AB and RB share 34bp (-118bp to -85bp) of sequence in common (Figure 3 .IB ) and on this basis I designed a 40bp double-stranded
oligonucleotide (CPO40; Figure 3.6) to use as a probe in EMSAs to further analyse this DNA/protein interaction and to identify the DNA-binding element within this region of the human C A l colon promoter.
EMSAs using CPO40 together with protein extracts from various cell lines (Table 2.1) led to the formation of the major retardation complex C O Fl together with the minor C O F l' complex (Figure 3.7). The C O F l/C O F l' factor was only present in those extracts from colon cell lines, while the non-specific U B 1 complex was present in all cell extracts and appeared to be of a similar intensity to the U B l complex formed with the AB probe (Figure 3.7; Table 2.1).
Results from here on will refer to the CO Fl and C O F l' proteins as the C O Fl complex since it seems likely that C O F l' is a degradation product of C O F l. EMSAs indicate that these complexes are closely related as judged by their behaviour in competition assays, in addition C O F l' exhibits variability in both its appearance and degree of intensity from one protein extract to
another (Figures 3.7 and 3.10).
A series of oligonucleotides (CP024, CP021, C P016, C P012 and C P017) which represent deletions of CPO40 (Figure 3.6) were synthesised in order to establish the exact sequence to which C O Fl binds within this region of the human C A l colon promoter. C P 024 and CP021 (a 24bp and 21 bp fragment, respectively; Figure 3.6) overlap by 9bp and when used as probes in EMSAs each gave a different binding pattern (Figure 3.8). C P 024 only bound the non-specific factor, U B l, whereas CP021 strongly bound U B l and C O Fl with an equal intensity; a binding pattern very similar to that seen with CPO40 (Figure 3.8).
These experiments narrowed down the C O Fl binding region to within the 21 bp of C P021. It seemed possible that the short 9bp region of overlap between C P 024 and CP021 was leading to the DNA binding of U B l, and that this sequence might be removed without the loss of CO Fl binding. This
Oligonucleotide oo O 5* 5* 5* 5* - GTAGAATTTTTTACAACACCTTTTTTTTAGATATGTGTAC - 3 - GTAGAATTTTTTACAACACCT- 3 * 5 * -ACAACACCTTTTTTTTAGATATGT-3 * -GTAGAATTTTTT-3 * -GTAGAATTTTTTACAA-3 * 5 *"AATTTTTTACAACACCT-3 * 5 *-AATTTTTgcCAACACCT-3'
Position in the CAl colon promoter CPO40 -83 to -122 CP021 -102 to -122 CP024 -87 to -110 CP012 -111 to -122 CP016 107 to 122 CP017 -102 to -118 m u tll
F igure 3.6 Oligonucleotides designed from the CAl colon promoter and used in EMSA studies. The CP021, CP024, CP012, CP016 and CP017 oligonucleotides represent a series of deletions of CPO40. mutXl
is a mutated form of CP017 where the central dinucleotide has been altered from -T A - to -G C -. The COFl binding site is underlined. Numbers at the right-hand side represent positions of oligonucleotides upstream from the colon transcription start site.
UBl COFl
C O F l’
III»*É S
a w
| j |
I
P HTl 15 LIM Caco-2 HeLa 23A2 G8 HEL HTl 15 HeLa 1215
3 2 p CPO40
Figure 3.7 EM SA using labelled CPO40 and whole cell extracts from various cell lines. Cells expressing C A l from the colon (HTl 15 and LIM 1215) and erythroid (HEL) promoters, and non-C A l expressing cells (Caco-2, HeLa, 2 3 A2 and G8) were tested. Arrows indicate the positions o f the C O F l/C O F l' and UB 1 complexes. Com plexes having a similar electrophoretic mobility to U B l were found using all cell extracts. P indicates probe without protein.
U B l - C O F l - C O F l - m C om p 3 2 P JL 40 24 21
Figure 3.8 EMSA using labelled CPO40, C P 0 2 4 and C P 021 and whole cell extracts from H Tl 15 cells. In all cases a 500-fold molar excess of unlabelled C P 021 was used as a competitior (Comp). Arrows indicate the UB 1 and C O F l/C O F l' retarded complexes. P, probe without protein; -, no competitor; 32p, indicates which oligonucleotide was used as a probe.
idea led to the synthesis of oligonucleotides CP012 and C P016 in which either 5bp of the overlap, or all 9bp were removed from the 3' end of C P 021 (Figure 3.6). However, deletion of these few bases resulted in the complete loss of colon-specific binding when both C P012 and C P016 were used as probes in EMSAs (Figures 3.9A and B, respectively). This led to the
synthesis of a third truncated oligonucleotide, C P017 (Figure 3.6) in which 4bp from the 5' end of C P021 was removed. CP017 did not bind U B l but strongly bound COFl in a cell type-specific manner (Figure 3.10; Table 2.1). 3.1.2 Intestine-specifîc DNA binding is retained by CP017
The CO Fl complex was formed when both labelled CPO40 and C P017 were used as probes in EMSAs with whole cell protein extracts from the H T l 15, LIM1215 and Caco-2 colon-derived cell lines (Figures 3.7 and 3.10). These findings suggested that this protein factor was present in the colon and that sequence in common to the CPO40 and C P017
oligonucleotides was able to bind this factor in vitro.
Competition assays were performed in order to confirm the specificity of the DNA/protein interactions. An excess (1 0 0 -fold, unless otherwise stated) of unlabelled double-stranded oligonucleotides were added to the binding reaction. These unlabelled oligonucleotides function as
‘competitors’ in the DNA/protein binding reaction. Where a competitor is able to bind to the same protein factor this results in the reduction or absence of the radiolabelled DNA/protein complex. Oligonucleotides having high affinity for the protein factor result in a greater level of competition.
Figure 3.11 shows a competition assay using labelled CPO40 as a probe and various unlabelled oligonucleotides as competitors. As expected from the EMSAs (Figure 3.8) C P 024 competed with CPO40 for the binding of U B l alone, while CP021 successfully competed with CPO40 for the binding of the CO Fl complex as well as the non-specific U B l complex, and C P017 specifically competed with CPO40 for the binding of the C O Fl
complex. C P012 and C P016 did not compete with CPO40 for the binding of any protein factors, consistent with the findings that neither of these
oligonucleotides used as probes in EMSA studies were found to bind any protein factors (Figures 3.9A and B).
32p C P 0 1 2
B
32p C P 0 1 6
F ig u r e 3 .9 P an el A: EM SA using labelled C P O 12 and whole cell extracts from H Tl 15 cells. P a n el B: EM SA using labelled CPO 16 and w hole cell extracts from H T l 15 cells.
C O F l C O F l
P HTl 15 LIM Caco-2 HeLa 23A2 G8 HEL H T l 15 HeLa 1215