• No results found

AMPLIFICATION REFRACTORY MUTATION SYSTEM (ARMS)

MOLECULAR DIAGNOSIS

5.3 DIAGNOSIS OF KNOWN MUTATIONS

5.3.3 AMPLIFICATION REFRACTORY MUTATION SYSTEM (ARMS)

The ARMS technique for detecting known point mutations was first described by Newton et al [37]. It has been developed for the diagnosis of all the common β-thalassaemia mutations found in all the main ethnic groups [39]. The technique is based on the principle of allele-specific priming of the PCR process, i.e. a specific primer will only permit amplification to take place when its 3’ terminal nucleotide matches with its target sequence. Thus to detect the β-thalassaemia mutation IVSI-5 (G C), the 3’ nucleotide of the ARMS primer is G in order to base pair with the substituted C in the mutant DNA. The primer forms a G-G mismatch with normal DNA, but this is a weak mismatch and will not prohibit extension of the primer by itself. Only strong mismatches (C-C, G-A and A-A) were found to reduce priming efficiency to zero or below-5%, and to prevent amplification, a further mismatch with the target sequence had to be introduced at the second, third or fourth nucleotide from the 3’ end of the primer (70).

As a general rule for ARMS primer design, if the 3’ terminal mismatch is a weak one, a strong secondary mismatch is engineered. If it is a strong one, a weak secondary mismatch is introduced. Usually the mismatch is designed at the second nucleotide in the first instance and the primer then tested for specificity and generation of product. The position of the mismatch can be altered if the primer does not work, or the strength of the mismatch increased if non-specific bands are observed. According to Little in Current Protocols in Human Genetics (71), the strength of mismatch pairings are; maximum, G-A, C-T, T-T; strong, C-C; medium, A-A, G-G; weak, C-A, G-T; none, A-T, G-C.

The mutation-specific ARMS primers used in the Oxford laboratory to diagnose the 25 most com- mon β-thalassaemia mutations, plus the haemoglobin variants HbS, HbC and HbE, are listed in

Table 5.5. All are 30 bases long so that they can all be used at a single high annealing temperature (65ºC).

Table 5.5: Primer sequences used for the detection of the common β-thalassaemia and β-chain variant mutations by ARMS-PCR.

Legend: The above primers are coupled as indicated with either primer A: CCCCTTCCTATGACATGAACTTAA, B: ACCTCACCCTGTGGAGCCAC;C: TTCGTCTGTTTCCCATTCTAAACT; or D: GAGTCAAGGCTGAGAGATGCAGGA. The control primers used were primers D plus E: CAATGTATCATGCCTCTTTGCACC (which yield a 861 bp prod- uct as shown in Figure 1) for all the above mutation specific ARMS primers except the two marked *. Control primers used with these two are the Gγ-Hind III RFLP primers described in Table 5.9

A typical ARMS test for a single mutation consists of two amplifications in the same reaction mix- ture using the same genomic DNA as substrate. One amplification product results from the spe- cific ARMS primer and its primer pair (when the mutation is present in the genomic DNA) and the other amplification results from two primers that generate a control fragment amplified from an unrelated region of the genome under the same PCR conditions. The generation of control prod- uct indicates the reaction mixture and thermal cycler is working optimally. Figure 5.7 shows the screening of a DNA sample for a β-thalassaemia mutation. The strategy is to screen for the com- mon mutations expected in the country of the ethnic origin of the patient first and then to screen for the rarer mutations. After which, uncharacterised mutations are identified by genomic sequencing.

Primers for the diagnosis of the normal alleles for many of these mutations are listed in Table 5.6.

These are required when both partners of a couple requesting prenatal diagnosis of β-thalassaemia carry the same mutation. An example of prenatal diagnosis using mutant and normal ARMS prim- ers is shown in Figure 5.8.

FIG. 5.7

An example of screening for common β-thalassaemia mutations by ARMS-PCR. Ethidium bromide stained gel showing the screening of a DNA sample for four com- mon Asian Indian β-thalassaemia mutations by ARMS- PCR: track1, IVSI-5 (G C); 2, IVSI-1 (G T); 3, Cd 41/42 (-TCTT); 4, Cd 8/9 (C T). The results show the patient carries the mutation IVSI-1 (G T). The control primers D and E produce an 861 bp fragment with normal DNA, present in all four lanes. The primers used are listed in Table 5.4.

FIG. 5.8

An example of prenatal diagnosis by ARMS-PCR. The ethidium bromide stained gel shows the results of a prenatal diagnosis for β-thalassaemia for IVSI-5 (G C) (both parents are carriers for IVSI-5 G C) using ARMS primers listed in Tables 5.4 and 5.5. Lanes 1 and 2 show paternal and maternal DNA samples tested with mutant primer, lane 3 shows a homozygous IVSI-5 (G C) control DNA sample tested with normal primer, and lanes 4 and 5 show fetal DNA tested with mutant primer and normal primer respectively. The generation of the ARMS-specific 285 bp product with normal primer and the absence of any 285bp product with mutant primer indicates the fetus is normal.

Table 5.6: Primer sequences used for the detection of normal DNA sequences by ARMS-PCR.

See Table 5.5 legend for details of primers A-D and control primers.

Reagents:

dNTPs: Add together 50 μl of a 100 mM solution of each dNTP (as purchased) and 3.8 ml of distilled water. The 1.25 mM dNTP stock solution should be stored in frozen aliquots.

ARMS-PCR buffer: 50 mM KCl, 10 mM Tris-HCl (pH 8.3 at room temperature), 1.5 mM MgCl2, 100 μg/ml gelatin. A 10x stock buffer can be prepared by adding together 0.5 ml of 1 M Tris-HCl (pH 8.3 at room temperature), 1.25 ml of 2 M KCl, 75 μl of 1 M MgCl2, 5 mg gelatin, and 3.275 ml of distilled water. The stock buffer is heated at 37ºC until the gelatin dissolves and then frozen in aliquots. Taq polymerases: suggested ones are as follows, AmpliTaq Gold (PE Biosystems) works best for ARMS-PCR/RE digestion assays and Platinum Taq (Gibco Life Technologies) for gap-PCR (see Methods).

Tris-borate-EDTA (TBE) buffer: 89 mM Tris-borate, 89 mM boric acid,10 mM EDTA (pH 8.0).

a. b.

c.

Method:

Prepare a reaction mixture for 200 reactions (4 ml) comprising of: 0.5 ml of 10x ARMS-PCR buff- er;1.25 ml of 1.35 mM dNTP mixture; 2.65 ml of sterile distilled water

Pipette 20 μl of PCR reaction mixture into a 0.5 μl tube. Add 1 μl of each primer (1 OD unit/ml).

Add 0.05 μl of Taq polymerase (5 U/μl).

When more than one test is being performed, a primer and the enzyme can be mixed together in a separate tube before addition to the reaction mix. This decreases pipetting errors as larger quanti- ties are used.

Add 1 μl of genomic DNA (100 ng/μl). Overlay with 25 μl of mineral oil.

Mix, centrifuge and place in thermal cycler.

Amplify for 25 cycles as follows: 1 min at 94ºC/1 min at 65ºC/1.5 min at 72ºC with a final extension period of 3 min at 72ºC following the 25th cycle.

Remove tubes from thermal cycler and add 5 μl of blue dye. Mix and centrifuge. Load a 20 μl aliquot onto a 3% agarose gel and run at 100 V for approx. 45 min in TBE

Stain gel in ethidium bromide solution (0.5 μg/ml) for 15-30 minutes, visualise bands on a UV light box (312 nm) and photograph with an electronic camera system or a Polaroid CU-5 camera fitted with an orange filter (e.g. Wratten 22A).