Construction of various CAi/SV40/CAT reporter gene plasmids The transcriptional activity of various upstream sequences from the

C A l colon promoter was analysed in transfection experiments using

constructs containing the Chloramphenicol Acetyltransferase (CAT) gene as a reporter (represented in Figure 4.14). CAT is a bacterial gene and was selected because it is not expressed in eukaryotes. Various regions of the human C A l colon promoter were cloned into the pCAT3-promoter vector (referred to in the text as pSV40/CAT; Figure 4.3 and 4.4) upstream of the SV40 early promoter. These included the double-stranded oligonucleotides C P 017 and m u tll, and the PCR fragments CPI and CP2 separately, or together, C Pl/2. The pSV40/CAT vector provides a multiple cloning site (MCS) suitable for the insertion of the DNA sequences upstream of the

minimal promoter (Figure 4.4). The cloning strategy was that of “sticky end” ligation (section 2.2.2.3) in the case of C P017 and m u tll and TA-cloning for the PCR fragments (section 2.2.16).

The complementary single-stranded oligonucleotides of C P017 and

m u tll were designed in such a way that their ends were compatible with the 3' and 5' overhangs produced when pSV40/CAT was cut with S a d and Xhdl

respectively (Figures 4.4 and 4.5). The sense and antisense oligonucleotides were self-annealed and directionally cloned into the SadJXhol sites of the pSV40/CAT MCS to generate the constructs p C P 0 1 7 -C A T and pm^f 17 - CAT, respectively (Figure 4.5).

The C PI, CP2 and CP 1/2 PCR fragments were cloned in both their natural and reverse orientations into the Smal site of pSV40/CAT (Figure 4.4) to generate the constructs: p C P l-C A T , pC PlR -C A T , pCP2-C AT, pC P2R - CAT, pC P l/2-C A T and p C P l/2 R -C A T (R indicates those products cloned in their reverse orientation; Figures 4.7, 4.9, and 4.11 respectively). Figure 4.14 provides a summary of all constructs used in the transfection experiments.

Diagnostic digests were performed in order to confirm the presence and identity of the inserts and in the case of the PCR products, to establish

p C A T ^ 'P ro m o w r V te to r (4239bp) SV40 Promoter SamH

Synthetic poly(A) signal and transcriptional pause site (for t)ackground reduction)

Kpn 1 5 Sacl 11 MIul 15 Nhe 1 21 Smal 28 Xho\ 32 BglW 36 (Hind III) 245 (Hind III) 468 N c o \ 501 region X b a l1163

F ig u r e 4 .3 Diagram o f the pCAT3-Promoter vector (referred to as pSV40/CAT in the text) showing the multiple cloning site (MCS), the SV 40 minimal promoter and the CAT reporter gene.

5 ' ... CTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCTATCGATA

^GGTACqpAGCTCTT^CGCGT;pCTAGCpCGGGCTCG|AGATCT^GCGATCTGCATCTCAATTAGTCAGCA

Kpnl Sacl Mlul Nhel

'

^mal Xhol

ACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGC

CCCATCGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCA

F ig u r e 4.4 pSV40/CAT sequence showing the SV40 minimal promoter (underlined) and its three alternative transcription initiation sites ( f ^ ) downstream o f the restriction enzyme sites in the MCS are shown. The large arrow indicates the sequence and direction o f the RV3 primer used to sequence the CA 1/SV40/CA T constructs.

pC A T *3"Prom oler V icto r (4239bp) SV40 Promoter BamH

Synthetic pdy^A) signal and transcnptional pause site (tor background reduction)

Kpn I 5 S a c l 11 \ C P 0 1 7 / y X m u M 7 X h oI 32 B g l II 36 (Hinà 111) 245 (Hind 111) 468 Nco I 501 Hpa I 1323 SV40 ^ x b a l 1 1 6 3 late poly(A) region B _5acl Xhol 5'-AATTTTTTACAACACCT-3' 3 ' - TCGATTAAAAAATGTTGTGGAAGCT - 5' CP017 Sacl Xhol 5'-AATTTTTGCCAACACCT-3' 3 ' - TCGATTAAAAACGGTTGTGGAAGCT - 5' m u t l l

Sacl E xcised Xhol

5 -'GGTACCGAGCTjcTTACGCGTGCTAGCCCGGGClrCGAGATC- 3 ' pSV40/CAT

3 -'CCATGGdrCGAGAATGCGCACGATCGGGCCCGAGCTbTAG-5 ' MCS

F ig u re 4.5 Panel A: Diagramatic representation o f the cloning o f CFO 17 and

m u t \ l into the pSV40/CAT multiple cloning site to produce pCPO 17-C A T and pmwr 17-CAT. Panel B: The cloning strategy used for the CFO 17 and m u t l l

oligonucleotides. pSV40/CAT was digested with Sacl and Xhol and ligated to the annealed double-stranded oligonucleotides containing Sacl and Xhol

their orientations. Digests of the contructs are shown in Figures 4.6, 4.8, 4.10, and 4.12. A KpnlJHinélll double digest was performed to test for the

presence of the DNA insert in all constructs (except for p C P l/2 -C A T and p C P l/2R -C A T ). A unique Kpnl site (at 5bp) and two HinàlH sites (at 245bp and 468bp) exist in pSV40/CAT (Figure 4.3) and yield three fragments of 3776, 240 and 223bp. In general, the presence of an insert results in an increase in the size of the 240bp KpnUHindlll fragment by the size of the particular insert, except in the case of the pCPO 17-C A T and pmMrl7-CAT constructs where a reduction occurs (Figure 4.6A).

In the case of pCPO 17-C A T and pm w rH-CA T, successful subclones were first identified by the failure to linearise the plasmids with Sacl (Figure 4.6B), since the subcloning procedure destroyed both the Sacl and X hol

restriction sites in the vector (Figure 4.5B). In the KpnUHindlll double digest the 240bp KpnUHindlU fragment decreased by 4bp to 236bp since a 21bp

Sacl/Xhol fragment was removed from pSV40/CAT and then replaced with

the 17bp, C P017 or m u tll fragment (Figure 4.5B). Figure 4.6A shows a digest of the pCPO 17-C A T construct, digests of pm ^ri7-C A T were identical to this and are not shown.

KpnUHindlU double digests of p C P l-C A T and p C P lR -C A T resulted in an increase in the size of the 240bp band to 329bp (Figure 4.8A). An additional double digest using ApoUNcol was performed in order to ascertain the orientation of the insert (Figure 4.8B). This gave three products of; 2638, 834 and 767bp with the pSV40/CAT vector. Four products were produced with p C P l-C A T : 2638, 767, 533 and 390bp; in this case insertion of the 89bp C PI DNA fragment carrying an A pol site (Figure 4.7) into the vector results in the 834bp vector band being divided into two fragments of 533 and 390bp. Similarly with p C P lR -C A T the bands generated were: 2638, 767, 502 and 421 bp; this time the 834bp vector band was divided into 502 and 421 bp (Figure 4.8B).

KpnUHindlll digests of pC P 2-C A T and pC P2R -C A T increased the size of the 240bp band to 343bp (Figure 4.10A). A M unlNcol double digest confirmed the orientation of the CP2 PCR insert. The pSV40/CAT vector

1 2 3 4 bp 236/240— 223 — B 2 3 4 5

Figure 4.6 Panel A: Restriction digest o f pCPO 17-C A T with K p n l

a n d //m d lll. This digest shows the presence o f an insert. Lane 1, D N A marker; lane 2, pCPO 17-CAT and lane 3, pSV40/CAT. Panel B:

Diagnostic digest of pCPO 17-C A T and pmwf 17-C A T using Sacl. Since the

Sacl site was destroyed in the cloning procedure this digest shows the presence o f the C P 0 1 7 and m u t l l inserts cloned into the SacUXhol sites o f pSV40/CAT. Lane 1, D N A marker; lane 2, digested but not cut

pSV40CAT; lane 3, linearised pSV40/CAT; lane 4, digested but not cut pCPO 17-CAT and lane 5, digested but not cut pmM/17-CAT.

A pol 3906

Synthetic poly(A) signal and transcriptional pause site (for background reduction)

PCR product Kpn I 5 S a c l11 Smal 28 p C A T ^ P r o m o lif V ic to r (4239bp) Smal 28 Xho \ 32 Promoter (Mnd III) 245 (Hind III) 468 Nco I 501 BamH H p a l1323 ■Xbal1163 A pol 1268 5'

ÎÎ

2 9 b p Apol _ 1 _ 6 0 b p 3' - t/ - - S 9 b p p C P I - C A T 3' _5' f t 6 0 b p Apol _ j — -/ / 8 9 b p p C P I R - C A T

Figure 4.7 The construction of pC Pl-C A T and pCPlR-CA T. The CPI PCR product (89bp) in both orientations was cloned into the Smal site of pSV40/CAT. Dotted lines indicate vector sequence.

A B

3776

bp 1 2 3 4 5

2638

390

F ig u r e 4 .8 Panel A: Restriction digest of pCP 1-C A T and p C P lR -C A T constructs with Kpnl and Hindlll. This digest shows the presence of an insert but not the different orientations. Lane 1, D N A marker; lane 2, pCP 1-CAT; lane 3, p C P lR -C A T and lane 4, pSV40/CAT. Panel B: Diagnostic digest o f

p C P l-C A T and p C P lR ^ A T using A pol and Ncol. This digest shows the different orientations o f the CPI insert cloned into the Smal site o f pSV40/CAT. Lane 1, D N A marker; lane 2, pC P l-C A T ; lane 3, pC PlR -C A T ; lane 4,

only gave bands sizes of: 3408 and 831bp. Since CP2 contains a M uni

restriction site (Figure 4.9) digestion resulted in bands of: 3015, 831 and 496bp with the 3408bp M unlN col vector fragment cleaved into 3015 and 496bp (Figure 4.1 OB). Likewise the bands generated from pCP2R-CA T were: 2958, 831 and 553bp with the 3408bp vector band cleaved into 2958 and 553bp (Figure 4.10B).

Since the C P l/2 PCR fragment contains an Apol restriction site (Figure 4.11) a single restriction digest of pCP 1/2-CA T and p C P l/2 R -C A T using this enzyme confirmed the orientation of the C P l/2 PCR product. W hen cut with

A pol the products of pSV40/CAT were: 2638 and 1601bp (Figure 4.12). Digestion products o f p C P l/2 -C A T were: 2638, 1300 and 467bp where the

1601bp fragment of pSV40/CAT was separated into 1300 and 467bp (Figure 4.12). Products generated by digestion of p C P l/2 R -C A T were: 2638, 1346 and 421 bp and here the 1601 bp vector fragment was separated into 1346 and 421 bp (Figure 4.12).

All constructs were sequenced using the RV3 primer (Figure 4.4) and the dideoxy chain termination sequencing method or the ALFexpress DNA automated sequencer (Pharmacia; section 2.2.20) in order to confirm the sequence and orientation of each DNA insert.

4.2.2 Analysis of the transcriptional activation of the CAT reporter

In document Carbonic anhydrase 1: A study of colon-specific gene regulation (Page 112-120)