• No results found

[PDF] Top 20 Mammary lineage restriction in development

Has 10000 "Mammary lineage restriction in development" found on our website. Below are the top 20 most common "Mammary lineage restriction in development".

Mammary lineage restriction in development

Mammary lineage restriction in development

... embryonic mammary gland development, they investigate the kinetics of stem and progenitor cells and both show that transition from multipotency to unipotency occurs surprisingly early during prenatal stages ... See full document

9

Epigenomics of mammary gland development

Epigenomics of mammary gland development

... the mammary epi- thelial subpopulations has led to some interesting dis- ...embryonic development and is maintained in the adult ...restrict lineage-specific gene expression ... See full document

11

Side branching and luminal lineage commitment by ID2 in developing mammary glands

Side branching and luminal lineage commitment by ID2 in developing mammary glands

... For 3D imaging, we performed the CUBIC method as previously reported (Lloyd-Lewis et al., 2016; Susaki et al., 2014) with minor modifications. Briefly, mammary fat pads were fixed with 4% paraformaldehyde ... See full document

15

Lineage restriction of adult human olfactory derived progenitors to dopaminergic neurons

Lineage restriction of adult human olfactory derived progenitors to dopaminergic neurons

... Human adult olfactory epithelium contains neu- ral progenitors (hONPs) which replace damaged cellular components throughout life. Methods to isolate and expand the hONPs which form neuronspheres in vitro have been ... See full document

15

FGF4 is required for lineage restriction and salt and pepper distribution of primitive endoderm factors but not their initial expression in the mouse

FGF4 is required for lineage restriction and salt and pepper distribution of primitive endoderm factors but not their initial expression in the mouse

... reporter exposed to exogenous FGF revealed that within 15 hours all ICM cells were GFP positive (supplementary material Movie 4). To establish if this response to FGF was transient, we cultured embryos in the presence of ... See full document

13

Cell tracing reveals a dorsoventral lineage restriction plane in the mouse limb bud mesenchyme

Cell tracing reveals a dorsoventral lineage restriction plane in the mouse limb bud mesenchyme

... that lineage restriction serves to stabilize signaling centers at compartment borders, which constitute organizers for adjacent compartments (reviewed by Vincent, ...center. Lineage boundaries with ... See full document

10

Connexin 32 and connexin 43 are involved in lineage restriction of hepatic progenitor cells to hepatocytes

Connexin 32 and connexin 43 are involved in lineage restriction of hepatic progenitor cells to hepatocytes

... In adult liver, Cx32, occupied approximately 90% of Cxs on hepatic parenchymal cells, establishes an elaborate GJIC network between hepatocytes and becomes indis- pensable for liver development [12]. Dozens of ... See full document

11

PER2 regulation of mammary gland development

PER2 regulation of mammary gland development

... mouse mammary gland ...virgin mammary glands and undifferentiated mammary epithelial cells (MECs), whereas PER1 expression is highest in lactating mouse mammary glands and differentiated HC11 ... See full document

10

New insights into lineage restriction of mammary gland epithelium using parity identified mammary epithelial cells

New insights into lineage restriction of mammary gland epithelium using parity identified mammary epithelial cells

... the mammary epithelium consists mainly of bi-layered milk ducts ...the mammary stem cells, and the luminal layer contains both steroid receptor-positive and -negative ...in mammary gland morphology ... See full document

17

Transcriptome analysis of embryonic mammary cells reveals insights into mammary lineage establishment

Transcriptome analysis of embryonic mammary cells reveals insights into mammary lineage establishment

... the mammary primordium should in theory be predicted to be enriched for stem cells, previous functional analysis suggests that only a very small frac- tion of the primordial epithelial cells can fulfil the stan- ... See full document

16

The complexities and caveats of lineage tracing in the mammary gland

The complexities and caveats of lineage tracing in the mammary gland

... in development, homeostasis and oncogenesis, there are important caveats associated with lineage tracing ...for lineage tracing studies on normal mammary development and on potential ‘ ... See full document

5

Lineage specific cell death in postembryonic brain development of
Drosophila

Lineage specific cell death in postembryonic brain development of Drosophila

... PC lineage, there is some indication that the total clone size is reduced by approximately half in en loss-of-function mutants, compared with wild type ...MC2 lineage, where it would have to play an ... See full document

10

Genetic Stabilization of the Drug Resistant PMEN1 Pneumococcus Lineage by Its Distinctive DpnIII Restriction Modification System

Genetic Stabilization of the Drug Resistant PMEN1 Pneumococcus Lineage by Its Distinctive DpnIII Restriction Modification System

... strains. Restriction- modification (R-M) systems can restrict horizontal gene transfer, yet most pneumococcal strains code for either the DpnI or DpnII R-M system and neither limits homologous ... See full document

12

Novel insights into chromosome evolution in birds, archosaurs, and reptiles

Novel insights into chromosome evolution in birds, archosaurs, and reptiles

... significantly enriched in avian, archosaurian and archosaurian/testudines msHSB sets. Out of these 17 genes distributed across 12 chicken chromosomes, only one (BMPR1B) was found in an avian-specific msHSBs but absent ... See full document

24

A proximal activator of transcription in epithelial mesenchymal transition

A proximal activator of transcription in epithelial mesenchymal transition

... BglII restriction site (ATTAGATCTGAGTAGCC- GCTGCGGCCTGGCCGACCATGT) and the 3′ primer (ATTCTC- GAGTCACTCGGCCGCTCCTGCTGCCTCTCAGTA) added a unique XhoI ...Following restriction digestion, the sequence was ... See full document

11

Short-term early exposure to lapatinib confers lifelong protection from mammary tumor development in MMTV-erbB-2 transgenic mice

Short-term early exposure to lapatinib confers lifelong protection from mammary tumor development in MMTV-erbB-2 transgenic mice

... Lapatinib suppresses cell proliferation of 78617 and 85815 cells in vitro through inhibition of RTK signaling As a preliminary experiment for in vivo studies, we tested the effects of lapatinib on cell proliferation in ... See full document

13

Restriction Endonuclease Mapping of the Proviral DNA of the Exogenous RIII Murine Mammary Tumor Virus

Restriction Endonuclease Mapping of the Proviral DNA of the Exogenous RIII Murine Mammary Tumor Virus

... C Physical map of restriction endonuclease sites for HpaI O, KpnI A, BamHI A, EcoRI 0, and HindIII U in RIII MuMTV proviral DNA isolated from FeI/C6 feline cells infected with milkborne [r] ... See full document

13

Developmental cell lineage

Developmental cell lineage

... intracellular lineage tracers (Weisblat et ...cell lineage tracer consists of an adduct of a fluorescent dye, such as fluorescine or rhodamine, with an inert carrier molecule, such as dextran (Weisblat et ... See full document

5

Defining epithelial cell dynamics and lineage relationships in the developing lacrimal gland

Defining epithelial cell dynamics and lineage relationships in the developing lacrimal gland

... acinar lineage, ductal markers were abundant during embryonic stages but decreased substantially after birth, a time coinciding with rapid expansion of the end buds ...embryonic development, with a dramatic ... See full document

12

Early vascular deficits are correlated with delayed mammary tumorigenesis in the MMTV PyMT transgenic mouse following genetic ablation of the NG2 proteoglycan

Early vascular deficits are correlated with delayed mammary tumorigenesis in the MMTV PyMT transgenic mouse following genetic ablation of the NG2 proteoglycan

... Bone marrow transplantation from female b-actin/EGFP donors to female MMTV-PyMT recipients was carried out as previously described [12]. Bone marrow was col- lected from tibiae and femurs of both wild type and NG2 null ... See full document

20

Show all 10000 documents...