REVERSE DOT BLOT (RDB)

Reverse dot-blot analysis is a technique for immobilizing allele-specific oligonucleotide probes on a nylon membrane rather than the individual DNA samples. This is a non-radioactive method. In this format, multiple pairs of mutant and normal ASO probes are spotted on strips of nylon membranes. For each diagnostic test, a spotted strip containing many normal and mutant oligonucleotides, is hybridized with a specific DNA sample in order to screen many mutations. Reverse dot-blot analy- sis was first described by Saiki et al (29), and then developed later to screen many β-thalassaemia mutations in the Sicilian population and for use in prenatal diagnosis (30, 68).

The reverse dot-blot can be theoretically designed to detect any point mutation present in a deter- mined country after the conditions are carefully set-up. RDB is also used in Sicily to analyse α−tha- lassaemia (68) and δ-thalassaemia point mutations, and for the genotyping of the main β−globin gene variants (HbS, HbC, HbD, etc). A general outline of the method is described below, for detailed protocols refer to other publications [30, 68, 69].

The amplified DNA is labelled using 5’modified primers with biotin or during the amplification by biotin-16-dUTP. Genomic DNA is amplified in a 50 μl reaction volume contain each 5’ biotinylated amplified primer or adding biotin-16-dUTP (Roche) instead of dTTP during PCR reaction. If 5’ bioti- nylated primers are used, a 5’ biotin group is introduced during the final coupling step on the DNA synthesizer that can be purchased from company. In the protocol used in the laboratory of Dr. A. Giambona & Prof. A. Maggio, biotin-16-dUTP is introduced during the PCR program.

Method for the amplification and labelling of β-globin gene

The protocol described here uses two pairs of PCR primers for the simultaneous amplification of two β-globin DNA fragments (duplex PCR) that encompass all the known β-thalassaemia muta- tions. These four primers are used simultaneously in the same test tube for duplex PCR in which the leftward pair directs amplification of a 735 bp fragment and the right pair a 526 bp fragment. The leftward primer pair consists of upstream primer 5’GTACGGCTGTCATCACTTAGACCTCA3’, and downstream primer 5’TCATTCGTCTGTTTCCCATTCTAAAC3’.

The rightward primer pair consists of: upstream primer 5’GGGTTAAGGCAATAGCAAT3’, and the downstream primer 5’CTGACCTCCCACATTCCCTT3’.

The following amplification buffer and thermal cycling conditions are adopted for β-globin gene PCR and to label DNA by biotin.

In the amplification reaction, target DNA (0.2 μg) is amplified in a 50 μl reaction mixture containing: 10 pm of each primer

1x PCR buffer, 1.5 mM MgCl2,

100 μM dNTPs,

10 μM biotin-16-dUTP (Roche)

2 U recombinant Taq polymerase (Invitrogene).

One cycle is performed at 94°C for 5 min, 30 cycles at 94°C for 45 s, 55°C for 45 s and 72°C for 45 s, followed by a final extension step at 72°C for 7 min.

1. 2. 3. 4. 5. 6.

Method for the amplification and labelling of α-globin gene:

Both α2 and α1 globin gene were amplified selectively by choosing one primer in the 3’ region of divergence between the α2 and α1 genes, and a common 5’ primer for both genes. The fragments are 923 bp for the α2 and 922 bp for the α1 globin gene.

The common 5’ α2 and α1 primer is CCAAGCATAAACCCTGGCGCGCT. The primer in 3’ region of α2 is AACACCTCCATTGTTGGCACATTCC. The primer in 3’ region of α1 is CCATGCTGGCACGTTTCTGAG.

Two 50 μl amplification reactions are set up for each DNA sample to be typed, one each for α2 and α1 genes.

The amplification buffer consists of: 10 pm of each primer, 2.5 mM MgCl₂, 50 mM Tris-HCl pH 8.9, 100 mM dNTPs, 10 μM biotin-16-dUTP, 13% glycerol and

2 U native Taq Polymerase (Invitrogene).

A total of 30 cycles are performed: 5 cycles at 98°C for 45 s, 55°C for 30 s, 72°C for 45 s; and 25 cycles at 96°C for 30 s, 55 °C for 30 s, 75°C for 45 sec; and finally, an additional 72°C for 7 min ex- tension step was included.

Hybridisation of amplified DNA:

Oligonucleotide probes are 5’ amino-modified. A NH₂ group is added during the last step of the synthesis (MWG-Biotech AG).

Table 5.3 lists the sequences and the quantitities of each β−globin gene applied to filters in picomoles.

Table 5.4 lists the sequences and the quantitities of each α2 and α1 globin gene applied to filters in picomoles.

Membrane Biodyne-C (PALL-Biosupport) is activated by 16% EDC (1-ethyl-3-dimethylaminopropyl carbodiimide, Sigma) for 15 min. It is rinsed in water and air dried.

Oligonucleotide probes are diluted with 0.5 M NaHCO₃/Na₂CO₃ buffer pH 8.4 to the concentrations as showed in Tables 5.3 and 5.4 for application onto the membrane.

Oligonucleotide probes are spotted on the surface, approximately 1 μl to each spot of the mem- brane using a 2 μl pipette. On the left and on the right of the same lane are spotted the normal and the mutant oligonucleotides.

Membrane is air dried and inactivated in 0.1 M NaOH for 10 min. The membrane is then rinsed thoroughly with water and air-dried. Membrane strips prepared in such a manner can be stored at room temperature in a desiccator for up 6 months.

Each filter with bound oligonucleotide probes are placed in 3 ml hybridization solution of 2x SSC and 0.1% SDS.

20 μl amplified DNA is diluted with 0.5 ml of hybridization solution (2x SSC and 0.1% SDS) and de- natured at 95°C for 5 min.

The denatured DNA is then added immediately to 3 ml hybridization solution and incubated at 45°C for 60 min in a shaker water incubator.

1. 2. 3. 4. 5. 6. 7. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10.

Table 5.3 Oligonucleotide probe sequences and the quantity (pmol of each applied to the filter) used for the diagnosis of Sicilian β-thalassaemia mutations by Reverse Dot Blot (RDB).

Table 5.4 Oligonucleotide probe sequences and the quantity (pmol of each applied to the filter) used for the diagnosis of α-thalassaemia mutations by Reverse Dot Blot (RDB).

They are then collectively incubated in 20 ml 2x SSC and 0.1% SDS solution containing 5 U of streptavidin-AP conjugation (Roche) for 30 min at room temperature.

Membranes are washed 2 times for 15 min at room temperature in 2x SSC and SDS.

Colour development is performed by incubating the filters at room temperature in the dark for 30 min in freshly prepared solution containing nitroblue tetrazolium chloride salt (NBT, Roche) and bromo-chloro-indolyl-phosphatase salt (BCIP, Roche) in Tris HCl pH 9.4. Colour is developed in 30-45 min.

The filters are washed twice in distilled water by shaking.

Figure 5.2 illustrates the main steps involved in the generation of a Reverse Dot Blot using immo- bilized ASO probe.

Interpretation of results: It is important to emphasise that there must be a differentiation between false positive due to background signals and the true positive results of the control samples. If in doubt the assay should always be repeated. The strategy, as with ARMS-PCR, is to screen for the common mutations on one membrane and then if no positive result is obtained, the rare ones are screened for on a second membrane. Any mutation remaining unidentified is then investigated by direct sequencing.

12. 13. 14.

Figures 5.3-5.6 show examples of results of the RDB method obtained from the laboratory of Dr. A. Giambona and Prof. A. Maggio. Figure 5.3 shows RDB being used to screen for the 7 most common mutations found in Sicily. These account for 95% of the β-thalassaemia defects in Sicily. Figure 5.4

shows RDB being used for prenatal diagnosis of β-thalassaemia. Figures 5.5 and 5.6 show RDB being used to detect α-thalassaemia and δ-thalassaemia point mutations.

FIG. 5.2

The main steps involved in “Reverse Dot Blot Analysis”.

FIG. 5.3

An example of a reverse dot-blot analysis that shows two individuals tested for the presence of the most common Mediterranean mutations. On the left is a carrier positive for the Cd 39 (C T) point mutation, while on the right a IVSI-6 (T C) point muta- tion is identified.

N: normal oligonucleotides; M: mutant oligonucleotides.

FIG. 5.4

An example of prenatal diagnosis by RDB. On the left (A) a prenatal diag- nosis for Cd 39 (C T) [both parents are carriers for Cd 39]. The fetus is homozygous for the Cd 39 mutation. On the right (B) a prenatal diagnosis for IVSI-110 (G A) and IVSI-6 (T C) (the fetus is heterozygous for IVSI- 110 and IVSI-6 mutations).

FIG. 5.5

Reverse dot blot strips of non-deletion α+_{-thalassaemia defects after hy-}

bridization and colour development. Hybridization probes complementary to the six common Mediterranean α-thalassaemia mutations and non- Mediterranean mutations are fixed to these reverse dot blot strips. On each filter, the normal probes are on the right and the mutant probes are on the left. The mutations represented by each probe are listed above, and the genotypes of the DNA samples tested are listed below.

FIG. 5.6

Strip A shows the mutation 3’IVSII (A G) in the δ-globin gene. Strip B shows the Cd 27 (G T) mutation of the δ-globin gene, the most frequent mutation in Sicily. Tab A and B are the phenotype of the respective mutations.