Xenopus laevis
eFGF is expressed in the dorsal midline of Xenopus laevis
... Int I Dn lliol 39 575 579 (1995) 575 O,igil/al Arlirlr eFGF is expressed in the dorsal midline of Xenopus laevis HARRY v ISAACS' MARY ELIZABETH POWNALL and JONATHAN M W SLACK Imperial Cancer Research[.] ...
5
Expression of mesoderm markers in Xenopus laevis Keller explants
... Int I De\', Riol 3M 605 611 (1994) 605 Origin{{1 Arliell' Expression of mesoderm markers in Xenopus laevis Keller explants JEAN PIERRE SAINT JEANNET', ALEXANOER A KARAVANOV and IGOR B OAWIO* Laborator[.] ...
7
Blood pressure control in a larval amphibian, Xenopus laevis
... early Xenopus laevis larvae (stages 49–51) display a Frank–Starling response to volume load and, despite the lack of a baroreflex, are able to correct the hypertension induced by volume ...
6
pdzrn3 is required for pronephros morphogenesis in Xenopus laevis
... in Xenopus laevis embryos was performed by whole mount in situ hybridization, using as probe a DIG-labelled cRNA derived from full length Xenopus-pdzrn3 mRNA sequence (NCBI accession ...
8
Developmental expression of Pod 1 in Xenopus laevis
... ABSTRACT The basic helix-loop-helix transcription factor, Pod 1, has been shown to be expressed in the mesenchyme of many developing mouse organs, including the heart, lungs and gut. In the kidneys of developing mice, ...
5
Dicer inactivation causes heterochronic retinogenesis in Xenopus laevis
... RT-PCR of Xenopus laevis dicer was carried out using forward 5’atgcatttcaagtgccatca and reverse 5’aaaagggacccattggagag primers. Mos, including a standard control morpholino oligonucleotide (control mor- ...
6
The Mode of Excretion of Ammonia and Urea in Xenopus Laevis
... Eighty-two single determinations of ammonia and urea excretion by Xenopus laevis indicated that the percentage of ammonia varied from 40 to 80%, with a mean value of 62%.. Measurements o[r] ...
12
Differential expression of arid5b isoforms in Xenopus laevis pronephros
... ABSTRACT Arid5b belongs to the ARID family of transcription factors characterised by a helix- turn-helix motif- based DNA-binding domain called ARID (A-T Rich Interaction Domain). In human, alternative splicing leads to ...
7
Comparison of induction during development between Xenopus tropicalis and Xenopus laevis
... from Xenopus laevis and Xenopus ...between Xenopus tropicalis and Xenopus laevis, suggesting that the rate and speed of signal transduction may be regulated by a common system in ...
8
Identification and gastrointestinal expression of Xenopus laevis FoxF2
... because Xenopus metamorphosis is exquisitely regu- lated by thyroid hormone (TH), the finding that FoxF2-expressing tissue expands vastly following metamorphosis raises the possi- bility that FoxF genes may be in ...
6
Expression of the transcription factor Xvent 2 in Xenopus laevis embryogenesis
... The spatial patterning of the Xvent-2 mRNA in Xe- nopus embryos is closely studied [3-6]. The specific Ab to the Xvent-2 protein enabled us to determine spatial and temporal patterning of this protein in early embryos. ...
8
Expression of membrane targeted aequorin in Xenopus laevis oocytes
... Int J [Jev Bioi 39 653 657 (1995) 653 Short Contribution Expression of membrane targeted aequorin in Xenopus laevis oocytes CHRISTIANE DAGUZAN', MARIE THERESE NICOLAS2, CHRISTIAN MAZARS3, CATHERINE LE[.] ...
5
XMam1, the Xenopus homologue of mastermind, is essential to primary neurogenesis in Xenopus laevis embryos
... ABSTRACT Notch signaling is involved in cell fate determination and is evolutionally highly conserved in vertebrates and invertebrates. Mastermind is a nuclear protein which participates in Notch signaling and is ...
8
Expression of neurotrophin 4 mRNA during oogenesis in Xenopus laevis
... Int J Dc'" Hinl J6 239 245 (1992) Origillal Arlirll' Expression of neurotrophin 4 mRNA during oogenesis in Xenopus laevis CARLOS F IBANEZ", FINN HALLBOOK', FRANi; OIS GODEAU' and HAKAN PERSSON' 10epar[.] ...
7
Genes and mechanisms involved in early embryonic development in Xenopus laevis
... Int I DC\" Hin! J t 51 59 (19901 5\ Genes and mechanisms involved in early embryonic development in Xenopus laevis MARCEL MECHALI*, GENEVIEVE ALMOUZNI, YANNICK ANDEOL, JACQUES MOREAU, SOPHIE VRIZ, MIC[.] ...
9
Identification of erythroid progenitors induced by erythropoietic activity in Xenopus laevis
... in Xenopus laevis , which should enable us to identify target cells, including erythroid progenitors, and to investigate the production and development of erythroid cells in ...in Xenopus ...
7
D-type cyclins in Xenopus laevis
... Although clearly the early cell cycle involves many gene products which are present in the oocyte as maternal protein stockpiles, the above result suggests that during the [r] ...
154
The Kinematics of Swimming in Larvae of the Clawed Frog, Xenopus Laevis
... [See Wassersug & Hoff 1985 for further discussion of the kinematic consequences of tail length for the Rana/Bufo group.] The amplitude of the travelling wave all along the body in Xenopu[r] ...
12
Regulatory remodeling in the allo tetraploid frog Xenopus laevis
... enriched (p = 1e-5; hypergeometric test), each accounting for 20–37% of all newly gained p300 peaks, whereas they only overlap with < 1% of other p300 peaks (Fig. 7c, lower panel). The three repeat annotations ...
18
Water depth alters respiratory behaviour of Xenopus laevis
... For each frog at each depth, median values of intersurface interval, bottom bout lengths, surface bout lengths and swimming speed to and from the surface were calculated.. Median values [r] ...
6