CHAPTER 3: Prostate specific transglutaminase TGM4 activity
3.2.1 Cloning of Human SEMGs and TGM4 into pFastBac1 vector
Dr. Hiroshi Miyamoto from the University of Rochester Medical Center, generously donated pSG5 plasmids containing full-length human SEMG1 and SEMG2 cDNA. A clone containing the full coding sequence of human TGM4 (IMAGE clone ID:3950865; GenBank ID:BC007003.1) was purchased from ThermoFisher Scientific (Waltham, MA). I designed primers that matched the beginning and end of SEMG1, SEMG2, and TGM4 sequence with the addition of restriction enzyme sites (SEMG1: SalI/PstI; XhoI/SphI, SEMG2: SalI/XbaI;
XhoI/SphI, TGM4: SalI/XbaI; XhoI/SphI) matching pFastBac1 (Invitrogen, Carlsbad, CA) vector,
a C-terminal HIS tag sequence, and random nucleotides on the ends to allow restriction enzymes to work properly (Table 3.1). The semenogelins and TGM4 were amplified with iProof™ DNA polymerase (BioRad, Hercules, CA) under the following conditions: (98°C, 30”)/(98°C, 10”/ 55°C, 15”/ 72°C, 1’)35 /(72°C, 10’)/(4°C, ∞). Initially, traditional cloning (digestion, ligation, and transformation) of the PCR products was attempted, but was unsuccessful. Subsequently, the gene amplified products were purified with the Wizard® SV gel and PCR clean-up system (Promega, Madison, WI), and incubated at 72°C for 15 minutes with Taq polymerase, thus incorporating additional A’s to the 3’ ends before TOPO® TA cloning (Invitrogen) and plating
onto LB kanamycin/IPTG/X-gal plates. TOPO® transformants were grown overnight at 37°C in LB ampicillin and DNA was extracted using the IBI high speed plasmid mini kit (Midsci, St. Louis, MO). Candidates were sequenced with BigDye® Terminator v3.1 (Thermofisher Scientific) with the following conditions: (96.0°C, 10”/50°C 5”/60°C, 4’)35 /(4°C, ∞), and analyzed on the Avant 3100 sequencer (Applied Biosystems, Foster City, CA). Vector and gene specific sequencing primers were used and are included in Appendix A.7 (Table A.14).
Table 3.1: Modified primers used for human gene construct cloning
Gene Primer Sequence Human SEMG1 Forward: 5’- CAGAATGCCGTCGACCTGCAGATGAAGCCCAACATCATCTTTGTACTTTCCCTG-3’ Reverse: 5’- ACGGTGATCGCATGCCTCGAGTTAATGGTGATGGTGATGGTGTGTAAATAATGGGTTT CGGTCGTTGTTAAG-3’ Human SEMG2 Forward: 5’- GGCTATCGATCGTCGACTCTAGAATGAAGTCCATCATCCTCTTTGTCC-3’ Reverse: 5’- GCCTATGCGCATGCCTCGAGTTAATGGTGATGGTGATGGTGTGTAGATATTGGATTTC TGTCTTCATTATA-3’ Human TGM4 Forward: 5’- CGAGTCAGGTCGACTCTAGAATGATGGATGCATCAAAAGAGCTGC-3’ Reverse: 5’- TAGACTCATCGGCATGCCTCGAGTTAATGGTGATGGTGATGGTGCTTGGTGATGAGAA CAATCTTCTGAGCATTAATC-3’
SEMGs and TGM4 gene orientation in the TOPO® vector was determined; and 20µl of
the TOPO® - SEMG1, SEMG2, or TGM4 clone (approximately 1.5- 7µg DNA) was digested with NotI / SalI or NotI/ Acc65I in multicore buffer (Promega) as well as 20µl of pFastBac1 (Invitrogen) vector (about 3.5 µg of vector DNA), for four hours at 37°C and then terminated at 65°C for ten minutes. The pFastBac1 vector was then incubated with alkaline phosphatase (Promega) at 37°C for one hour. Alkaline phosphatase removes 5’ phosphates in order to prevent
re-circularization of the vector. The digested and/or dephosphorylated products were extracted with the Wizard® SV gel and PCR clean-up system (Promega) and quantified with the Qubit® dsDNA BR assay kit on the Qubit® 2.0 fluorometer (Invitrogen). Both 1:1 and 3:1
(insert:vector) DNA ratios (~100-200ng DNA total) were added to separate ligation reactions (total volume 10µl) and incubated with T4 ligase (Promega) in the thermocycler at the following increasing temperatures for sixty minute increments (4°C, 6°C, 8-16°C). Entire ligation reactions (10µl) were transferred to 200µl of thawed TG1 chemically competent E. coli cells and put on ice for 20 minutes. Cells were heatshocked at 42°C for 45 seconds and immediately transferred to ice for two minutes. Cells were added to 500µl of LB broth in a culture tube and incubated at 37°C and 250 rpm for one hour. After incubation, 50µl and 250µl of each culture were spread onto LB carbenicillin plates and incubated 16-18 hours at 37°C. Single colonies were transferred to a 3mL LB ampicillin tube, and to an LB carbenicillin replicate plate, and incubated overnight at 37°C. Freezer stocks were made from 750µl of culture with 250µl 60% glycerol and stored at - 80°C. The remaining 2.25mL culture’s DNA was extracted with the IBI high-speed plasmid mini kit (Midsci). Candidates were sequenced with BigDye® Terminator (Thermofisher Scientific) at the following conditions: (96.0°C, 10”/50°C 5”/60°C, 4’)35 /(4°C, ∞), and analyzed on the Avant
3100 sequencer (Applied Biosystems). Verified constructs were grown in 50mL LB ampicillin cultures and DNA was extracted using the Pureyield™ plasmid midiprep system (Promega). 3.2.1.2 Site-directed mutagenesis of human TGM4
The pcDNA-TGM4 plasmid used to subclone human TGM4 into pFastBac1 had one nonsynonymous mutation at 1125 bases in the sequence. This missense variant converts a proline (CCG) codon to a serine (TCG) codon. After searching for common single nucleotide
addition, PolyPhen and SIFT missense effect indexes indicated this mutation would most likely be deleterious. Therefore, QuickChange II Site-directed mutagenesis (Agilent Technologies, Santa Clara, CA) was utilized to modify the mutated human TGM4 to the common proline (CCG) variant in the population.
Human TGM4 pFastBac1 template (10ng and 50ng) was amplified with 5.7µl of 20nM mutagenetic primers (Table 3.2) at the following conditions: (95°C, 1’)/(95°C, 50”/60°C, 50”/ 68°C, 16’)18 /(68°C, 8’) /(4°C, ∞). Then 1µl of DpnI was added to each reaction and incubated at
37°C for 2 hours and 80°C for 20 minutes. XL1-Blue chemically competent E. coli cells (Agilent Technologies) were aliquoted (50µl) into pre-chilled tubes and incubated on ice for several minutes. Then 1µl (5ng reaction) or 4µl (10ng reaction) of DpnI digested DNA was added to the cells and incubated on ice for thirty minutes. Cells were heat shocked at 42°C for 45 seconds, and immediately incubated on ice for two minutes. Transformed cells were transferred to a 0.5mL NZY+ broth (preheated to 42°C) and incubated at 37°C and 250 rpm for one hour. After incubation, 250µl of cells were spread onto LB carbenicillin/ 2%XGAL/ 10mM IPTG plates and grown overnight at 37°C. Freezer stocks were made from 750µl of culture with 250µl 60% glycerol and stored at -80°C. The remaining 2.25mL culture’s DNA was extracted with the IBI high speed plasmid mini kit (Midsci). Candidates were sequenced with BigDye® Terminator (Thermofisher Scientific) at the following conditions: (96.0°C, 10”/50°C 5”/60°C, 4’)35 /(4°C,
∞), and analyzed on the Avant 3100 sequencer (Applied Biosystems). Verified constructs were grown in 50mL LB ampicillin cultures and DNA was extracted using the Pureyield™ plasmid midiprep system (Promega).
Table 3.2: Mutagenic primers used for human TGM4 modification
Gene Mutagenic Primer Sequence Human TGM4
1: 5’– GCTGTGGACGCAACGCCGCAGGAGCGAAGCC–3’ 2: 5’– GGCTTCGCTCCTGCGGCGTTGCGTCCACAGC–3’
3.2.2 Gibson assembly of human and chimpanzee KLK3s and chimpanzee and