55Val (a C to T substitution) in exon 4 (rs660339) have been associated with obesity and T2DM to a certain ...of ...
10
The uncoupling protein 1 gene, UCP1, is expressed in mammalian islet cells and associated with acute insulin response to glucose in African American families from the IRAS Family Study
... between uncoupling protein polymorphisms (UCP2-UCP3) and energy metabo- lism/obesity in Pima ...the uncoupling protein 2 gene on 24-h energy expenditure and substrate ...
10
Effects of mutations in the human uncoupling protein 3 gene on the respiratory quotient and fat oxidation in severe obesity and type 2 diabetes
... Based on the putative topology of UCP3, the missense amino acid substitutions were located in the third, matrix- orientated, extramembranous loop (R143X); the first, cytosol- orientated, loop (V102I); and the sixth, ...
8
Increased uncoupling protein 2 and 3 mRNA expression during fasting in obese and lean humans
... expressed specifically in brown adipose tissue, plays an impor- tant role in thermogenesis by promoting the dissipation of the proton electrochemical gradient across the inner mitochon- drial membrane (6). The activation ...
7
Uncoupling protein 2 regulates myocardial apoptosis via the diabetogenic action of streptozotocin
... The protein concentration of apop- tosis protein was measured using a bicinchoninic acid (BCA) kit and standardized for 60 ...The protein loading was 30 μl and was normalized using a housekeeping ...
5
Antagonistic effect of TNF-alpha and insulin on uncoupling protein 2 (UCP-2) expression and vascular damage
... have uncoupling activity and decreased ROS production in macrophages and skeletal muscle, respectively ...type 2 diabetes mellitus (T2DM). In this regard, several UCP-2 gene polymorphisms were ...
10
Association Between Uncoupling Protein 3 Gene and Obesity-Related Phenotypes in the Québec Family Study
... Significant evidence of association (0.0001 p 0.05) were observed between the GAIVS6 poly- morphism and obesity-related phenotypes (Table 2). Subjects carrying the 240-bp allele, but not the 238-bp allele (240–240 ...
9
Superoxide mediated activation of uncoupling protein 2 causes pancreatic β cell dysfunction
... altered gene transcrip- tion; changes in intracellular signaling intermediates; and loss of β cell mass ...understood. Uncoupling protein 2 (UCP2) is a negative regulator of insulin ...note, ...
13
Reptilian uncoupling protein: functionality and expression in sub zero temperatures
... reptilian uncoupling protein (repUCP) gene from the European common lizard ( Lacerta vivipara ...the protein shows 55%, 72% and 77% sequence homology with rat UCP1, UCP2 and UCP3, ...
7
Acetoacetate reduces growth and ATP concentration in cancer cell lines which over-express uncoupling protein 2
... Single protein manipula- tions, while very important, cannot be expected to reliably predict phenotypic changes in light of growing awareness of complex feedback regulation of gene-protein ...
11
Circulating levels of mitochondrial uncoupling protein 2, but not prohibitin, are lower in humans with type 2 diabetes and correlate with brachial artery flow-mediated dilation
... UCP2 gene (− 866G>A) results in reduced UCP2 expression [40], increased systemic oxidative stress, and an increased risk of myocardial infarction in men with T2DM independent of other traditional risk facts ...
11
The Deletion Polymorphism in Exon 8 of Uncoupling Protein 2 is Associated with Severe Obesity in a Saudi Arabian Case-Control Study
... They also inhibit the production of cellular free radicals and reactive oxygen species [5]. UCP2 is the most ubiquitously expressed of these proteins, and also exerts the greatest impact on mitochondrial function; thus, ...
5
Sequence and haplotypes variation of the ovine uncoupling protein-1 gene (UCP1) and their association with growth and carcass traits in New Zealand Romney lambs
... Haplotypes can span a larger region of a gene and help increase the Polymorphism Information Content (PIC). They can therefore be used to improve the power of association studies [25]. Nine haplotypes were ...
12
Uncoupling protein 2 polymorphisms as risk factors for NTDs
... individuals with the −866AA genotype have reduced B-cell function and lower insulin secretion in response to glucose stimulation (Sesti et al., 2003). However, Wang et al. (2004) found that −866AA individuals had ...
10
Uncoupling protein 2 G(-866)A polymorphism: a new gene polymorphism associated with C-reactive protein in type 2 diabetic patients C-reactive protein in type 2 diabetic patients
... type 2 diabetes mellitus consecutively seen at the outpatient clinics and recruited according to the following criteria: type 2 diabetes diagnosed according to WHO, and aged 40 to 70 ...> 2 mg/dl, ...
5
Expression of the mitochondrial uncoupling protein gene from the aP2 gene promoter prevents genetic obesity
... aP2 gene promoter directed Ucp expression in white fat and provided for the constitutive expression of Ucp in brown ...at 2-10% the level normally measured in brown ...endogenous gene expression by ...
11
A quest for the origin of mammal uncoupling proteins
... mammals, uncoupling protein 1 (UCP1) is responsible for non- shivering thermogenesis in brown adipose tissue ...The protein is inserted with six ???-helical transmembrane domains into the inner mito- ...
10
Insights into brown adipose tissue evolution and function from non model organisms
... Pioneering morphological and physiological comparative studies summarized the presence or absence of BAT in neonates of 285 mammalian species, suggesting the absence of BAT in monotremes, marsupials and some groups of ...
9
Effect of co-exposure to nickel and particulate matter on insulin resistance and mitochondrial dysfunction in a mouse model
... of gene expression was determined by real-time ...for 2 minutes, 95°C for 10 minutes, 40 cycles of 95°C for 15 seconds, and 60°C for 1 ...type 2 iodothyronine deiondinase (Dio2), cell death- inducing ...
12
Ontogeny and thermogenic role for sternal fat in female sheep
... PPARγ NM_181024.2 GACCCGATGGTTGCAGATTA TGAGGGAGTTGGAAGGCTCT 145 PRDM16 XM_003583245.1 TGGCAGCTGGCTCAAGTACA CGGAACGTGGGCTCCTCATC 198 PRLR NM_174155.3 CTCCACCCACCATGACTGAT CAGCGAATCTGCACAAGGTA 169 RIP140 XM_002684642.2 ...
49